Theonella: A Treasure Trove of Structurally Unique and Biologically Active Sterols.

The marine environment is considered a vast source in the discovery of structurally unique bioactive secondary metabolites. Among marine invertebrates, the sponge Theonella spp. represents an arsenal of novel compounds ranging from peptides, alkaloids, terpenes, macrolides, and sterols. In this review, we summarize the recent reports on sterols isolated from this amazing sponge, describing their structural features and peculiar biological activities. We also discuss the total syntheses of solomonsterols A and B and the medicinal chemistry modifications on theonellasterol and conicasterol, focusing on the effect of chemical transformations on the biological activity of this class of metabolites. The promising compounds identified from Theonella spp. possess pronounced biological activity on nuclear receptors or cytotoxicity and result in promising candidates for extended preclinical evaluations. The identification of naturally occurring and semisynthetic marine bioactive sterols reaffirms the utility of examining natural product libraries for the discovery of new therapeutical approach to human diseases.

Expanding the Library of 1,2,4-Oxadiazole Derivatives: Discovery of New Farnesoid X Receptor (FXR) Antagonists/Pregnane X Receptor (PXR) Agonists.

Compounds featuring a 1,2,4-oxadiazole core have been recently identified as a new chemotype of farnesoid X receptor (FXR) antagonists. With the aim to expand this class of compounds and to understand the building blocks necessary to maintain the antagonistic activity, we describe herein the synthesis, the pharmacological evaluation, and the in vitro pharmacokinetic properties of a novel series of 1,2,4-oxadiazole derivatives decorated on the nitrogen of the piperidine ring with different N-alkyl and N-aryl side chains. In vitro pharmacological evaluation showed compounds 5 and 11 as the first examples of nonsteroidal dual FXR/Pregnane X receptor (PXR) modulators. In HepG2 cells, these compounds modulated PXR- and FXR-regulated genes, resulting in interesting leads in the treatment of inflammatory disorders. Moreover, molecular docking studies supported the experimental results, disclosing the ligand binding mode and allowing rationalization of the activities of compounds 5 and 11.

Phytochemical Analysis of the Methanolic Extract and Essential Oil from Leaves of Industrial Hemp Futura 75 Cultivar: Isolation of a New Cannabinoid Derivative and Biological Profile Using Computational Approaches.

Cannabis sativa L. is a plant belonging to the Cannabaceae family, cultivated for its psychoactive cannabinoid (Δ9-THC) concentration or for its fiber and nutrient content in industrial use. Industrial hemp shows a low Δ9-THC level and is a valuable source of phytochemicals, mainly represented by cannabinoids, flavones, terpenes, and alkaloids, with health-promoting effects. In the present study, we investigated the phytochemical composition of leaves of the industrial hemp cultivar Futura 75, a monoecious cultivar commercially used for food preparations or cosmetic purposes. Leaves are generally discarded, and represent waste products. We analyzed the methanol extract of Futura 75 leaves by HPLC and NMR spectroscopy and the essential oil by GC-MS. In addition, in order to compare the chemical constituents, we prepared the water infusion. One new cannabinoid derivative (1) and seven known components, namely, cannabidiol (2), cannabidiolic acid (3), ß-cannabispirol (4), ß-cannabispirol (5), canniprene (6), cannabiripsol (7), and cannflavin B (8) were identified. The content of CBD was highest in all preparations. In addition, we present the outcomes of a computational study focused on elucidating the role of 2α-hydroxy-Δ3,7-cannabitriol (1), CBD (2), and CBDA (3) in inflammation and thrombogenesis.

Discovering New G-Quadruplex DNA Catalysts in Enantioselective Sulfoxidation Reaction.

The natural human telomeric G-quadruplex (G4) sequence d(GGGTTAGGGTTAGGGTTAGGG) HT21 was extensively utilized as a G4 DNA-based catalytic system for enantioselective reactions. Nine oligonucleotides (ODNs) based on this sequence and containing 8-bromo-2'-deoxyadenosine (ABr), 8-oxo-2'-deoxyadenosine (Aoxo) or ß-L-2'-deoxyadenosine (AL) at different single loop positions were investigated to evaluate their performances as DNA catalysts in an enantioselective sulfoxidation reaction of thioanisole. The substitution of an adenosine in the loops of HT21 with these modified residues had a negligible impact on the G4 DNA structural features, thermal stability, and catalytic activity, since almost all investigated ODNs were able to form G-quadruplexes strictly resembling that of HT21 and catalyze a full conversion of the thioanisole substrate. More marked effects were obtained in chiral selectivity of G4 DNA metalloenzymes, considering that in most cases the DNA-modified catalysts induced lower enantioselectivities compared to the natural one. However, the HT21 derivative containing an AL residue in the first loop sequence significantly proved to be capable of producing about 84% enantiomeric excess, the highest enantioselectivity for DNA-based oxidation reaction to date.

Biological Profile of Two Gentiana lutea L. Metabolites Using Computational Approaches and In Vitro Tests.

Natural products have been the main source of bioactive molecules for centuries. We tested the biological profile of two metabolites extracted from Gentiana lutea L. by means of computational techniques and in vitro assays. The two molecules (loganic acid and gentiopicroside) were tested in silico using an innovative technique, named Inverse Virtual Screening (IVS), to highlight putative partners among a panel of proteins involved in inflammation and cancer events. A positive binding with cyclooxygenase-2 (COX-2), alpha-1-antichymotrypsin, and alpha-1-acid glycoprotein emerged from the computational experiments and the outcomes from the promising interaction with COX-2 were confirmed by Western blot, highlighting the reliability of IVS in the field of the natural products.

Synergism of a Novel 1,2,4-oxadiazole-containing Derivative with Oxacillin against Methicillin-Resistant Staphylococcus aureus.

Staphylococcusaureus is an important opportunistic pathogen that causes many infections in humans and animals. The inappropriate use of antibiotics has favored the diffusion of methicillin-resistant S. aureus (MRSA), nullifying the efforts undertaken in the discovery of antimicrobial agents. Oxadiazole heterocycles represent privileged scaffolds for the development of new drugs because of their unique bioisosteric properties, easy synthesis, and therapeutic potential. A vast number of oxadiazole-containing derivatives have been discovered as potent antibacterial agents against multidrug-resistant MRSA strains. Here, we investigate the ability of a new library of oxadiazoles to contrast the growth of Gram-positive and Gram-negative strains. The strongest antimicrobial activity was obtained with compounds 3 (4 µM) and 12 (2 µM). Compound 12, selected for further evaluation, was found to be noncytotoxic on the HaCaT cell line up to 25 µM, bactericidal, and was able to improve the activity of oxacillin against the MRSA. The highest synergistic interaction was obtained with the combination values of 0.78 µM for compound 12, and 0.06 µg/mL for oxacillin. The FIC index value of 0.396 confirms the synergistic effect of compound 12 and oxacillin. MRSA treatment with compound 12 reduced the expression of genes included in the mec operon. In conclusion, 12 inhibited the growth of the MRSA and restored the activity of oxacillin, thus resulting in a promising compound in the treatment of MRSA infection.

Structure-based screening for the discovery of 1,2,4-oxadiazoles as promising hits for the development of new anti-inflammatory agents interfering with eicosanoid biosynthesis pathways.

The multiple inhibition of biological targets involved in pro-inflammatory eicosanoid biosynthesis represents an innovative strategy for treating inflammatory disorders in light of higher efficacy and safety. Herein, following a multidisciplinary protocol involving virtual combinatorial screening, chemical synthesis, and in vitro and in vivo validation of the biological activities, we report the identification of 1,2,4-oxadiazole-based eicosanoid biosynthesis multi-target inhibitors. The multidisciplinary scientific approach led to the identification of three 1,2,4-oxadiazole hits (compounds 1, 2 and 5), all endowed with IC50 values in the low micromolar range, acting as 5-lipoxygenase-activating protein (FLAP) antagonists (compounds 1 and 2), and as a multi-target inhibitor (compound 5) of arachidonic acid cascade enzymes, namely cyclooxygenase-1 (COX-1), 5-lipoxygenase (5-LO) and microsomal prostaglandin E2 synthase-1 (mPGES-1). Moreover, our in vivo results demonstrate that compound 5 is able to attenuate leukocyte migration in a model of zymosan-induced peritonitis and to modulate the production of IL-1ß and TNF-α. These results are of interest for further expanding the chemical diversity around the 1,2,4-oxadiazole central core, enabling the identification of novel anti-inflammatory agents characterized by a favorable pharmacological profile and considering that moderate interference with multiple targets might have advantages in re-adjusting homeostasis.

Wound healing activity and phytochemical screening of purified fractions of Sempervivum tectorum L. leaves on HCT 116.

INTRODUCTION: Sempervivum tectorum L. (Crassulaceae), is a succulent perennial plant widespread in Mediterranean countries and commonly used in traditional medicine for ear inflammation, ulcers and skin rashes as a refrigerant and astringent. OBJECTIVE: To demonstrate the therapeutic effects of the plant, various fractions were purified and characterised. The potential wound healing activity, proliferation rate and intracellular signalling cascades were investigated by using human epithelial colorectal carcinoma (HCT 116) cells. METHODOLOGY: An extraction method without organic solvents was applied for the first time. The purification was carried out by droplet counter current chromatography (DCCC) coupled with high-performance liquid chromatography (HPLC) and electrospray ionisation mass spectrometry (ESI-MS) data. By nuclear magnetic resonance (NMR) [1 H, 13 C and two-dimensional (2D) experiments] pure components were identified. Wound healing and cell proliferation assays were utilised to determine the role of the isolated S. tectorum (SVT) fraction on cellular migration and proliferation. The signalling pathways elicited from the SVT fractions, were analysed by Western blot analysis. RESULTS: In this study two rare natural components were identified, namely monosaccharide sedoheptulose and polyalcohol 2-C-methyl-D-erythritol, along with known organic acids and flavonoids. The fractions with high level of sedoheptulose enhance the proliferation and the cellular migration of epithelial HCT 116 cells. The intracellular signalling cascades elicited from the purified fractions induce the c-Src-mediated transactivation of EGFR and the activation of the STAT3 pathway which, in turn, are crucially involved in the cellular proliferation and migration. CONCLUSIONS: Our study demonstrates the efficacy of purified fractions of S. tectorum L. in enhancing cellular proliferation and migration, suggesting their potential role as topical therapeutic treatments for wound healing.

Chemistry and Pharmacology of GPBAR1 and FXR Selective Agonists, Dual Agonists, and Antagonists.

In the recent years, bile acid receptors FXR and GPBAR1 have attracted the interest of scientific community and companies, as they proved promising targets for the treatment of several diseases, ranging from liver cholestatic disorders to metabolic syndrome, inflammatory states, nonalcoholic steatohepatitis (NASH), and diabetes.Consequently, the development of dual FXR/GPBAR1 agonists, as well as selective targeting of one of these receptors, is considered a hopeful possibility in the treatment of these disorders. Because endogenous bile acids and steroidal ligands, which cover the same chemical space of bile acids, often target both receptor families, speculation on nonsteroidal ligands represents a promising and innovative strategy to selectively target GPBAR1 or FXR.In this review, we summarize the most recent acquisition on natural, semisynthetic, and synthetic steroidal and nonsteroidal ligands, able to interact with FXR and GPBAR1.

Phytochemical and Biological Studies of Nepeta asterotricha Rech. f. (Lamiaceae): Isolation of Nepetamoside.

The n-butanolic extract, from an Iranian specimen of Nepeta asterotricha Rech. f. (NABE), displayed anti-inflammatory effects on lipopolysaccharide (LPS)-stimulated J774A.1 macrophages, which reduced nitrites and cytokines production. Bioassay guided fractionation of the extract led to the isolation of four iridoid glycosides, including a new one known as nepetamoside (1), one hexenyl-diglycoside, and some polyphenol and flavonoid components. None of the isolated iridoid components displayed significant effects on nitrites formation in an in vitro LPS-induced model of inflammation, thus suggesting that the plant anti-inflammatory effect is probably due to a synergistic action among its constituents.

Investigation around the Oxadiazole Core in the Discovery of a New Chemotype of Potent and Selective FXR Antagonists.

Recent findings have shown that Farnesoid X Receptor (FXR) antagonists might be useful in the treatment of cholestasis and related metabolic disorders. In this paper, we report the discovery of a new chemotype of FXR antagonists featured by a 3,5-disubstituted oxadiazole core. In total, 35 new derivatives were designed and synthesized, and notably, compounds 3f and 13, containing a piperidine ring, displayed the best antagonistic activity against FXR with promising cellular potency (IC50 = 0.58 ± 0.27 and 0.127 ± 0.02 µM, respectively). The excellent pharmacokinetic properties make compound 3f the most promising lead identified in this study.

Discovery of ((1,2,4-oxadiazol-5-yl)pyrrolidin-3-yl)ureidyl derivatives as selective non-steroidal agonists of the G-protein coupled bile acid receptor-1.

The G-protein bile acid receptor 1 (GPBAR1) has emerged in the last decade as prominent target for the treatment of metabolic and inflammatory diseases including type 2 diabetes, obesity, and non-alcoholic steatohepatitis. To date numerous bile acid derivatives have been identified as GPBAR1 agonists, however their clinical application is hampered by the lack of selectivity toward the other bile acid receptors. Therefore, non-steroidal GPBAR1 ligands able to selectively activate the receptor are urgently needed. With this aim, we here designed, synthesized and biologically evaluated ((1,2,4-oxadiazol-5-yl)pyrrolidin-3-yl) urea derivatives as novel potent GPBAR1 agonists. Particularly, compounds 9 and 10 induce the mRNA expression of the GPBAR1 target gene pro-glucagon and show high selectivity over the other bile acid receptors FXR, LXRα, LXRß and PXR, and the related receptors PPARα and PPARγ. Computational studies elucidated the binding mode of 10 to GPBAR1, providing important structural insights for the design of non-steroidal GPBAR1 agonists. The pharmacokinetic properties of 9 and 10 suggest that the ((1,2,4-oxadiazol-5-yl)pyrrolidin-3-yl)ureydil scaffold might be exploited to achieve effective drug candidates to treat GPBAR1 related disorders.

Targeting Bile Acid Receptors: Discovery of a Potent and Selective Farnesoid X Receptor Agonist as a New Lead in the Pharmacological Approach to Liver Diseases.

Bile acid (BA) receptors represent well-defined targets for the development of novel therapeutic approaches to metabolic and inflammatory diseases. In the present study, we report the generation of novel C-3 modified 6-ethylcholane derivatives. The pharmacological characterization and molecular docking studies for the structure-activity rationalization, allowed the identification of 3ß-azido-6α-ethyl-7α-hydroxy-5ß-cholan-24-oic acid (compound 2), a potent and selective FXR agonist with a nanomolar potency in transactivation assay and high efficacy in the recruitment of SRC-1 co-activator peptide in Alfa Screen assay. In vitro, compound 2 was completely inactive towards common off-targets such as the nuclear receptors PPARα, PPARγ, LXRα, and LXRß and the membrane G-coupled BA receptor, GPBAR1. This compound when administered in vivo exerts a robust FXR agonistic activity increasing the liver expression of FXR-target genes including SHP, BSEP, OSTα, and FGF21, while represses the expression of CYP7A1 gene that is negatively regulated by FXR. Collectively these effects result in a significant reshaping of BA pool in mouse. In summary, compound 2 represents a promising candidate for drug development in liver and metabolic disorders.

Hyodeoxycholic acid derivatives as liver X receptor α and G-protein-coupled bile acid receptor agonists.

Bile acids are extensively investigated for their potential in the treatment of human disorders. The liver X receptors (LXRs), activated by oxysterols and by a secondary bile acid named hyodeoxycholic acid (HDCA), have been found essential in the regulation of lipid homeostasis in mammals. Unfortunately, LXRα activates lipogenic enzymes causing accumulation of lipid in the liver. In addition to LXRs, HDCA has been also shown to function as ligand for GPBAR1, a G protein coupled receptor for secondary bile acids whose activation represents a promising approach to liver steatosis. In the present study, we report a library of HDCA derivatives endowed with modulatory activity on the two receptors. The lead optimization of HDCA moiety was rationally driven by the structural information on the binding site of the two targets and results from pharmacological characterization allowed the identification of hyodeoxycholane derivatives with selective agonistic activity toward LXRα and GPBAR1 and notably to the identification of the first example of potent dual LXRα/GPBAR1 agonists. The new chemical entities might hold utility in the treatment of dyslipidemic disorders.

Biomolecular proteomics discloses ATP synthase as the main target of the natural glycoside deglucoruscin.

Extracts of Ruscus aculeatus are a rich source of bioactive steroidal glycosides, such as ruscogenins which are reported to act against chronic venous disorders. Nowadays, several preparations of its roots, commonly used in traditional medicine, are on the market as food supplements for health care and maintenance. Although spirostanol deglucoruscin is one of the main metabolites in these extracts, literature reports about its pharmacological profile are scarce. In this paper, a multi-disciplinary approach, based on chemical proteomics, molecular modelling and bio-organic assays, has been used to disclose the whole interactome of deglucoruscin and the F0-F1 ATP synthase complex has been found as its main target.

Anti-inflammatory and analgesic activities with gastroprotective effect of semi-purified fractions and isolation of pure compounds from Mediterranean gorgonian Eunicella singularis.

OBJECTIVE: To explore anti-inflammatory activities of organic extract and its semi-purified fractions (ethanol, acetone, methanol/dichloromethane) from the Mediterranean gorgonian Eunicella singularis. METHODS: The anti-inflammatory and analgesic activities were evaluated, using the carrageenan-induced rat paw edema model and the acetic acid writhing test in mice. The gastroprotective activity was determined using HCl/EtOH induced gastric ulcers in rats. The purification and structure elucidation of compound(s) from the more effective fraction were determined by chromatographic and spectroscopic methods and in comparison with data reported in the literature. RESULTS: The fraction F-EtOH showed an important anti-inflammatory activity associated with significant analgesic and gastroprotective properties. The purification and structure elucidation of compound(s) from this fraction lead to the identification of one diterpenoid and four sterols. CONCLUSIONS: These results suggested that components from the active fraction can be used to treat various anti-inflammatory diseases.

Molecular decodification of gymnemic acids from Gymnema sylvestre. Discovery of a new class of liver X receptor antagonists.

The individual chemical components of commercial extract of Gymnema sylvestre, a medicinal plant used in the traditional systems of the Indian medicine for its antidiabetic and hypolipidemic properties, were isolated and evaluated for their capability to act as modulators of nuclear and membrane receptors involved in glucose and lipid homeostasis. The study disclosed for the first time that individual gymnemic acids are potent and selective antagonists for the ß isoform of LXR. Indeed the above activity was shared by the most abundant aglycone gymnemagenin (10) whereas gymnestrogenin (11) was endowed with a dual LXRα/ß antagonistic profile. Deep pharmacological investigation demonstrated that gymnestrogenin, reducing the expression of SREBP1c and ABCA1 in vitro, is able to decrease lipid accumulation in HepG2 cells. The results of this study substantiate the use of G. sylvestre extract in LXR mediated dislypidemic diseases.

Pharmacological evaluation of the semi-purified fractions from the soft coral Eunicella singularis and isolation of pure compounds.

BACKGROUND: Gorgonians of the genus Eunicella are known for possessing a wide range of pharmacological activities such as antiproliferative and antibacterial effect. The aim of this study was to evaluate the anti-inflammatory and gastroprotective effect of the organic extract and its semi-purified fractions from the white gorgonian Eunicella singularis and the isolation and identification of pure compound(s) from the more effective fraction. METHODS: Anti-inflammatory activity was evaluated, using the carrageenan-induced rat paw edema test and in comparison to the reference drug Acetylsalicylate of Lysine. The gastroprotective activity was determined using HCl/EtOH induced gastric ulcers in rats. The purification of compound(s) from the more effective fraction was done by two chromatographic methods (HPLC and MPLC). The structure elucidation was determined by extensive spectroscopic analysis (1H and 13C NMR, COSY, HMBC, HMQC and NOESY) and by comparison with data reported in the literature. RESULTS: The evaluation of the anti-inflammatory activity of different fractions from Eunicella singularis showed in a dependent dose manner an important anti-inflammatory activity of the ethanol fraction, the percentage of inhibition of edema, 3 h after carrageenan injection was 66.12%, more effective than the reference drug (56.32%). In addition, this ethanolic fraction showed an interesting gastroprotective effect compared to the reference drugs, ranitidine and omeprazol. The percentage of inhibition of gastric ulcer induced by HCl/ethanol in rats was 70.27%. The percentage of the reference drugs (ranitidine and omeprazol) were 65 and 87.53%, respectively. The purification and structure elucidation of compound(s) from this ethanolic fraction were leading to the isolation of five sterols: cholesterol (5α-cholest-5-en-3ß-ol) (1); ergosterol (ergosta-5,22-dien-3ß-ol) (2); stigmasterol (24-ethylcholesta-5,22-dien-3b-ol) (3); 5α,8α-epidioxyergosta 6,22-dien-3ß-ol (4) and 3ß-hydroxy-5α,8α-epidioxyergosta-6-ene (5); and one diterpenoid: palmonine D (6). CONCLUSION: Based on data presented here, we concluded that diterpenoids and sterols detected in the ethanolic fraction can be responsible for its pharmacological activity.

Scalarane sesterterpenes from Thorectidae sponges as inhibitors of TDP-43 nuclear factor.

The analysis of two Thorectidae sponge samples, Hyrtios sp. and Petrosaspongia sp., collected at Fiji Islands, led to the isolation of five new scalarane derivatives along with fifteen known compounds. Their structures were elucidated on the basis of NMR and MS spectroscopic data. The small library of natural scalarane derivatives was investigated for their ability to modulate the activity of trans-activation response DNA-binding protein of 43 kDa (TDP-43), a key factor in several neurodegenerative conditions and the study resulted in the identification of potent inhibitors of TDP-43 protein.

Exploitation of cholane scaffold for the discovery of potent and selective farnesoid X receptor (FXR) and G-protein coupled bile acid receptor 1 (GP-BAR1) ligands.

Nuclear and G-protein coupled receptors are considered major targets for drug discovery. FXR and GP-BAR1, two bile acid-activated receptors, have gained increasing consideration as druggable receptors. Because endogenous bile acids often target both receptor families, the development of selective ligands has been proven difficult, exposing patients to side effects linked to an unwanted activation of one of the two receptors. In the present study, we describe a novel library of semisynthetic bile acid derivatives obtained by modifications on the cholane scaffold. The pharmacological characterization of this library led to the discovery of 7α-hydroxy-5ß-cholan-24-sulfate (7), 6ß-ethyl-3α,7ß-dihydroxy-5ß-cholan-24-ol (EUDCOH, 26), and 6α-ethyl-3α, 7α-dihydroxy-24-nor-5ß-cholan-23-ol (NorECDCOH, 30) as novel ligands for FXR and GP-BAR1 that might hold utility in the treatment of FXR and GP-BAR1 mediated disorders.