Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 154
Filtrar
1.
Clin Oncol (R Coll Radiol) ; 35(7): 446-453, 2023 07.
Artigo em Inglês | MEDLINE | ID: mdl-36894383

RESUMO

AIMS: Renin-angiotensin-aldosterone system inhibitors (RAASi) are associated with improved survival outcomes in patients receiving immune checkpoint inhibitors (ICIs), but the data on the response to treatment and tumour-based endpoints across different tumour types are unknown. MATERIALS AND METHODS: We carried out a retrospective study at two tertiary referral centres in Taiwan. All adult patients treated with ICIs between January 2015 and December 2021 were included. The primary outcome was overall survival and the secondary outcomes were progression-free survival (PFS) and clinical benefit rates. RESULTS: In total, 734 patients were enrolled in our study, of which 171 were RAASi users and 563 were non-users. Compared with non-users, RAASi users had a longer median overall survival [26.8 (interquartile range 11.3-not reached) versus 15.2 (interquartile range 5.1-58.4) months, P < 0.001] and PFS [12.2 (interquartile range 3.9-34.5) versus 5.0 (interquartile range 2.2-15.2) months, P < 0.001]. In univariate Cox proportional hazard analyses, the use of RAASi was associated with a 40% reduction in the risk of mortality [hazard ratio 0.58 (95% confidence interval 0.44-0.76), P < 0.001] and disease progression [hazard ratio 0.62 (95% confidence interval 0.50-0.77), P < 0.001]. The association remained significant after adjusting for underlying comorbidities and cancer therapy in multivariate Cox analyses. A similar trend was observed for PFS. Furthermore, RAASi users experienced a greater clinical benefit rate than non-users (69% versus 57%, P = 0.006). Importantly, the use of RAASi before ICI initiation was not associated with improved overall survival and PFS. RAASi were not associated with an increased risk of adverse events. CONCLUSION: The use of RAASi is associated with improved survival outcomes, treatment response and tumour-based endpoints in patients undergoing immunotherapy.


Assuntos
Hiperpotassemia , Insuficiência Renal Crônica , Adulto , Humanos , Sistema Renina-Angiotensina , Estudos Retrospectivos , Inibidores de Checkpoint Imunológico/uso terapêutico , Inibidores da Enzima Conversora de Angiotensina/uso terapêutico , Inibidores da Enzima Conversora de Angiotensina/farmacologia , Hiperpotassemia/induzido quimicamente , Hiperpotassemia/complicações , Hiperpotassemia/tratamento farmacológico , Insuficiência Renal Crônica/induzido quimicamente , Insuficiência Renal Crônica/complicações , Insuficiência Renal Crônica/tratamento farmacológico
2.
Int J Tuberc Lung Dis ; 24(9): 922-927, 2020 09 01.
Artigo em Inglês | MEDLINE | ID: mdl-33156759

RESUMO

BACKGROUND: Disseminated Mycobacterium avium complex infection (DMAC) has symptoms and microscopic findings similar to those of TB in HIV patients. To inform a clinical algorithm-based differential diagnosis, we aimed to characterise the clinical features of DMAC.METHODS: This was a retrospective cohort study of 192 HIV-positive patients with culture-confirmed mycobacterial infections hospitalised during 1996-2016 at a major HIV/AIDS treatment centre in Taiwan.RESULTS: HIV patients with DMAC (n = 58) had a three times higher 1-year mortality than those with TB (n = 98) (48.3% vs. 16.3%, P < 0.001). DMAC and TB were not distinguishable by the WHO TB screening criteria (fever, cough, night sweats or weight loss). Nevertheless, DMAC was characterised by a lower median CD4 count (5.0 cells/µL vs. 38.5 cells/µL, P < 0.001), lower median body mass index (BMI) (17.7 kg/m² vs. 19.7 kg/m², P = 0.002) and the absence of chest radiographic findings (P < 0.001). Simultaneous presence of CD4 <20 cells/µl, BMI <18.5 kg/m² and negative chest radiographic finding had a 98% specificity for diagnosing DMAC against TB or other types of mycobacterial infections.CONCLUSION: DMAC is an important differential diagnosis of TB in HIV patients. A simple rule based on CD4, BMI and chest radiography may inform the decision to start anti-DMAC treatment in patients with mycobacterial infection.


Assuntos
Infecções por HIV , Infecção por Mycobacterium avium-intracellulare , Mycobacterium tuberculosis , Tuberculose , Diagnóstico Diferencial , Infecções por HIV/complicações , Humanos , Complexo Mycobacterium avium , Infecção por Mycobacterium avium-intracellulare/diagnóstico , Estudos Retrospectivos , Taiwan/epidemiologia , Tuberculose/diagnóstico
3.
Clin Microbiol Infect ; 23(2): 121.e1-121.e7, 2017 Feb.
Artigo em Inglês | MEDLINE | ID: mdl-27793735

RESUMO

OBJECTIVES: The study aimed to determine the long-term Staphylococcus aureus colonization patterns and strain relatedness, and the association between maternal and infant colonization in infancy. METHODS: A birth cohort study was conducted from January 2012 to November 2014. Nasopharyngeal swabs for S. aureus detection were collected from infants at the age of 1, 2, 4, 6 and 12 months and from mothers when their children were 1-month-old. RESULTS: In total, 254 samples were collected at each planned visit during the first 12-month study. The prevalence of S. aureus colonization decreased in the first year of life, ranging from 61.0% (155/254) at the age of 1 month to 12.2% (31/254) at 12 months. Persistent colonization, defined as a positive culture on four or five occasions, was detected in only 13.8% (35/254) of carriers. Most of the persistent carriers were colonized with methicillin-resistant S. aureus (MRSA) only, and among persistent MRSA carriers, 61.1% (11/18) had indistinguishable genotypes. Of the mothers with MRSA colonization, 77.1% (27/35) had infants who were concomitantly colonized at the age of 1 month; 70.4% (19/27) of the infant-mother paired isolates belonged to indistinguishable or related subtypes, which suggests that surrounding carriers, probably their mothers, may be the possible source for MRSA acquisition in early infancy. CONCLUSIONS: Staphylococcus aureus colonization including MRSA was commonly observed in our cohort. Strains of persistent MRSA among infant-mother pairs were usually of indistinguishable genotypes. Therefore, horizontal spread within households is possibly an important factor related to infant MRSA colonization.


Assuntos
Portador Sadio , Staphylococcus aureus Resistente à Meticilina/isolamento & purificação , Nasofaringe/microbiologia , Infecções Estafilocócicas/epidemiologia , Infecções Estafilocócicas/microbiologia , Estudos de Coortes , Feminino , Humanos , Incidência , Lactente , Recém-Nascido , Estudos Longitudinais , Masculino , Staphylococcus aureus Resistente à Meticilina/classificação , Staphylococcus aureus Resistente à Meticilina/genética , Tipagem Molecular , Razão de Chances , Taiwan/epidemiologia
4.
Clin Exp Obstet Gynecol ; 42(2): 152-5, 2015.
Artigo em Inglês | MEDLINE | ID: mdl-26054108

RESUMO

PURPOSE OF STUDY: The aim of this study was to evaluate the efficacy of uroflowmetry in predicting the possibility of abnormal voiding symptoms following antimuscarinic treatment for overactive bladder syndrome (OAB) in Taiwanese women. MATERIALS AND METHODS: A retrospective study was conducted on women with OAB. Forty-five women with abnormal voiding patterns shown by urodynamic study comprised the main group and 38 women with normal voiding patterns comprised the control group. All patients were prescribed two mg tolterodine once daily for one week. Follow-up on complaints of abnormal voiding symptoms was done one week later. RESULTS: One woman in control group and 12 women in main group complained of abnormal voiding symptoms. There was a significant difference in the occurrence of abnormal voiding symptoms after antimuscarinic administration between main study group and control group (26.7 % vs 2.6 %, p = 0.02). CONCLUSIOn: Uroflowmetry is a non-invasive and simple tool to predict the occurrence of abnormal voiding symptoms after antimuscarinic use.


Assuntos
Compostos Benzidrílicos/efeitos adversos , Cresóis/efeitos adversos , Antagonistas Muscarínicos/efeitos adversos , Fenilpropanolamina/efeitos adversos , Bexiga Urinária Hiperativa/tratamento farmacológico , Transtornos Urinários/induzido quimicamente , Urodinâmica , Adulto , Idoso , Feminino , Humanos , Pessoa de Meia-Idade , Estudos Retrospectivos , Síndrome , Tartarato de Tolterodina , Adulto Jovem
5.
Int J Tuberc Lung Dis ; 19(1): 58-64, 2015 Jan.
Artigo em Inglês | MEDLINE | ID: mdl-25519791

RESUMO

BACKGROUND: Tuberculosis (TB) is a serious problem for patients undergoing haematopoietic stem cell transplantation (HSCT) in TB-endemic areas; however, data on these patients are limited. METHODS: We obtained data on 2040 HSCT recipients from the Registry of Catastrophic Illness in Taiwan from 1997 to 2006. We also obtained data on age-, sex- and enrolment date-matched controls from the Longitudinal Health Insurance Database. The cumulative incidence of active TB in HSCT recipients and controls and risk factors for TB were analysed. RESULTS: Among 2040 HSCT recipients identified, 39 (1.9%) had newly diagnosed TB. The incidence rate was 688 per 100 000 person-years. The 10-year cumulative TB incidence was respectively 3.52% and 0.38% in HSCT recipients and controls (P < 0.001). HSCT was an independent risk factor for TB compared with matched controls. Among post-HSCT patients, independent risk factors for TB included age ⩾18 years and allogeneic recipients with graft-versus-host disease (GVHD). Post-HSCT patients with subsequent TB had a higher mortality rate than those without TB (P < 0.001). CONCLUSION: HSCT is associated with an increased risk of TB in endemic regions. Older age and development of chronic GVHD are independent predictors of late onset active TB in HSCT recipients.


Assuntos
Doença Enxerto-Hospedeiro/epidemiologia , Transplante de Células-Tronco Hematopoéticas/efeitos adversos , Transplantados , Tuberculose/epidemiologia , Adolescente , Adulto , Idoso , Idoso de 80 Anos ou mais , Estudos de Casos e Controles , Criança , Pré-Escolar , Comorbidade , Feminino , Seguimentos , Doença Enxerto-Hospedeiro/tratamento farmacológico , Doença Enxerto-Hospedeiro/microbiologia , Humanos , Imunossupressores/uso terapêutico , Incidência , Lactente , Recém-Nascido , Masculino , Pessoa de Meia-Idade , Fatores de Risco , Taiwan/epidemiologia , Adulto Jovem
6.
Plant Dis ; 98(12): 1746, 2014 Dec.
Artigo em Inglês | MEDLINE | ID: mdl-30703901

RESUMO

Passion fruit (Passiflora edulis × Passiflora edulis f. flavicarpa) 'Tainung No. 1' is the main variety cultivated in Taiwan, which is a hybrid and propagated only by grafting. In the spring of 2011, plants with systemic mottle and malformation on leaves were found in some orchards located in Puli and Nantou in central Taiwan. Interestingly, after 3 months of growth, most of these diseased plants became symptomless when the weather became warmer. Nevertheless, some striped concaves were observed on immature fruit surfaces of diseased plants. In March of 2011, two leaf samples exhibiting mosaic and three samples showing malformation were collected and tested by DAS-ELISA; none positively reacted with antibodies against the Cucumber mosaic virus (CMV), East Asian passiflora virus (EAPV), Passion fruit mottle virus (PaMV), or Passion fruit crinkle virus (PCV) that have previously occurred in Taiwan. Rolling-circle amplification (RCA) with hexamer primers were adopted to analyze potential begomoviruses that were prevalent on the other crops in Taiwan (3). The RCA amplified products were digested with BamHI and separated on 1.2% agarose by gel electrophoresis. A fragment, about 3 kb, was purified from each gel and cloned into the respective site of pBluescript SK(-) individually. Clones were screened by EcoRI digestion and two types of restriction fragment length patterns were found among them. One type of a clone containing 2,745 nucleotides (Accession No. KC161185) with 98.5% identity to Euphorbia leaf curl virus (EuLCV) (1) and the other type of a clone containing 2,732 nucleotides (KC161184) with 91.7% identity to Papaya leaf curl Guangdong virus (PaLCuGDV) (2) were revealed by nucleotide comparisons of their DNA-A in GenBank. Accordingly, we confirmed the existence of passiflora isolates of EuLCV and PaLCuGDV. PCR primers CPup/Edw/Pdw (5'TGTGAAGG(A/C/G/T)CC(A/G/T)TGTAA(A/G)GT3'/5'CGCAGTTT CTGGAGGATATTAAG3'/5'TCGCATGCCACTTCCTCAGT3') were designed to differentiate these viruses by amplifying a 235 bp DNA fragment for EuLCV and 345 bp for PaLCuGDV. In a brief survey, all 26 passion fruit leaf samples collected from seven orchards were double infected with EuLCV and PaLCuGDV; only six samples collected from a specific orchard were found to harbor the PaLCuGDV infection. Thirty-seven seedlings from passion fruit (P. edulis f. flavicarpa) seeds were indexed and all were free from both viruses. Five virus-free plantlets of P. edulis f. flavicarpa, one EuLCV and PalCuGDV double infected P. edulis × P. edulis f. flavicarpa, and 20 whiteflies were put into one net tent for 2 months, and then the five plantlets were tested by PCR. The two EuLCV and PalCuGDV specific fragments were amplified from all five plantlets. The two begomoviruses cause mild symptoms on passion fruit plant but the appearance of the fruit was affected. To our knowledge, this is the first report of begomoviruses infecting passion fruit in Taiwan and in Asia. References: (1) X. Ma et al. J. Phytopathol. 152:215. (2) X. Wang et al. Virus Genes 29:303. (3) C. Wu et al. J. Virol. Methods 147:355.

7.
Br J Cancer ; 109(3): 731-8, 2013 Aug 06.
Artigo em Inglês | MEDLINE | ID: mdl-23820254

RESUMO

BACKGROUND: Signal transducer and activator of transcription 3 (STAT3) activation is frequently found in human lung cancer and is associated with increased metastasis and reduced survival. How STAT3 enhances invasiveness is unclear. METHODS: The expression of microRNAs and target genes was measured by real-time RT-PCR. Protein level was studied by western blotting. Luciferase reporter assay was used to confirm the direct targeting of microRNAs. Gelatin zymography was used to study matrix metalloproteinase (MMP) activity. Transwell assay was used to investigate cell migration and invasion. RESULTS: Enforced expression of STAT3 decreases the endogenous MMP inhibitor RECK protein but not mRNA level in H460 cells. Conversely, STAT3 inhibitor S3I-201 increases RECK protein in STAT3-activating H1299 cells. We demonstrate that STAT3 upregulates miR-92a to repress RECK via post-transcriptional inhibition. The RECK 3'-untranslated region (3'UTR) reporter activity assay suggests that RECK is a direct repression target of miR-92a. Delivery of pre-miR-92a reduces RECK protein level whereas transfection of anti-miR-92a restores STAT3-induced downregulation of RECK. Anti-miR-92a attenuates MMP activity, migration and invasion of H1299 cells and STAT3-overexpressing H460 cells, suggesting miR-92a is critical for STAT3-induced invasiveness. CONCLUSION: The STAT3-induced miR-92a promotes cancer invasion by suppressing RECK and targeting of the STAT3/miR-92a axis may be helpful for cancer treatment.


Assuntos
Proteínas Ligadas por GPI/antagonistas & inibidores , MicroRNAs/genética , Fator de Transcrição STAT3/genética , Linhagem Celular Tumoral , Movimento Celular/fisiologia , Proteínas Ligadas por GPI/biossíntese , Proteínas Ligadas por GPI/genética , Humanos , Neoplasias Pulmonares/genética , Neoplasias Pulmonares/metabolismo , Neoplasias Pulmonares/patologia , Metaloproteinase 2 da Matriz/metabolismo , Metaloproteinase 9 da Matriz/metabolismo , MicroRNAs/metabolismo , Invasividade Neoplásica , RNA Mensageiro/biossíntese , RNA Mensageiro/genética , Fator de Transcrição STAT3/metabolismo , Transcrição Gênica , Transfecção , Regulação para Cima
8.
Int J Obes (Lond) ; 37(3): 410-5, 2013 Mar.
Artigo em Inglês | MEDLINE | ID: mdl-22531094

RESUMO

OBJECTIVE: This study aimed to investigate the metabolic risk factors of high hepatitis B viral load. DESIGN: Large-scale, community-based cross-sectional study. SUBJECTS: A total of 3587 hepatitis B virus (HBV)-infected participants without liver cirrhosis at study entry were investigated. High HBV viral load was defined as a serum level 10(4) copies per ml for hepatitis B e antigen (HBeAg) seronegatives or 10(8) copies per ml for HBeAg seropositives. RESULTS: Among HBeAg seropositives (n=545), high HBV viral load was reversely associated with extreme obesity (odds ratio (OR), 0.30; 95% confidence interval (CI), 0.13-0.68; P=0.004) or central obesity (OR, 0.53; 95% CI, 0.34-0.82; P=0.004) after adjustment for gender, hypertriglyceridemia, hyperuricemia and history of hypertension. High HBV viral load remained significantly inversely associated with extreme obesity (OR, 0.17; 95% CI, 0.05-0.63; P=0.008) and central obesity (OR, 0.44; 95% CI, 0.25-0.78; P=0.005) in male HBeAg-seropositive participants in stratification analyses by gender. Among HBeAg seronegatives (n=3042), however, high HBV viral load was inversely associated with hypertriglyceridemia (OR, 0.74; 95% CI, 0.61-0.89, P=0.002) after adjustment for age, gender, high serum alanine aminotransferase level, and extreme obesity or central obesity. High HBV viral load was still inversely associated with hypertriglyceridemia in both female (OR, 0.70; 95% CI, 0.50-0.97; P=0.041) and male (OR, 0.75; 95% CI, 0.60-0.94; P=0.011) HBeAg-seronegative participants. CONCLUSION: Extreme obesity and central obesity were associated with a low prevalence of high HBV viral load in HBeAg seropositives, especially in men; while hypertriglyceridemia was associated with a low prevalence of high viral load in HBeAg seronegatives in both women and men.


Assuntos
Antígenos E da Hepatite B/sangue , Vírus da Hepatite B/isolamento & purificação , Hepatite B/sangue , Hipertrigliceridemia/sangue , Obesidade Abdominal/sangue , Obesidade Mórbida/sangue , Alanina Transaminase/sangue , Estudos Transversais , DNA Viral , Feminino , Hepatite B/epidemiologia , Hepatite B/imunologia , Vírus da Hepatite B/imunologia , Humanos , Hipertrigliceridemia/epidemiologia , Hipertrigliceridemia/imunologia , Masculino , Pessoa de Meia-Idade , Obesidade Abdominal/epidemiologia , Obesidade Abdominal/imunologia , Obesidade Mórbida/epidemiologia , Obesidade Mórbida/imunologia , Razão de Chances , Prevalência , Fatores de Risco , Taiwan/epidemiologia , Carga Viral
9.
Clin Exp Obstet Gynecol ; 39(2): 171-4, 2012.
Artigo em Inglês | MEDLINE | ID: mdl-22905457

RESUMO

PURPOSE OF STUDY: To evaluate the efficacy of baclofen in combination with antimuscarinics to treat women with an overactive bladder (OAB) with abnormal voiding patterns. METHODS: An action research and chart review was conducted in 245 OAB women. Women were prescribed tolterodine or oxybutynin with or without baclofen after urodynamics. The complaint of voiding difficulty was followed up one week later. RESULTS: There was a significant difference in the occurrence of voiding difficulty after antimuscarinic administration in OAB women with abnormal voiding patterns compared with normal patterns (18% vs 4.9%, respectively; p = 0.013). The clinical difference of voiding difficulty after treating with antimuscarinics between both voiding patterns disappeared after adding baclofen (abnormal voiding pattern vs normal pattern; 11.1% vs. 5.6%, respectively; p = 1.000). CONCLUSION: Combined use of baclofen and antimuscarinic agents could reduce voiding difficulty in treating women with overactive bladders with abnormal voiding patterns.


Assuntos
Baclofeno/uso terapêutico , Compostos Benzidrílicos/uso terapêutico , Cresóis/uso terapêutico , Antagonistas Muscarínicos/uso terapêutico , Fenilpropanolamina/uso terapêutico , Bexiga Urinária Hiperativa/tratamento farmacológico , Adulto , Idoso , Baclofeno/farmacologia , Compostos Benzidrílicos/farmacologia , Pesquisa Participativa Baseada na Comunidade , Cresóis/farmacologia , Quimioterapia Combinada , Feminino , Humanos , Ácidos Mandélicos/farmacologia , Ácidos Mandélicos/uso terapêutico , Pessoa de Meia-Idade , Fenilpropanolamina/farmacologia , Tartarato de Tolterodina , Bexiga Urinária Hiperativa/fisiopatologia , Micção/efeitos dos fármacos , Urodinâmica , Adulto Jovem
10.
Plant Dis ; 96(6): 918, 2012 Jun.
Artigo em Inglês | MEDLINE | ID: mdl-30727392

RESUMO

Macroptilium atropurpureum (siratro plants) is a perennial wild legume plant introduced to Taiwan as a forage crop in 1961 (3) and has become a naturalized weed found all over the island. In 2010, siratro plants with virus-like symptoms of mosaic and leaf deformation were observed on the campus of Da-Yeh University in central Taiwan. Flexuous virus-like particles about 750 × 12 nm were observed in the crude sap extracted from symptomatic leaves with a transmission electron microscope. Crude sap was mechanically inoculated to Chenopodium quinoa and local lesions can be observed on inoculated leaves 4 to 5 days after inoculation. Virus was purified from the leaves of inoculated C. quinoa with modified protocols of Gonsalves and Ishii (2). The virus coat protein (CP) consisted of a single major peptide with relative molecular weight of approximately 33 kDa when analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Viral RNA extracted from the purified virus was used as a template and was primed with several primer sets corresponding to potyviruses and carlaviruses in reverse transcription-PCR to amplify possible corresponding cDNA fragments. After several attempts, a cDNA fragment of about 1,300 bp could be amplified with the degenerated primer set of BCMNV-F (5'CCDTGGACDGTWGGVATGAC3') and BCMNV-R (5'CACCAHACCATRAARCCATTCAT3'), which were designed on the basis of the conserved region of the nuclear inclusion b (NIb) and CP genes of some potyviruses including Bean common mosaic necrosis virus, Soybean mosaic virus, Blackeye cowpea mosaic virus, East Asian passiflora virus, and Passion fruit woodiness virus. BLAST analyses showed the amplicon was highly homologous to that of Passiflora virus Y (PaVY). Together with oligo dT, a specific primer (5'GATGACACTCAAATGGCTG3') corresponding to PaVY CP was used to amplify the cDNA fragment of the most 3' region of the viral RNA (about 800 bp). The assembled cDNA fragment of 1,958 bp (Accession No. AB679294) contains a partial NIb gene (877 nt), a complete CP gene (819 nt), and the 3' noncoding region (262 nt). The CP gene shared sequence identities of 89.4 to 98.9% and 92.7 to 98.9% in nucleotide and amino acid, respectively, to that of documented PaVY isolates. PaVY has also been found to be infecting Vigna trilobata, Rhynchosia minima, Clitoria ternatea, and Passiflora foetida in Australia (1). Here we present the first report to our knowledge of PaVY and its infection of siratro (M. atropurpureum) in Taiwan. Additional work is needed to investigate the spread of PaVY and its interaction with other legume plants in Taiwan. References: (1) B. A. Coutts et al. Arch. Virol. 156:1757, 2011. (2) D. Gonsalves and M. Ishii. Phytopathology 70:1028, 1980. (3) Y. Y. Lai et al. J. Taiwan Livestock Res. 42:19, 2009.

11.
Clin Exp Allergy ; 41(5): 739-49, 2011 May.
Artigo em Inglês | MEDLINE | ID: mdl-21488999

RESUMO

BACKGROUND: Mould-induced atopic respiratory diseases are a worldwide problem. Characterization of fungal allergens is of major clinical importance. OBJECTIVE: We identified a novel transaldolase family allergen of Cladosporium and Penicillium species. METHODS: Fungal allergens were identified by immunoblotting, peptide mass mapping and partial sequencing, cDNA cloning and IgE epitope mapping. RESULTS: A 36.5 kDa IgE-binding component in a partially purified C. cladosporioides preparation was identified. Mass spectrometric analyses suggest that this novel IgE-reacting allergen is a transaldolase. A corresponding full-length 1246 bp cDNA encoding a polypeptide of 325 residues was isolated. The newly identified transaldolase allergen has been designated as Cla c 14.0101. The cDNA encoding the Pencillium chrysogenum transaldolase was isolated by RT-PCR according to the cDNA sequence encoding a P. chrysogenum Wisconsin 54-1255 hypothetical protein. The purified rCla c 14.0101 protein reacted with IgE antibodies in 10 (38%) of 26 Cladosporium cladosporioides-sensitized asthmatic patients. Nine of the 10 rCla c 14.0101-positive sera have IgE binding against the recombinant Penicillium transaldolase (rPen ch 35.0101). Among the eight fungal transaldolase-positive sera tested, three showed IgE binding against the recombinant human transaldolase. To determine cross-reactivity between the Cladosporium and Penicillium fungi, IgE cross-reactivity was detected between these two fungal transaldolase allergens by inhibition assays. Both the N- and the C-terminal fragments of Cla c 14.0101 were recognized by IgE antibodies. The C-terminal IgE-reacting determinant was narrowed down to a region encompassing Thr257 to Ser278 of Cla c 14.0101. It was mapped onto a loop-like structure of a 3D model constructed for Cla c 14.0101. CONCLUSION AND CLINICAL RELEVANCE: We identified transaldolase as a novel and IgE cross-reactive allergen family of C. cladosporioides and P. chrysogenum. In addition, an IgE-reacting fragment (Thr257 to Ser278) was pinpointed to a loop-like structure on Cla c 14.0101. Results obtained provide important information in clinical mould allergy.


Assuntos
Alérgenos/imunologia , Antígenos de Fungos/imunologia , Asma/imunologia , Cladosporium/imunologia , Imunoglobulina E/imunologia , Penicillium chrysogenum/imunologia , Transaldolase/imunologia , Alérgenos/sangue , Antígenos de Fungos/sangue , Asma/sangue , Asma/microbiologia , Cladosporium/enzimologia , Humanos , Imunoglobulina E/sangue , Penicillium chrysogenum/enzimologia , Transaldolase/sangue
13.
Plant Dis ; 95(5): 617, 2011 May.
Artigo em Inglês | MEDLINE | ID: mdl-30731963

RESUMO

Bell pepper (Capsicum annuum L.) plants exhibiting systemic mild mosaic, vein yellowing, and leaf malformation were collected from Puli City in 2006. Double-antibody sandwich (DAS)-ELISA was used to test these samples for Chilli veinal mottle virus (ChiVMV) infection using polyclonal antibodies. In addition, Chenopodium quinoa, C. amaranticolor, and Nicotiana benthamiana plants were mechanically inoculated with sap extracted from collected samples. Ten days postinoculation, chlorotic local lesions were observed on inoculated leaves of C. quinoa and C. amaranticolor plants, whereas, systemic mosaic and foliar distortion symptoms were developed on upper leaves of N. benthamiana plants. The DAS-ELISA test showed that field-collected pepper samples and inoculated leaves of C. quinoa and C. amaranticolor were infected with ChiVMV, while N. benthamiana with mosaic symptoms did not react with ChiVMV antibodies. To confirm ChiVMV, field-collected samples as well as mechanically inoculated plants were tested by reverse transcription (RT)-PCR using the potyvirus degenerate primers Hrp5/Pot1 (2). Amplified RT-PCR products were cloned and sequenced. Sequence analysis of amplified fragments (1.4 kb) revealed that field-collected pepper samples were infected with ChiVMV and Pepper mottle virus (PepMoV). The DNA fragment amplified from C. quinoa and C. amaranticolor showed high (99.2%) sequence identities with the CP gene of ChiVMV (3) (GenBank Accession No. AM909717). However, amplicons obtained from N. benthamiana plants (GenBank Accession No. HQ329082) that showed mosaic symptoms showed 83.6% to 98.7% nucleotide identities with PepMoV (GenBank Accession Nos. AB126033, AF227728, AF440801, AF501591, EU586133, and M96425). Next, a pure isolate of PepMoV was established on N. benthamiana by mechanical inoculation of diluted plant sap obtained from a PepMoV-infected N. benthamiana plant. Bell pepper plants inoculated with the Taiwan isolate of PepMoV developed mosaic and leaf distortion symptoms. Antiserum against the PepMoV Taiwan isolate was subsequently prepared by immunizing rabbits with purified virus particles. Using the prepared antiserum and specific primers (1) to detect PepMoV, ChiVMV, and Pepper veinal mottle virus (PVMV), three viruses could be readily detected and differentiated from diseased bell peppers in the field. In a survey done in 2007, 18 of 33 pepper samples from southern Taiwan were found with mixed infections of PepMoV and ChiVMV, seven samples were infected with PepMoV and PVMV, five samples were infected with PVMV, and another three samples were infected with ChiVMV. To our knowledge, this is the first report of the occurrence of PepMoV in bell peppers in Taiwan. References: (1) Y. H. Cheng et al. Plant Dis. 93:107, 2009. (2) S. S. Pappu et al. Plant Dis. 82:1121, 1998. (3) W. S. Tsai et al. Plant Pathol. 58:408, 2008.

14.
Int J Clin Pract ; 62(4): 555-61, 2008 Apr.
Artigo em Inglês | MEDLINE | ID: mdl-18067561

RESUMO

BACKGROUND: In ST-segment elevation acute myocardial infarction (STEMI), dislodgement of thrombus within the culprit artery during primary percutaneous coronary intervention (PCI) may cause distal embolisation and impaired myocardial reperfusion. Clinical results of thromboembolic protection strategies have been controversial. We conducted this study to investigate whether the benefit of thrombus removal is time dependent. METHODS: Seventy-four STEMI patients within 12 h from onset were randomised to receive either primary PCI with initial thrombosuction (IT) or standard strategy. Results were analysed in subgroups according to the onset-to-lab time intervals (subgroup 1: 0-240 min, subgroup 2: 241-480 min and subgroup 3: 481-720 min). RESULTS: The primary end-points were improvements in thrombolysis in myocardial infarction flow (DeltaTIMI) and myocardial blush grade (DeltaMBG) postprocedure. Better DeltaTIMI (2.2 +/- 1.1 vs. 1.5 +/- 1.3, p = 0.014) and DeltaMBG (2.3 +/- 1.1 vs. 1.0 +/- 1.5, p < 0.001) were observed in IT patients, compared with standard PCI patients. In onset-to-lab time subgroup analysis, the difference between IT and standard PCI is significant only in subgroup 2 (DeltaTIMI 2.6 +/- 1.0 vs. 1.3 +/- 1.2, p = 0.007; DeltaMBG 2.6 +/- 0.9 vs. 1.0 +/- 1.1, p = 0.010), but not in the other two subgroups. CONCLUSIONS: This prospective randomised study shows that primary PCI with IT may improve epicardial flow and myocardial reperfusion in patients with STEMI, and this benefit is the most significant in patients treated within 4-8 h after symptom onset.


Assuntos
Trombose Coronária/terapia , Infarto do Miocárdio/terapia , Reperfusão Miocárdica/métodos , Angioplastia Coronária com Balão , Feminino , Humanos , Masculino , Pessoa de Meia-Idade , Estudos Prospectivos , Sucção/métodos , Trombectomia/métodos , Fatores de Tempo
15.
Transplant Proc ; 38(10): 3283-5, 2006 Dec.
Artigo em Inglês | MEDLINE | ID: mdl-17175250

RESUMO

This study examined the combinatory effect on graft survival of neonatal pig pancreatic cell clusters (NPCC) with nordihydroguaiaretic acid (NDGA), a 5-lipoxygenase inhibitor, with systemic CTLA4Ig expression, with local CTLA4Ig and with interleukin-1 (IL-1) receptor antagonist (IL-1ra) expression using a pig to mouse model. About 2000 NPCCs, which were infected with both adenoviruses carrying CTLA4Ig and IL1-1ra genes (each 500 pfu/NPCC), were transplanted beneath the kidney capsule of diabetic BALB/c mice. Two days before transplantation, the recipient mice were either injected with (group C, n = 4; group D, n = 6) or without (group A, n = 7; group B, n = 9) 1 x 10(13) pfu/kg body weight of adenovirus carrying the CTLA4Ig gene. Mice in groups B and D received daily injections of NDGA (20 mg/kg body weight) subcutaneously for 4 weeks. Blood glucose levels less than 200 mg/dL were defined to be normoglycemic and the transplant termed as a functioning graft for the purpose of calculating mean graft function time (MFT). Four weeks posttransplantation, an intraperitoneal glucose tolerance test (IPGTT) was performed to calculate the area under the curve (AUC). Blood glucose levels in groups C and D were significantly lower than groups A and B at 1, 2, and 3 weeks after transplantation. Graft MFT and AUC of IPGTT in group D were significantly different from those in groups A and B. Our data suggested that a high dosage of systemic expression of CTLA4Ig was effective to enhance xenograft survival and that in it was reinforced by a combination with the macrophage inhibitor NDGA.


Assuntos
Imunoconjugados/uso terapêutico , Imunossupressores/uso terapêutico , Transplante das Ilhotas Pancreáticas/imunologia , Masoprocol/uso terapêutico , Transplante Heterólogo/imunologia , Abatacepte , Animais , Animais Recém-Nascidos , Diabetes Mellitus Experimental/cirurgia , Sobrevivência de Enxerto/efeitos dos fármacos , Sobrevivência de Enxerto/imunologia , Camundongos , Camundongos Endogâmicos BALB C , Modelos Animais , Suínos
16.
J Biomed Mater Res A ; 75(2): 283-7, 2005 Nov 01.
Artigo em Inglês | MEDLINE | ID: mdl-16059899

RESUMO

Chitosan is a cationic biopolymer derived from chitin with potential therapeutic applications such as controlled drug delivery to mucosal-epithelial surfaces in the body. Inhaled chitosan microparticles (CM), for example, are of potential interest in pulmonary pharmacotherapy. In this context, we examine some basic reactions of lung tissue to CM. Inhaled CM (2-10 mg/kg of particles) induce dose-dependent proinflammatory effects in rat lungs; these effects are documented in increases in bronchoalveolar lavage fluid protein (BALF-P) and lactate dehydrogenase activity (BALF-LDH) and increases in lung tissue myeloperoxidase (MPO) activity and leukocyte migration. Overall, the biochemical parameters (i.e., average of BALF-P, BALF-DH, and MPO) indicate that the inflammation response is 1.8-fold greater than controls without CM; the same inflammation parameters, however, are 1.9-fold lower with CM compared with the proinflammatory effects of lipopolysaccharide (LPS). Cytological examination of BALF shows a large infiltration of polymorphonuclear neutrophils to lung tissue: more than a sixfold increase in this population of inflammatory cells, after inhalation of CM relative to air inhalation controls. Thus, the results indicate that inhaled CM can have significant proinflammatory effects on lung tissues; these effects are mild relative to LPS but need to be considered in the context of therapeutic applications via pulmonary delivery if such concentrations of CM are used.


Assuntos
Quitosana/imunologia , Pulmão , Pneumonia , Animais , Líquido da Lavagem Broncoalveolar/química , Quitosana/administração & dosagem , Sistemas de Liberação de Medicamentos , L-Lactato Desidrogenase/metabolismo , Leucócitos/imunologia , Leucócitos/metabolismo , Lipopolissacarídeos/imunologia , Pulmão/citologia , Pulmão/imunologia , Pulmão/patologia , Masculino , Tamanho da Partícula , Peroxidase/metabolismo , Pneumonia/etiologia , Pneumonia/imunologia , Pneumonia/patologia , Ratos , Ratos Sprague-Dawley
17.
Prenat Diagn ; 24(12): 1007-12, 2004 Dec 15.
Artigo em Inglês | MEDLINE | ID: mdl-15614833

RESUMO

OBJECTIVE: The aim of this prospective study was to evaluate the impact of image magnification in the measurements of crown-rump length (CRL) and nuchal translucency (NT) thickness for first-trimester Down syndrome screening in Asians. METHODS: Ultrasound measurements of NT and CRL were performed in 561 consecutive Taiwanese unaffected fetuses and 11 cases of Down syndrome fetuses between 12 and 14 weeks of gestation. All sonographic images were measured by one qualified examiner to prospectively undergo first-trimester NT screening for Down syndrome. Fetal CRL and NT thickness were measured on three separated images including the original image, regular image, and the magnified image. RESULTS: A significant mean difference (0.59 +/- 4.24 mm) of CRL was found between measurements on the original and regular image (p < 0.001). There was a significant mean difference of NT thickness measurements between the regular and magnified image (0.12 +/- 0.25 mm, p < 0.001). Seven out of the 11 cases (63.6%) of Down syndrome with NT thickness > or =2.5 mm was measured on three separated images. A significantly reduced incidence of NT thickness > or =2.5 mm on the magnified image was noted than those of the original and regular image measurements in unaffected cases (p < 0.001). Either using the assessing method by the 95th centile cutoff value of NT thickness or combined risk, our results could achieve observed detection rate of 63.6% measured on three separated images. CONCLUSIONS: Our data indicate that the image magnification could reduce the false-positive rate by using a fixed cutoff value of NT thickness, but would have no influence on the results when using the assessing method either by the 95th centile cutoff value of NT thickness or the combined risk. In order to place the caliper more accurately, a magnified image should be recommended as a standard image in the measurements of the NT thickness.


Assuntos
Síndrome de Down/diagnóstico por imagem , Idade Gestacional , Medição da Translucência Nucal/métodos , Adulto , Estatura Cabeça-Cóccix , Reações Falso-Positivas , Feminino , Humanos , Gravidez , Estudos Prospectivos , Sensibilidade e Especificidade , Taiwan
18.
J Microencapsul ; 21(1): 91-106, 2004 Feb.
Artigo em Inglês | MEDLINE | ID: mdl-14718189

RESUMO

An approach is proposed using Vibrio cholerae (VC)-loaded microparticles as oral vaccine delivery systems for improved vaccine bioavailability and increased therapeutic efficacy. The VC-loaded microparticles were prepared with 50:50 poly(DL-lactide-co-glycolide) (PLG), 75:25 poly(DL-lactide-co-glycolide) and poly(lactide acid) (PLA)/PEG blend copolymers by the solvent evaporation method. VC was successfully entrapped in three types of microparticles with loading efficiencies and loading levels as follows: 50:50 PLG systems: 97.8% and 55.4 +/- 6.9 micro g/mg; 75:25 PLG systems: 89.2% and 46.5 +/- 4.4 micro g/mg; PLA/PEG-blended systems: 82.6% and 53.7 +/- 5.8 micro g/mg. The different distributions of VC in the core region and on the surface were as follows: 50:50 PLG systems 25.7 +/- 1.9 and 6.2 +/- 0.9 micro g/mg; 75:25 PLG systems: 25.8 +/- 2.2 and 3.6 +/- 0.4 micro g/mg; PLA/PEG-blended systems: 32.4 +/- 2.1 and 5.2 +/- 1.0 micro g/mg, respectively. In vitro active release of VC was affected mainly by matrix type and VC-loaded location in microparticles. The therapeutic immunogenic potential of VC loaded with 50:50 PLG, 75:25 PLG and PLA/PEG-blended microparticles was evaluated in adult mice by oral immunization. Significantly higher antibody responses and serum immunoglobin Ig G, IgA and IgM responses were obtained when sera from both VC-loaded 75:25 PLG and PLA/PEG-blended microparticles immunized mice were titrated against VC. The most immunogenicity in evoking serum IgG, IgA and IgM responses was immunized by VC-loaded PLA/PEG-blended microparticles, and with VC challenge in mice, the survival rate (91.7%).


Assuntos
Vacinas contra Cólera/administração & dosagem , Cólera/prevenção & controle , Microesferas , Vacinas de Produtos Inativados/administração & dosagem , Vibrio cholerae/imunologia , Administração Oral , Animais , Anticorpos Antibacterianos/biossíntese , Vacinas contra Cólera/química , Vacinas contra Cólera/imunologia , Composição de Medicamentos/métodos , Sistemas de Liberação de Medicamentos , Glicolatos/química , Ácido Láctico , Masculino , Camundongos , Camundongos Endogâmicos ICR , Ácido Poliglicólico , Copolímero de Ácido Poliláctico e Ácido Poliglicólico , Vacinação/métodos , Vacinas de Produtos Inativados/química , Vacinas de Produtos Inativados/imunologia
19.
J Microencapsul ; 21(7): 719-28, 2004 Nov.
Artigo em Inglês | MEDLINE | ID: mdl-15799222

RESUMO

Insulin-loaded poly(lactide) (PLA) microparticles were successfully prepared by 6% w/v PLA in the organic phase, 10% w/v PVP and varied types of 5%w/v electrolytes in the continuous phase, by using a water-in-oil-in-water emulsion/ solvent extraction technique. Addition of electrolytes such as NaCl, CaCl2 into the external phase significantly improved insulin entrapment efficiency compared to the case of no additives. NaCl was the most effective for obtaining high entrapment efficiency, with microparticle yield 81.2%, trapping efficiencies 49%, insulin-loading level 5.5% w/w and mean particle size 14.8 microm. The distribution (%) of insulin on the PLA microparticles surface, outer layer and core were 8, 37 and 43%, respectively. The cumulative release of insulin had an upper limit of approximately 24% of the insulin load at 24 days. A steady release rate was 0.5 microg insulin/mg microparticles/day of insulin release maintained for 24 days. Total protein-leaking amount was reduced after addition of electrolytes in the continuous aqueous phase. Rabbit glucose levels were evaluated after subcutaneous 20 mg insulin-loaded PLA microparticles or PLA blank microparticles. Study results show that the insulin-loaded PLA microparticles significantly reduced the glucose level than PLA blank microparticles. The insulin-loaded PLA microparticles, physicochemical characterization data and the animal result obtained in this study may be relevant in optimizing the PLA microparticle formulation incorporation and delivery insulin carriers.


Assuntos
Hipoglicemiantes/farmacocinética , Insulina/farmacocinética , Animais , Glicemia/análise , Preparações de Ação Retardada , Composição de Medicamentos/métodos , Eletrólitos , Hipoglicemiantes/sangue , Insulina/sangue , Masculino , Microesferas , Poliésteres , Coelhos , Distribuição Aleatória
20.
J Microencapsul ; 21(8): 877-88, 2004 Dec.
Artigo em Inglês | MEDLINE | ID: mdl-15799543

RESUMO

The purpose of this study was to evaluate ovalbumin (OVA) leakage pathways and to explore the mechanism of the surface-indented microparticle formation in the preparation of OVA-loaded microparticles. OVA-loaded poly (D,L-lactic-co-glycolic acid) (PLGA) microparticles were prepared by a water-in oil-in water (w/o/w) solvent evaporation method associated with varied NaCl (NaCl) concentrations and adjusted with urea at 1240mOsm kg(-1) in the external aqueous phase. To evaluate dichloromethane (DCM)-related OVA leakage, three stirring rates, 600, 800, 1000rpm at 25 degrees C were carried out during the solvent evaporation stage. Both DCM and OVA levels in the external phase medium and total dispersion were sampled and measured. The time course of particle characteristics was evaluated by microscopy or SEM photography. The surface adsorptive capacities of the prepared microparticles were measured by using bovine serum albumin conjugated with fluorescein isothiocyanate (FITC-BSA). The findings were that the DCM-related OVA leakage accounted for approximately 34%, of the total leakage. By combining NaCl in the external phase, a faster solidifying crust-like structure was formed as a barrier to remarkably reduce OVA loss and improve OVA content from 40.1 to 72.8 microg mg(-1). The yield and OVA content for formulations containing NaCl were much improved by the ionic effect, in addition to the osmotic effect. The total entrapment efficiency was also highly increased from 43 to 72%. The formations of the crust-like surface structure of the microparticle were affected by entrapped drugs, salt content in the external phase and aqueous volume in the inner phase. A scheme was proposed to interpret the formation mechanism of the surface-indented microparticles. In comparison to the surface-smooth microparticles, the surface adsorptive capacities of the surface-indented microparticles were highly improved from 26.6 to 87.0%, determined by the adsorption of FITC-BSA.


Assuntos
Ovalbumina/farmacocinética , Adsorção , Composição de Medicamentos/métodos , Sistemas de Liberação de Medicamentos , Concentração de Íons de Hidrogênio , Ácido Láctico , Cloreto de Metileno/farmacologia , Microesferas , Pressão Osmótica , Ácido Poliglicólico , Copolímero de Ácido Poliláctico e Ácido Poliglicólico , Polímeros , Soroalbumina Bovina , Cloreto de Sódio/farmacologia , Propriedades de Superfície
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA