Achieving precise dual detection: One-tube reverse transcription-recombinase aided amplification (RT-RAA) combined with lateral flow strip (LFS) assay for RNA and DNA target genes from pepper mild mottle virus and Colletotrichum species in crude plant samples.

Ensuring the detection sensitivity of both RNA-derived and DNA-derived target genes in a single reaction has posed a significant challenge for on-site detection of plant pathogens. This challenge was addressed by developing a one-tube dual RT-RAA assay combined with LFS for the rapid on-site detection of pepper mild mottle virus (PMMoV) and four Colletotrichum species causing anthracnose in Solanaceous crops. By testing four different combinations of primer groups, two combinations were precisely adjusted within the dual RT-RAA system to balance amplification efficiency and maintain consistent levels of amplification in crude plant samples. Utilizing commercially accessible small-scale equipment and following a streamlined optimization strategy, the assay achieved a limit of detection of 0.32 copies/µL of target genes in the reaction. Importantly, it demonstrated no cross-reactivity with other plant pathogens, thereby affirming the high sensitivity and specificity of the developed dual RT-RAA-LFS detection assay. Moreover, the entire process took only 25 min from sample collection to the visible presentation of results. The assay was validated with 60 field samples and 10 seed samples, producing results consistent with reverse transcription quantitative polymerase chain reaction (RT-qPCR). Notably, it successfully detected PMMoV in systemic leaves without visible symptoms three days post-inoculation, underscoring its effectiveness in early disease detection. This streamlined strategy offers a valuable approach for rapid, low-cost, and highly sensitive on-site simultaneous detection of RNA genome-contained PMMoV and DNA genome-contained Colletotrichum species.

Sleep Disturbances in Health Professional Students During the COVID-19 Pandemic: A Concept Analysis.

AIM: The aim is to delineate the concept of sleep disturbances in health professional students during the COVID-19 pandemic. DESIGN: A concept analysis was conducted. METHODS: A systematic search was conducted for relevant articles published and performed from inception to July 5, 2024. Electronic databases searched included PubMed, Cumulative Index to Nursing and Allied Health Literature (CINAHL), Embase and Web of Science. Rodgers' method of evolutionary concept analysis was used. RESULTS: A total of 50 pertinent articles were included in our analysis. Utilising inductive thematic analysis, this study identified attributes, antecedents and consequences of sleep disturbances. Important attributes included insomnia, disrupted sleep patterns, altered sleep duration/nocturnal sleep duration and poor sleep quality. Antecedents encompassed factors such as gender, age/grade levels, physical activity, screen time of digital production, mental health issues, COVID-19-related stressors, financial strain and academic stress. Consequences included both mental and physical health implications. By addressing sleep disturbances and promoting better sleep health among students, we can enhance their learning and performance, which could translate to improved patient care outcomes. Additionally, understanding and mitigating sleep disturbances can contribute to the development of a more resilient and effective health care workforce, capable of providing high-quality care even during crises like the COVID-19 pandemic. PATIENT OR PUBLIC CONTRIBUTION: No patient or public contribution.

Tunnel construction worker safety state prediction and management system based on AHP and anomaly detection algorithm model.

Tunnels represent complex, high-risk, and technically demanding underground construction projects. The safety of construction workers in tunnels is influenced by various factors, including physiological indicators, tunnel dimensions, and internal environmental conditions. Analyzing safety based solely on static factors is inadequate for modern tunnel engineering safety management requirements. To address this challenge, this paper provides a comprehensive analysis of factors impacting safety and employs the Analytic Hierarchy Process (AHP) to identify seven significant factors with high importance: body temperature, heart rate, internal temperature, internal humidity, CO concentration, chlorine concentration, and the relative positioning of personnel. Considering these factors essential for assessing worker safety, we introduce a novel model named Tunnel-APH-AD. For training models aimed at anomaly detection, we performed data augmentation and utilized four distinct machine learning models. Additionally, ensemble learning techniques were applied to aggregate the predictions from individual models, thereby enhancing the effectiveness of detecting safety states for tunnel workers. We also evaluated the performance of these models on out-of-distribution (OOD) samples to test their robustness and generalizability. The experimental results indicate that, under similar ventilation and tunnel conditions, the ensemble learning model exhibits superior overall performance compared to individual models, underscoring the effectiveness of model combination in improving the accuracy and reliability of safety alerts. Through experimental validation, this study provides interpretable, scalable, and scientifically generalized applications of machine learning theories in systems for tunnel construction worker safety alerts. These findings contribute to advancing safety management practices in tunnel engineering, enabling proactive and effective measures to mitigate potential risks and ensure the well-being of workers.

First report of tomato as a natural host of tobacco vein banding mosaic virus (TVBMV) in Yunnan, China.

Tomatoes (Solanum lycopersicum L.), as a significant solanaceous crop, have attracted global research interest focused on elucidating its plant virus incidence, epidemiology, and pathogenicity, especially in field production (Li et al. 2021; Rivarez et al. 2023). Tobacco vein banding mosaic virus (TVBMV) is classified in the genus Potyvirus. Since its discovery, TVBMV has been documented to infect tobacco, potato, jimsonweed, wild eggplant under nature conditions (Wang et al. 2017). Also, TVBMV could be transmitted to tomatoes by aphids (Myzus persicae) in laboratory conditions (Bi et al. 2020). However, to date, there is no sequence representing TVBMV infecting tomato deposited in NCBI nucleotide database. In August 2023, about 30% of tomato planted in an open field showing typical viral disease symptoms (chlorosis, yellowing, mosaic, curling, and mottling) in Dali, Yunnan, China. To identify the potential pathogen, about 9 symptomatic leave from different plants were collected, pooled and sent for high-throughput sequencing. In summary, total RNA was extracted using TRIzol® Reagent (Invitrogen, CA, USA). Subsequently, RNA sequencing libraries were constructed using the TruSeq RNA sample prep kit (Illumina, CA, USA), followed by RNA-Seq sequencing performed on an Illumina HiSeq4000 platform (LC Sciences, USA). A total of 71,368,934 raw reads (paired-end) of the length 150-bp were generated. After quality control, 69,746,872 reads were retained and subjected to de novo assembly using Trinity (version 2.8.5). The assembled contigs (ranging from 186 nt to 15,573 nt) were searched against the NCBI non-redundant protein (NR) to detect potential viral pathogens using BLASTx with a cutoff e-value of 10-5. As a result, 2 viral contigs were assigned to 2 known viruses: TVBMV (Depth: 1960X, BLASTn similarity: 95.26%) and chilli veinal mottle virus (ChiVMV) (Depth: 3581X, BLASTn similarity: 98.22%). No other viruses and viroids were detected. The presence of TVBMV and ChiVMV were tested positive in all of the 9 samples originally collected. Notably, the detection primer for TVBMV identified in tomato (TVBMV-tomato) was designed from the newly assembled TVBMV genome (Forward: 5'- CTCGGTGAGGAAGGTGACATAAGT'; Reverse: 5'- CTTTCAACACCAGGGAATCTAGTG -3'). The nearly complete genome sequence of TVBMV-tomato was validated by overlapping RT-PCR and submitted to NCBI nucleotide database (accession: PP848192). To assess TVBMV-tomato infectivity, symptomatic tomato leaf sap was mechanically inoculated onto 4 healthy tomatoes, with healthy tomato leaf sap serving as a control. After 3 weeks, plants inoculated with symptomatic sap showed leaf curling and stunting, while control plants remained unaffected. All symptomatic samples tested positive for TVBMV via RT-PCR (4/4). For comparison, TVBMV could not be detected in the control sample. Sanger sequencing verified the expected 986 bp amplicon sequences. However, ChiVMV was also detected in all symptomatic tomato samples, which makes it possible that the symptoms after inoculation were the result of the synergism of TVBMV and ChiVMV. Phylogenetic analysis based on complete coding sequence revealed that TVBMV-tomato was most closely related to TVBMV identified from Solanum lyratum. To our knowledge, this work represents the first report of natural occurrence of TVBMV in agroecosystem in Yunnan, China.

First report of potato virus H infecting tomato (Solanum lycopersicum) in China.

Potato virus H (PVH), belonging to the genus Carlavirus in the family Betaflexiviridae, was initially discovered in potato plants in Inner Mongolia, China (Li et al., 2013). Subsequently, it was documented to infect pepino, a perennial shrub of the Solanaceae family like potatoes (Abouelnasr et al., 2014). Tomato (Solanum lycopersicum L.), a major global crop, faces threats from various plant viruses. In an open field survey in Yunnan, China during July 2023, tomatoes (cultivar: Liangsi) showed typical virus symptoms: leaf yellowing, curling, mottling, and fruit with abnormal shape and color. Eleven symptomatic tomato samples were collected for high-throughput sequencing to identify the potential pathogen. RNA sequencing libraries were prepared using the TruSeq RNA sample prep kit (Illumina, San Diego, CA, USA), followed by RNA-seq sequencing on an Illumina HiSeq4000 platform (LC Sciences, USA). Approximately 77,928,560 paired-end reads (150-bp each) were generated. After quality control, 75,808,296 reads were retained and subjected to de novo assembly using Trinity (version 2.8.5). The assembled contigs, ranging from 198 nt to 15865 nt, were used as queries to search against the NCBI non-redundant protein sequence database (NR) or nucleotide sequence database (NT) to detect the potential pathogens using BLASTx and BLASTn program with a cutoff e-value of 10-5. As a consequence, certain contigs were assigned to 3 plant viruses, including PVH (the highest RdRp blastx identity to UAD82396.1: 97.8%), Capsicum chlorosis virus (CaCV, the highest RdRp blastx identity to APQ31267.1: 98.4%), and southern tomato virus (STV, the highest CP-RdRp fusion protein blastx identity to QOW17541.1: 99.74%). The presence of the identified 3 viruses was subsequently screened in the 11 tomato samples originally collected from the corresponding field. Notably, the specific detection primers for the PVH genome was designed from the newly assembled PVH genome (Forward primer: 5'- ATAGTTGTGCACTGTGTGCCTG-3'; Reverse primer: 5'-GCTTAAGGTTCTTAGCGTATTC-3'), targeting ~1.1kb. Consequently, PVH was detected in 3 out of 11 samples: 2 leaf samples and 1 fruit sample, with one leaf sample showing a single infection. The complete genome sequence of PVH in tomatoes (PVH-tomato) was successfully obtained by assembling nine overlapping regions spanning the entire PVH-tomato genome, following the RT-PCR and the 5' RACE and 3' RACE approaches, and deposited in NCBI nucleotide database with accession number OR397130.1Phylogenetic analysis based on the full genome sequences of PVH-tomato and other publicly available PVH isolates revealed that PVH-tomato was closely related to a PVH isolate found in potatoes in Yunnan (blastn similarity: 97.76%) (Fig. S1A). To test PVH-tomato infectivity and pathogenicity, four healthy Nicotiana benthamiana and four healthy tomato plants were mechanically inoculated with PVH-infected leaf sap; controls used sap from healthy plants. Three weeks post-inoculation, all N. benthamiana (4/4) and three tomato plants (3/4) were PVH-positive by RT-PCR. Symptoms were milder in N. benthamiana, and only two tomato plants (2/4) showed leaf curling. No PVH was detected in control samples (Figure S1B, S1C). Sanger sequencing confirmed the amplicons' expected length of 1093 bp. Previously, PVH was documented only in potato and pepino. This is the first report of tomatoes as natural PVH hosts and PVH infecting N. benthamiana under lab conditions.

Nanorefractive index transducer using a ring cavity with an internal h-shaped cavity grounded on Fano resonance.

Building on the Fano resonance observation, a new refractive index transducer structure at the nanoscale is proposed in this article, which is a refractive index transducer consisting of a metal-insulator-metal (MIM) waveguide structure coupled with a ring cavity internally connected to an h-shaped structure (RCIhS). Using an analytical method based on COMSOL software and finite element method (FEM), the effect of different geometric parameters of the structure on the trans-mission characteristics of the system is simulated and analyzed, which in turn illustrates the effect of the structural parameters on the output Fano curves. As simulation results show, the internally connected h-shaped structure is an influential component in the Fano resonance. By optimizing the geometrical parameters of the structure, the system finally accomplishes a sensitivity (S) of 2400 nm/RIU and a figure of merit (FOM) of 68.57. The sensor has also been demonstrated in the realm of temperature detection, having tremendous potential for utilization in future nano-sensing and optically integrated systems.

Isothermal Nucleic Acid Amplification-Based Lateral Flow Testing for the Detection of Plant Viruses.

Isothermal nucleic acid amplification-based lateral flow testing (INAA-LFT) has emerged as a robust technique for on-site pathogen detection, providing a visible indication of pathogen nucleic acid amplification that rivals or even surpasses the sensitivity of real-time quantitative PCR. The isothermal nature of INAA-LFT ensures consistent conditions for nucleic acid amplification, establishing it as a crucial technology for rapid on-site pathogen detection. However, despite its considerable promise, the widespread application of isothermal INAA amplification-based lateral flow testing faces several challenges. This review provides an overview of the INAA-LFT procedure, highlighting its advancements in detecting plant viruses. Moreover, the review underscores the imperative of addressing the existing limitations and emphasizes ongoing research efforts dedicated to enhancing the applicability and performance of this technology in the realm of rapid on-site testing.

A Comprehensive Review on Shiga Toxin Subtypes and Their Niche-Related Distribution Characteristics in Shiga-Toxin-Producing E. coli and Other Bacterial Hosts.

Shiga toxin (Stx), the main virulence factor of Shiga-toxin-producing E. coli (STEC), was first discovered in Shigella dysenteriae strains. While several other bacterial species have since been reported to produce Stx, STEC poses the most significant risk to human health due to its widespread prevalence across various animal hosts that have close contact with human populations. Based on its biochemical and molecular characteristics, Shiga toxin can be grouped into two types, Stx1 and Stx2, among which a variety of variants and subtypes have been identified in various bacteria and host species. Interestingly, the different Stx subtypes appear to vary in their host distribution characteristics and in the severity of diseases that they are associated with. As such, this review provides a comprehensive overview on the bacterial species that have been recorded to possess stx genes to date, with a specific focus on the various Stx subtype variants discovered in STEC, their prevalence in certain host species, and their disease-related characteristics. This review provides a better understanding of the Stx subtypes and highlights the need for rapid and accurate approaches to toxin subtyping for the proper evaluation of the health risks associated with Shiga-toxin-related bacterial food contamination and human infections.

Aromatic amine antioxidants (AAs) and p-phenylenediamines-quinones (PPD-Qs) in e-waste recycling industry park: Occupational exposure and liver X receptors (LXRs) disruption potential.

Recently, evidence of aromatic amine antioxidants (AAs) existence in the dust of the electronic waste (e-waste) dismantling area has been exposed. However, there are limited studies investigating occupational exposure and toxicity associated with AAs and their transformation products (p-phenylenediamines-quinones, i.e., PPD-Qs). In this study, 115 dust and 42 hand wipe samples collected from an e-waste recycling industrial park in central China were analyzed for 19 AAs and 6 PPD-Qs. Notably, the median concentration of ∑6PPD-Qs (1,110 ng/g and 1,970 ng/m2) was significantly higher (p < 0.05, Mann-Whitney U test) than that of ∑6PPDs (147 ng/g and 34.0 ng/m2) in dust and hand wipes. Among the detected analytes, 4-phenylaminodiphenylamine quinone (DPPD-Q) (median: 781 ng/g) and 1,4-Bis(2-naphthylamino) benzene quinone (DNPD-Q) (median: 156 ng/g), were particularly prominent, which were first detected in the e-waste dismantling area. Occupational exposure assessments and nuclear receptor interference ability, conducted through estimated daily intake (EDI) and molecular docking analysis, respectively, indicated significant occupational exposure to PPD-Qs and suggested prioritized Liver X receptors (LXRs) disruption potential of PPDs and PPD-Qs. The study provides the first evidence of considerable levels of AAs and PPD-Qs in the e-waste-related hand wipe samples and underscores the importance of assessing occupational exposure and associated toxicity effects.

An oxidized dextran-composite self-healing coated magnesium scaffold reduces apoptosis to induce bone regeneration.

Self-healing coatings have shown promise in controlling the degradation of scaffolds and addressing coating detachment issues. However, developing a self-healing coating for magnesium (Mg) possessing multiple biological functions in infectious environments remains a significant challenge. In this study, a self-healing coating was developed for magnesium scaffolds using oxidized dextran (OD), 3-aminopropyltriethoxysilane (APTES), and nano-hydroxyapatite (nHA) doped micro-arc oxidation (MHA), named OD-MHA/Mg. The results demonstrated that the OD-MHA coating effectively addresses coating detachment issues and controls the degradation of Mg in an infectious environment through self-healing mechanisms. Furthermore, the OD-MHA/Mg scaffold exhibits antibacterial, antioxidant, and anti-apoptotic properties, it also promotes bone repair by upregulating the expression of osteogenesis genes and proteins. The findings of this study indicate that the OD-MHA coated Mg scaffold possessing multiple biological functions presents a promising approach for addressing infectious bone defects. Additionally, the study showcases the potential of polysaccharides with multiple biological functions in facilitating tissue healing even in challenging environments.

Complete genome sequence of Paris polyphylla chlorotic mottle virus infecting Paris polyphylla var. yunnanensis in southwest China.

A novel virus infecting a Paris polyphylla var. yunnanensis plant, tentatively named "Paris polyphylla chlorotic mottle virus" (PpCMV), was discovered in the city of Lijiang, Yunnan Province, China. Its genome consists of 6384 nucleotides (nt), excluding the 3'-terminal poly(A) tail, and contains two open reading frames: ORF1 and ORF2. ORF1 is 6150 nt in length, encoding a large 2050-aa polyprotein with at least two conserved regions encoding a replication-associated protein and a coat protein, the latter of which is located at the 3' end of ORF1. ORF2, consisting of 1185 nt, is located within ORF1 but has a different reading frame. It encodes a 394-aa-long putative movement protein. Phylogenetic analysis based on amino acid sequences revealed that the newly discovered virus exhibited the closest relationship to Hobart betaflexivirus 1 and rhodiola betaflexivirus 1, both of which belong to the genus Capillovirus, sharing 48.8% and 36.5% amino acid sequence identity, respectively, in the structural protein. This is the first report of the complete genome sequence of PpCMV in China.

Meat Authenticity Made Easy: DNA Extraction-Free Rapid Onsite Detection of Duck and Pork Ingredients in Beef and Lamb Using Dual-Recombinase-Aided Amplification and Multiplex Lateral Flow Strips.

Meat adulteration is a major global concern that poses a threat to public health and consumer rights. However, current detection techniques, such as quantitative polymerase chain reaction (qPCR) and gas chromatography-mass spectrometry, are time-consuming and require sophisticated equipment. In this study, we developed a rapid onsite identification method for animal-derived ingredients by utilizing a fast nucleic acid lysis buffer to expedite the release of sample nucleic acids and combined it with dual-recombinase-aided amplification (dual-RAA) technology and visual multiplex lateral flow strips (MLFSs). Our method successfully detected duck- and bovine-derived, porcine- and bovine-derived, duck- and ovine-derived, and porcine- and ovine-derived meat in a rapid 20 min onsite detection assay, with a detection limit of 101 copies/50 µL reaction system for target genes. Moreover, our method accurately detected adulterated meat with proportions as low as 1:999. These findings have significant implications for food safety and the protection of consumer rights.

Inhibition of VCP modulates NF-κB signaling pathway to suppress multiple myeloma cell proliferation and osteoclast differentiation.

Multiple myeloma (MM) is the second most common hematological malignancy, in which the dysfunction of the ubiquitin-proteasome pathway is associated with the pathogenesis. The valosin containing protein (VCP)/p97, a member of the AAA+ ATPase family, possesses multiple functions to regulate the protein quality control including ubiquitin-proteasome system and molecular chaperone. VCP is involved in the occurrence and development of various tumors while still elusive in MM. VCP inhibitors have gradually shown great potential for cancer treatment. This study aims to identify if VCP is a therapeutic target in MM and confirm the effect of a novel inhibitor of VCP (VCP20) on MM. We found that VCP was elevated in MM patients and correlated with shorter survival in clinical TT2 cohort. Silencing VCP using siRNA resulted in decreased MM cell proliferation via NF-κB signaling pathway. VCP20 evidently inhibited MM cell proliferation and osteoclast differentiation. Moreover, exosomes containing VCP derived from MM cells partially alleviated the inhibitory effect of VCP20 on cell proliferation and osteoclast differentiation. Mechanism study revealed that VCP20 inactivated the NF-κB signaling pathway by inhibiting ubiquitination degradation of IκBα. Furthermore, VCP20 suppressed MM cell proliferation, prolonged the survival of MM model mice and improved bone destruction in vivo. Collectively, our findings suggest that VCP is a novel target in MM progression. Targeting VCP with VCP20 suppresses malignancy progression of MM via inhibition of NF-κB signaling pathway.

Stem-loop RT-qPCR system for multiplex miRNA profiling and its application in wound healing-specific biomarker identification.

MiRNAs are biomarkers widely used in research but their clinical application is still challenging due to their low expression levels. Current methods for miRNA detection involve separate transcription and quantification for each target, which is costly and unsuitable for large sample sizes. This study provides a strategy for designing and screening miRNA-specific stem-loop reverse transcription (RT) primers, which enable the simultaneous transcription of three miRNAs and U6, and the concurrent detection of miRNA and U6 in the same transcript using TaqMan probes labeled with different dyes. The strategy was successfully employed to establish multiplex RT-PCR and dual-quantitative PCR (qPCR) quantification systems for 21 differentially expressed miRNAs during wound healing. The corresponding system can accurately quantify the cell culture samples containing miR-7a-5p mimic, miR-7a-5p inhibitor, or negative control. In summary, our results demonstrate that this strategy could efficiently accomplish the design, screening, and analysis of stem-loop RT primers for multiplex miRNA detection. Compared with the commercially customized miRNA assay kits, our system showed a higher degree of automation, more accurate qPCR assay capabilities, and lower assay costs, which could provide practical value for clinical diagnosis.

Development of Recombinase Aided Amplification (RAA)-Exo-Probe Assay for the Rapid Detection of Shiga Toxin-Producing Escherichia coli.

BACKGROUND: Shiga toxin-producing Escherichia coli (STEC) is a significant cause of foodborne illness causing various gastrointestinal diseases including hemolytic uremic syndrome (HUS), the most severe form, which can lead to kidney failure or even death. OBJECTIVE: Here, we report the development of recombinase aided amplification (RAA)-exo-probe assays targeting the stx1 and stx2 genes for the rapid detection of STEC in food samples. METHODS: Primers and exo-probes were designed and optimized for the detection of stx1 and stx2 using RAA technology. The optimal STEC RAA-exo-probe assays were then tested for specificity and sensitivity, and validated in both spiked and real food samples. RESULTS: These assays were found to be 100% specific to STEC strains and were also highly sensitive with a detection limit of 1.6 × 103 CFU/mL or 32 copies/reaction. Importantly, the assays were able to successfully detect STEC in spiked and real food samples (beef, mutton, and pork), with a detection limit as low as 0.35 CFU/25g in beef samples after an overnight enrichment step. CONCLUSIONS: Overall, the RAA assay reactions completed within ∼20 min and were less dependent on expensive equipment, suggesting they can be easily adopted for in-field testing requiring only a fluorescent reader. HIGHLIGHTS: As such, we have developed two rapid, sensitive, and specific assays that can be used for the routine monitoring of STEC contamination in food samples, particularly in the field or in poorly equipped labs.

Silicon Nanoparticles Embedded in Chemical-Expanded Graphite through Electrostatic Attraction for High-Performance Lithium-Ion Batteries.

Silicon (Si) is a promising next-generation anode for high-energy-density lithium-ion batteries. The application of silicon/carbon (Si/C) composites with high Si content is hindered by the huge volume change and insecure electrochemical interface of the Si anode. Herein, chemical-expanded graphite (CEG) is used as a carbon matrix to form Si@CEG/C composites with an embedded structure. CEG with an abundant pore structure and electropositivity can well disperse and accommodate a mass of Si nanoparticles (Si NPs). With the flexibility and porosity of CEG, the embedded structure of Si NPs fixed in an expanded graphite layer can adopt the volume change of Si NPs and offer the abundant path of diffusion of lithium-ion, which leads to a moderate cycle and rate performance. Si@CEG/C exhibits a high reversible capacity of 1232.4 mA h g-1 at a current density of 0.5 A g-1 and with a capacity retention rate of 87% after 200 cycles. This embedded structure of Si/C composites built by CEG is meaningful for the structure design of the Si-based anode with higher specific capacity, active material utilization, and satisfactory cycle stability.

Design and synthesis of selective FLT3 inhibitors via exploration of back pocket II.

Aim: The clinical benefits of FLT3 inhibitors against acute myeloid leukemia (AML) have been limited by selectivity and resistance mutations. Thus, to identify FLT3 inhibitors possessing high selectivity and potency is of necessity. Methods & results: The authors used computational methods to systematically compare pocket similarity with 269 kinases. Subsequently, based on these investigations and beginning with in-house compound 10, they synthesized a series of 6-methyl-isoxazol[3,4-b]pyridine-3-amino derivatives and identified that compound 45 (IC50: 103 nM) displayed gratifying potency in human AML cell lines with FLT3-internal tandem duplications mutation as well as FLT3-internal tandem duplications-tyrosine kinase domain-transformed BaF3 cells. Conclusion: The integrated biological activity results indicated that compound 45 deserves further development for therapeutic remedies for AML.

Hyaluronic acid/serotonin-decorated cerium dioxide nanomedicine for targeted treatment of ulcerative colitis.

Ulcerative colitis (UC) is a chronic nonspecific inflammatory bowel disease often characterized by rapid progression and frequent comorbidities that make its treatment challenging. In colonic ulcers of UC patients, myeloperoxidase (MPO) is highly expressed, which results in an abundance of macrophages and reactive oxygen species. This study developed an active MPO-targeting hyaluronic acid/serotonin ceria nanoenzyme (HA-5-HT@CeO2) using the electrostatic interaction between CeO2 nanoparticles, 5-hydroxyserotonin-cerium oxide and hyaluronic acid. Based on the dual targeting effects of MPO and the macrophage CD44+ receptor in locating the inflammatory site in conjunction with the inflammatory area of the colon through electrostatic action, CeO2 nanoparticles along with multiple similar enzymes were used to eliminate O2, H2O2 and ˙OH and other reactive oxygen species, achieving targeted repair of the intestinal epithelial barrier through the elimination of inflammatory factors. In studies involving pharmacodynamics in vitro and DSS-induced animal models of acute colitis in vivo, HA-5-HT@CeO2 has been shown to reduce inflammation further and treat ulcerative colitis compared to traditional drugs. Additionally, active targeting of MPO inflammation can lead to accurate drug delivery to the site and can minimize the side effects associated with the drug. HA-5-HT@CeO2 is a promising novel drug for the treatment of ulcerative colitis. In addition to illustrating the benefits of this novel nanodrug delivery in treating ulcerative colitis compared to traditional medications, this study provides theoretical and experimental support for its application to any targeted therapy for ulcerative colitis.