Complete analysis of G-quadruplex forming sequences in the gapless assembly of human chromosome Y.

Recent advancements have finally delivered a complete human genome assembly, including the elusive Y chromosome. This accomplishment closes a significant knowledge gap. Prior efforts were hampered by challenges in sequencing repetitive DNA structures such as direct and inverted repeats. We used the G4Hunter algorithm to analyze the presence of G-quadruplex forming sequences (G4s) within the current human reference genome (GRCh38) and the new telomere-to-telomere (T2T) Y chromosome assemblies. This analysis served a dual purpose: identifying the location of potential G4s within the genomes and exploring their association with functionally annotated sequences. Compared to GRCh38, the T2T assembly exhibited a significantly higher prevalence of G-quadruplex forming sequences. Notably, these repeats were abundantly located around precursor RNA, exons, genes, and within protein binding sites. This remarkable co-occurrence of G4-forming sequences with these critical regulatory regions suggests their role in fundamental DNA regulation processes. Our findings indicate that the current human reference genome significantly underestimated the number of G4s, potentially overlooking their functional importance.

Complex Biophysical and Computational Analyses of G-Quadruplex Ligands: The Porphyrin Stacks Back.

G-quadruplexes (G4 s), as non-canonical DNA structures, attract a great deal of research interest in the molecular biology as well as in the material science fields. The use of small molecules as ligands for G-quadruplexes has emerged as a tool to regulate gene expression and telomeres maintenance. Meso-tetrakis-(N-methyl-4-pyridyl) porphyrin (TMPyP4) was shown as one of the first ligands for G-quadruplexes and it is still widely used. We report an investigation comprising molecular docking and dynamics, synthesis and multiple spectroscopic and spectrometric determinations on simple cationic porphyrins and their interaction with different DNA sequences. This study enabled the synthesis of tetracationic porphyrin derivatives that exhibited binding and stabilizing capacity against G-quadruplex structures; the detailed characterization has shown that the presence of amide groups at the periphery improves selectivity for parallel G4 s binding over other structures. Taking into account the ease of synthesis, 5,10,15,20-tetrakis-(1-acetamido-4-pyridyl) porphyrin bromide could be considered a better alternative to TMPyP4 in studies involving G4 binding.

The influence of G-tract and loop length on the topological variability of putative five and six G-quartet DNA structures in the human genome.

Local variation of DNA structure and its dynamic nature play an essential role in the regulation of important biological processes. One of the most prominent noncanonical structures are G-quadruplexes, which form in vivo within guanine-rich regions and have been demonstrated to be involved in the regulation of transcription, translation and telomere maintenance. We provide an analysis of G-quadruplex formation in sequences with five and six guanine residues long G-tracts, which have emerged from the investigation of the gapless human genome and are associated with genes related to cancer and neurodegenerative diseases. We systematically explored the effect of G-tract and loop elongations by means of NMR and CD spectroscopy and polyacrylamide electrophoresis. Despite both types of elongation leading up to structural polymorphism, we successfully determined the topologies of four out of eight examined sequences, one of which contributes to a very scarce selection of currently known intramolecular four G-quartet structures in potassium solutions. We demonstrate that examined sequences are incompatible with five or six G-quartet structures with propeller loops, although the compatibility with other loop types cannot be factored out. Lastly, we propose a novel approach towards specific G-quadruplex targeting that could be implemented in structures with more than four G-quartets.

Special Issue "Bioinformatics of Unusual DNA and RNA Structures".

Nucleic acids are not only static carriers of genetic information but also play vital roles in controlling cellular lifecycles through their fascinating structural diversity [...].

G-quadruplex propensity in H. neanderthalensis, H. sapiens and Denisovans mitochondrial genomes.

Current methods of processing archaeological samples combined with advances in sequencing methods lead to disclosure of a large part of H. neanderthalensis and Denisovans genetic information. It is hardly surprising that the genome variability between modern humans, Denisovans and H. neanderthalensis is relatively limited. Genomic studies may provide insight on the metabolism of extinct human species or lineages. Detailed analysis of G-quadruplex sequences in H. neanderthalensis and Denisovans mitochondrial DNA showed us interesting features. Relatively similar patterns in mitochondrial DNA are found compared to modern humans, with one notable exception for H. neanderthalensis. An interesting difference between H. neanderthalensis and H. sapiens corresponds to a motif found in the D-loop region of mtDNA, which is responsible for mitochondrial DNA replication. This area is directly responsible for the number of mitochondria and consequently for the efficient energy metabolism of cell. H. neanderthalensis harbor a long uninterrupted run of guanines in this region, which may cause problems for replication, in contrast with H. sapiens, for which this run is generally shorter and interrupted. One may propose that the predominant H. sapiens motif provided a selective advantage for modern humans regarding mtDNA replication and function.

Abundance of G-Quadruplex Forming Sequences in the Hepatitis Delta Virus Genomes.

Hepatitis delta virus (HDV) is a highly unusual RNA satellite virus that depends on the presence of hepatitis B virus (HBV) to be infectious. Its compact and variable single-stranded RNA genome consists of eight major genotypes distributed unevenly across different continents. The significance of noncanonical secondary structures such as G-quadruplexes (G4s) is increasingly recognized at the DNA and RNA levels, particularly for transcription, replication, and translation. G4s are formed from guanine-rich sequences and have been identified in the vast majority of viral, eukaryotic, and prokaryotic genomes. In this study, we analyzed the G4 propensity of HDV genomes by using G4Hunter. Unlike HBV, which has a G4 density similar to that of the human genome, HDV displays a significantly higher number of potential quadruplex-forming sequences (PQS), with a density more than four times greater than that of the human genome. This finding suggests a critical role for G4s in HDV, especially given that the PQS regions are conserved across HDV genotypes. Furthermore, the prevalence of G4-forming sequences may represent a promising target for therapeutic interventions to control HDV replication.

Transactivation by partial function P53 family mutants is increased by the presence of G-quadruplexes at a promoter site.

The effect of mutations in the P53 family of transcription factors on their biological functions, including partial or complete loss of transcriptional activity, has been confirmed several times. At present, P53 family proteins showing partial loss of activity appear to be promising potential candidates for the development of novel therapeutic strategies which could restore their transcriptional activity. In this context, it is important to employ tools to precisely monitor their activity; in relation to this, non-canonical DNA secondary structures in promoters including G-quadruplexes (G4s) were shown to influence the activity of transcription factors. Here, we used a defined yeast assay to evaluate the impact of differently modeled G4 forming sequences on a panel of partial function P53 family mutant proteins. Specifically, a 22-mer G4 prone sequence (derived from the KSHV virus) and five derivatives that progressively mutate characteristic guanine stretches were placed upstream of a minimal promoter, adjacent to a P53 response element in otherwise isogenic yeast luciferase reporter strains. The transactivation ability of cancer-associated P53 (TA-P53α: A161T, R213L, N235S, V272L, R282W, R283C, R337C, R337H, and G360V) or Ectodermal Dyplasia syndromes-related P63 mutant proteins (ΔN-P63α: G134D, G134V and inR155) were tested. Our results show that the presence of G4 forming sequences can increase the transactivation ability of partial function P53 family proteins. These observations are pointing to the importance of DNA structural characteristics for accurate classification of P53 family proteins functionality in the context of the wide variety of TP53 and TP63 germline and somatic mutations.

DNA Quadruplex Structure with a Unique Cation Dependency.

DNA quadruplex structures provide an additional layer of regulatory control in genome maintenance and gene expression and are widely used in nanotechnology. We report the discovery of an unprecedented tetrastranded structure formed from a native G-rich DNA sequence originating from the telomeric region of Caenorhabditis elegans. The structure is defined by multiple properties that distinguish it from all other known DNA quadruplexes. Most notably, the formation of a stable so-called KNa-quadruplex (KNaQ) requires concurrent coordination of K+ and Na+ ions at two distinct binding sites. This structure provides novel insight into G-rich DNA folding under ionic conditions relevant to eukaryotic cell physiology and the structural evolution of telomeric DNA. It highlights the differences between the structural organization of human and nematode telomeric DNA, which should be considered when using C. elegans as a model in telomere biology, particularly in drug screening applications. Additionally, the absence/presence of KNaQ motifs in the host/parasite introduces an intriguing possibility of exploiting the KNaQ fold as a plausible antiparasitic drug target. The structure's unique shape and ion dependency and the possibility of controlling its folding by using low-molecular-weight ligands can be used for the design or discovery of novel recognition DNA elements and sensors.

The presence of a G-quadruplex prone sequence upstream of a minimal promoter increases transcriptional activity in the yeast Saccharomyces cerevisiae.

Non-canonical secondary structures in DNA are increasingly being revealed as critical players in DNA metabolism, including modulating the accessibility and activity of promoters. These structures comprise the so-called G-quadruplexes (G4s) that are formed from sequences rich in guanine bases. Using a well-defined transcriptional reporter system, we sought to systematically investigate the impact of the presence of G4 structures on transcription in yeast Saccharomyces cerevisiae. To this aim, different G4 prone sequences were modeled to vary the chance of intramolecular G4 formation, analyzed in vitro by Thioflavin T binding test and circular dichroism and then placed at the yeast ADE2 locus on chromosome XV, downstream and adjacent to a P53 response element (RE) and upstream from a minimal CYC1 promoter and Luciferase 1 (LUC1) reporter gene in isogenic strains. While the minimal CYC1 promoter provides basal reporter activity, the P53 RE enables LUC1 transactivation under the control of P53 family proteins expressed under the inducible GAL1 promoter. Thus, the impact of the different G4 prone sequences on both basal and P53 family protein-dependent expression was measured after shifting cells onto galactose containing medium. The results showed that the presence of G4 prone sequences upstream of a yeast minimal promoter increased its basal activity proportionally to their potential to form intramolecular G4 structures; consequently, this feature, when present near the target binding site of P53 family transcription factors, can be exploited to regulate the transcriptional activity of P53, P63 and P73 proteins.

G-quadruplexes in the evolution of hepatitis B virus.

Hepatitis B virus (HBV) is one of the most dangerous human pathogenic viruses found in all corners of the world. Recent sequencing of ancient HBV viruses revealed that these viruses have accompanied humanity for several millenia. As G-quadruplexes are considered to be potential therapeutic targets in virology, we examined G-quadruplex-forming sequences (PQS) in modern and ancient HBV genomes. Our analyses showed the presence of PQS in all 232 tested HBV genomes, with a total number of 1258 motifs and an average frequency of 1.69 PQS per kbp. Notably, the PQS with the highest G4Hunter score in the reference genome is the most highly conserved. Interestingly, the density of PQS motifs is lower in ancient HBV genomes than in their modern counterparts (1.5 and 1.9/kb, respectively). This modern frequency of 1.90 is very close to the PQS frequency of the human genome (1.93) using identical parameters. This indicates that the PQS content in HBV increased over time to become closer to the PQS frequency in the human genome. No statistically significant differences were found between PQS densities in HBV lineages found in different continents. These results, which constitute the first paleogenomics analysis of G4 propensity, are in agreement with our hypothesis that, for viruses causing chronic infections, their PQS frequencies tend to converge evolutionarily with those of their hosts, as a kind of 'genetic camouflage' to both hijack host cell transcriptional regulatory systems and to avoid recognition as foreign material.

Variability of Inverted Repeats in All Available Genomes of Bacteria.

Noncanonical secondary structures in nucleic acids have been studied intensively in recent years. Important biological roles of cruciform structures formed by inverted repeats (IRs) have been demonstrated in diverse organisms, including humans. Using Palindrome analyser, we analyzed IRs in all accessible bacterial genome sequences to determine their frequencies, lengths, and localizations. IR sequences were identified in all species, but their frequencies differed significantly across various evolutionary groups. We detected 242,373,717 IRs in all 1,565 bacterial genomes. The highest mean IR frequency was detected in the Tenericutes (61.89 IRs/kbp) and the lowest mean frequency was found in the Alphaproteobacteria (27.08 IRs/kbp). IRs were abundant near genes and around regulatory, tRNA, transfer-messenger RNA (tmRNA), and rRNA regions, pointing to the importance of IRs in such basic cellular processes as genome maintenance, DNA replication, and transcription. Moreover, we found that organisms with high IR frequencies were more likely to be endosymbiotic, antibiotic producing, or pathogenic. On the other hand, those with low IR frequencies were far more likely to be thermophilic. This first comprehensive analysis of IRs in all available bacterial genomes demonstrates their genomic ubiquity, nonrandom distribution, and enrichment in genomic regulatory regions. IMPORTANCE Our manuscript reports for the first time a complete analysis of inverted repeats in all fully sequenced bacterial genomes. Thanks to the availability of unique computational resources, we were able to statistically evaluate the presence and localization of these important regulatory sequences in bacterial genomes. This work revealed a strong abundance of these sequences in regulatory regions and provides researchers with a valuable tool for their manipulation.

Dual mode of IFI16 binding to supercoiled and linear DNA: A closer insight.

IFI16 (Interferon inducible protein 16) is a DNA sensor responsible for innate immune response stimulation and a direct viral restriction by modulating gene expression and replication. Many IFI16-DNA binding properties were described - length-dependent and sequence-independent binding, oligomerization of IFI16 upon recognition, sliding on the DNA, and preference for supercoiled DNA. However, the question of the role of IFI16-DNA binding in distinct IFI16 functions remains unclear. Here we demonstrate two modes of IFI16 binding to DNA using atomic force microscopy and electrophoretic mobility shift assays. In our study, we show that IFI16 can bind to DNA in the form of globular complexes or oligomers depending on DNA topology and molar ratios. The stability of the complexes is different in higher salt concentrations. In addition, we observed no preferential binding with the HIN-A or HIN-B domains to supercoiled DNA, revealing the importance of the whole protein for this specificity. These results provide more profound insight into IFI16-DNA interactions and may be important in answering the question of self- and non-self-DNA binding by the IFI16 protein and potentially could shed light on the role of DNA binding in distinct IFI16 functions.

G-quadruplex ligands as potent regulators of lysosomes.

Guanine-quadruplex structures (G4) are unusual nucleic acid conformations formed by guanine-rich DNA and RNA sequences and known to control gene expression mechanisms, from transcription to protein synthesis. So far, a number of molecules that recognize G4 have been developed for potential therapeutic applications in human pathologies, including cancer and infectious diseases. These molecules are called G4 ligands. When the biological effects of G4 ligands are studied, the analysis is often limited to nucleic acid targets. However, recent evidence indicates that G4 ligands may target other cellular components and compartments such as lysosomes and mitochondria. Here, we summarize our current knowledge of the regulation of lysosome by G4 ligands, underlying their potential functional impact on lysosome biology and autophagic flux, as well as on the transcriptional regulation of lysosomal genes. We outline the consequences of these effects on cell fate decisions and we systematically analyzed G4-prone sequences within the promoter of 435 lysosome-related genes. Finally, we propose some hypotheses about the mechanisms involved in the regulation of lysosomes by G4 ligands.

Genomic Analysis of Non-B Nucleic Acids Structures in SARS-CoV-2: Potential Key Roles for These Structures in Mutability, Translation, and Replication?

Non-B nucleic acids structures have arisen as key contributors to genetic variation in SARS-CoV-2. Herein, we investigated the presence of defining spike protein mutations falling within inverted repeats (IRs) for 18 SARS-CoV-2 variants, discussed the potential roles of G-quadruplexes (G4s) in SARS-CoV-2 biology, and identified potential pseudoknots within the SARS-CoV-2 genome. Surprisingly, there was a large variation in the number of defining spike protein mutations arising within IRs between variants and these were more likely to occur in the stem region of the predicted hairpin stem-loop secondary structure. Notably, mutations implicated in ACE2 binding and propagation (e.g., ΔH69/V70, N501Y, and D614G) were likely to occur within IRs, whilst mutations involved in antibody neutralization and reduced vaccine efficacy (e.g., T19R, ΔE156, ΔF157, R158G, and G446S) were rarely found within IRs. We also predicted that RNA pseudoknots could predominantly be found within, or next to, 29 mutations found in the SARS-CoV-2 spike protein. Finally, the Omicron variants BA.2, BA.4, BA.5, BA.2.12.1, and BA.2.75 appear to have lost two of the predicted G4-forming sequences found in other variants. These were found in nsp2 and the sequence complementary to the conserved stem-loop II-like motif (S2M) in the 3' untranslated region (UTR). Taken together, non-B nucleic acids structures likely play an integral role in SARS-CoV-2 evolution and genetic diversity.

Analysis of G-Quadruplex-Forming Sequences in Drought Stress-Responsive Genes, and Synthesis Genes of Phenolic Compounds in Arabidopsis thaliana.

Sequences of nucleic acids with the potential to form four-stranded G-quadruplex structures are intensively studied mainly in the context of human diseases, pathogens, or extremophile organisms; nonetheless, the knowledge about their occurrence and putative role in plants is still limited. This work is focused on G-quadruplex-forming sites in two gene sets of interest: drought stress-responsive genes, and genes related to the production/biosynthesis of phenolic compounds in the model plant organism Arabidopsis thaliana. In addition, 20 housekeeping genes were analyzed as well, where the constitutive gene expression was expected (with no need for precise regulation depending on internal or external factors). The results have shown that none of the tested gene sets differed significantly in the content of G-quadruplex-forming sites, however, the highest frequency of G-quadruplex-forming sites was found in the 5'-UTR regions of phenolic compounds' biosynthesis genes, which indicates the possibility of their regulation at the mRNA level. In addition, mainly within the introns and 1000 bp flanks downstream gene regions, G-quadruplex-forming sites were highly underrepresented. Finally, cluster analysis allowed us to observe similarities between particular genes in terms of their PQS characteristics. We believe that the original approach used in this study may become useful for further and more comprehensive bioinformatic studies in the field of G-quadruplex genomics.

Quadruplexes and aging: G4-binding proteins regulate the presence of miRNA in small extracellular vesicles (sEVs).

The interaction between proteins and nucleic acids is a core element of life. Many proteins bind nucleic acids via a sequence-specific manner, but there are also many types of proteins that recognize various structural motifs. Researchers have recently found that proteins that can recognize DNA and RNA G-quadruplexes (G4s) are very important for basic cellular processes, particularly in eukaryotes. Some of these proteins are located outside the nucleus and interact with RNA, potentially affecting miRNA functions in intercellular communication, which is facilitated by small extracellular vesicles (sEVs). Imbalances in the production of sEVs are associated with various pathologies and senescence in humans. The distribution of miRNA into sEVs is regulated by two RNA-binding proteins, Alyref and FUS. Both proteins possess G-rich recognition motifs that are compatible with the formation of RNA parallel G4 structures. This lends credence to the new hypothesis that G4-formation in RNAs and their interaction with G4-binding proteins can affect the fate of miRNAs and control their distribution in sEVs that are associated with senescence and aging.

Interaction of C-terminal p53 isoforms depends strongly upon DNA sequence and topology.

The p53 protein is a key tumor suppressor and the most commonly mutated and down-regulated protein in human tumors. It functions mainly through interaction with DNA, and p53 acts as a transcription factor that recognizes the so-called p53 target sites on the promoters of various genes. P53 has been shown to exist as many isoforms, including three C-terminal isoforms that are produced by alternative splicing. Because the C-terminal domain is responsible for sequence-nonspecific binding and regulation of p53 binding, we have analyzed DNA recognition by these C-terminal isoforms. Using atomic force microscopy, we show for the first time that all C-terminal isoforms recognize superhelical DNA. It is particularly noteworthy that a sequence-specific p53 consensus binding site is bound by p53α and ß isoforms with similar affinities, whilst p53α shows higher binding to a quadruplex sequence than both p53ß and p53γ, and p53γ loses preferential binding to both the consensus binding sequence and the quadruplex-forming sequence. These results show the important role of the variable p53 C-terminal amino acid sequences for DNA recognition.

Inverted repeats in the monkeypox virus genome are hot spots for mutation.

The current monkeypox virus (MPXV) strain differs from the strain arising in 2018 by 50+ single nucleotide polymorphisms (SNPs) and is mutating much faster than expected. The cytidine deaminase apolipoprotein B messenger RNA editing enzyme, catalytic subunit B (APOBEC3) was hypothesized to be driving this increased mutation. APOBEC has recently been identified to preferentially mutate cruciform DNA secondary structures formed by inverted repeats (IRs). IRs were recently identified as hot spots for mutation in severe acute respiratory syndrome coronavirus 2, and we aimed to identify whether IRs were also hot spots for mutation within MPXV genomes. We found that MPXV genomes were replete with IR sequences. Of the 50+ SNPs identified in the 2022 outbreak strain, 63.9% of these were found to have arisen within IR regions in the 2018 reference strain (MT903344.1). Notably, IR sequences found in the 2018 reference strain were significantly lost over time, with an average of 32.5% of these sequences being conserved in the 2022 MPXV genomes. This evidence was highly indicative that mutations were arising within IRs. This data provides further support to the hypothesis that APOBEC may be driving MPXV mutation and highlights the necessity for greater surveillance of IRs of MPXV genomes to detect new mutations.

Irradiation potentiates p53 phosphorylation and p53 binding to the promoter and coding region of the TP53 gene.

An essential factor of the DNA damage response is 53BP1, a multimeric protein that inhibits the resection-dependent double-strand break (DBS) repair. The p53 protein is a tumor suppressor known as a guardian of the genome. Although the interaction between 53BP1 and its p53 partner is well-known in regulating gene expression, a question remains whether genome injury can affect the interaction between 53BP1 and p53 proteins or p53 binding to DNA. Here, using mass spectrometry, we determine post-translational modifications and interaction properties of 53BP1 and p53 proteins in non-irradiated and γ-irradiated cells. In addition, we used Atomic Force Microscopy (AFM) and Fluorescent Lifetime Imaging Microscopy combined with Fluorescence Resonance Energy Transfer (FLIM-FRET) for studies of p53 binding to DNA. Also, we used local laser microirradiation as a tool of advanced confocal microscopy, showing selected protein accumulation at locally induced DNA lesions. We observed that 53BP1 and p53 proteins accumulate at microirradiated chromatin but with distinct kinetics. The density of 53BP1 (53BP1pS1778) phosphorylated form was lower in DNA lesions than in the non-specified form. By mass spectrometry, we found 22 phosphorylations, 4 acetylation sites, and methylation of arginine 1355 within the DNA-binding domain of the 53BP1 protein (aa1219-1711). The p53 protein was phosphorylated on 8 amino acids and acetylated on the N-terminal domain. Post-translational modifications (PTMs) of 53BP1 were not changed in cells exposed to γ-radiation, while γ-rays increased the level of S6ph and S15ph in p53. Interaction analysis showed that 53BP1 and p53 proteins have 54 identical interaction protein partners, and AFM revealed that p53 binds to both non-specific and TP53-specific sequences (AGACATGCCTA GGCATGTCT). Irradiation by γ-rays enhanced the density of the p53 protein at the AGACATGCCTAGGCATGTCT region, and the binding of p53 S15ph to the TP53 promoter was potentiated in irradiated cells. These findings show that γ-irradiation, in general, strengthens the binding of phosphorylated p53 protein to the encoding gene.

The Newly Sequenced Genome of Pisum sativum Is Replete with Potential G-Quadruplex-Forming Sequences-Implications for Evolution and Biological Regulation.

G-quadruplexes (G4s) have been long considered rare and physiologically unimportant in vitro curiosities, but recent methodological advances have proved their presence and functions in vivo. Moreover, in addition to their functional relevance in bacteria and animals, including humans, their importance has been recently demonstrated in evolutionarily distinct plant species. In this study, we analyzed the genome of Pisum sativum (garden pea, or the so-called green pea), a unique member of the Fabaceae family. Our results showed that this genome contained putative G4 sequences (PQSs). Interestingly, these PQSs were located nonrandomly in the nuclear genome. We also found PQSs in mitochondrial (mt) and chloroplast (cp) DNA, and we experimentally confirmed G4 formation for sequences found in these two organelles. The frequency of PQSs for nuclear DNA was 0.42 PQSs per thousand base pairs (kbp), in the same range as for cpDNA (0.53/kbp), but significantly lower than what was found for mitochondrial DNA (1.58/kbp). In the nuclear genome, PQSs were mainly associated with regulatory regions, including 5'UTRs, and upstream of the rRNA region. In contrast to genomic DNA, PQSs were located around RNA genes in cpDNA and mtDNA. Interestingly, PQSs were also associated with specific transposable elements such as TIR and LTR and around them, pointing to their role in their spreading in nuclear DNA. The nonrandom localization of PQSs uncovered their evolutionary and functional significance in the Pisum sativum genome.