Phylogenetic analysis of the partial sequences of the env and tax BLV genes reveals the presence of genotypes 1 and 3 in dairy herds of Antioquia, Colombia.

Bovine leukemia virus (BLV) is a retrovirus that primarily infects dairy cows. Although few studies have also used the tax gene, phylogenetic studies of BLV use mostly the env gene. The aim of this work was to establish the circulating genotypes of BLV in specialized dairy cattle from Antioquia, Colombia. Twenty blood samples from Holstein Friesian cows were collected, and their DNA was isolated. A PCR was performed for a partial region of the env and tax genes. A phylogenetic analysis was carried out using the maximum likelihood and Bayesian methods for both genes. Nineteen sequences were identified as genotype 1 by env and tax genes. Only one sequence was clustered with genotype 3 and had the highest proportion of different nucleotide sites compared to other strains. Four amino acid substitutions in the 134 amino acid residue fragment of the Env protein were identified in the Colombian sequences, and three new amino acid substitutions were reported in the 296 amino acid residue fragment of the Tax protein. R43K (Z finger), A185T (Activation domain), and L105F changes were identified in the genotype 3 sample. This genotype has been reported in the United States, Japan, Korea, and Mexico, but so far, not in Colombia. The country has a high rate of imported live animals, semen, and embryos, especially from the United States. Although it is necessary to evaluate samples from other regions of the country, the current results indicate the presence of two BLV genotypes in specialized dairy herds.

Common surgical training program: standardization of learning quality. / Programa de formación quirúrgica común: uniformidad en la calidad del aprendizaje.

INTRODUCTION: The various surgical specialties in our center have used the simulation and experimental surgery resources available for their training tasks in minimally invasive surgery (MIS) in an individualized manner. With this learning model, a great dispersion of effort and expense was observed, so it was decided to create a unified program based on the following: shared learning, synergy among specialties, moderation of the economic cost, and rational use of the facilities. OBJECTIVE: To describe and assess our consensually designed training program in order to consolidate a shared learning strategy that will enable our residents to acquire and perfect surgical skills in MIS. MATERIALS AND METHODS: The program consists of various increasingly complex phases implemented on a continuous basis throughout the period of specialized training in the virtual laboratory and experimental operating room. The assessment methods were based on quantifiable criteria: percentage of efficiency and completion time of the "McGill Inanimate System for Training and Evaluation of Laparoscopic Skills" (MISTELS) exercises at the beginning and end of the program. An economic study was also conducted. RESULTS: 20 residents have completed the program. Mean times show a significant reduction in each of the exercises. The efficiency percentages at the end of the program were higher than at the beginning (p < 0.001). The cost of the program represented a saving of 67.89%. CONCLUSION: The new MIS training program improved the quality of learning in a safe environment, establishing common criteria among the different specialties and an improved use of resources.

INTRODUCCION: Las diferentes especialidades quirúrgicas de nuestro centro han usado los recursos de simulación y cirugía experimental para sus tareas de formación en cirugía mínimamente invasiva (CMI) de manera individualizada. Con este modelo de aprendizaje se detectó una gran dispersión de esfuerzos y gasto, por lo que se decidió crear un programa unificado basado en: aprendizaje compartido, sinergia entre especialidades, moderación del coste económico y uso racional de las instalaciones. OBJETIVO: Describir y evaluar nuestro programa de entrenamiento diseñado por consenso de cara a la consolidación de una estrategia de aprendizaje compartido que permita a nuestros residentes adquirir y perfeccionar habilidades quirúrgicas en CMI. MATERIAL Y METODOS: El programa consta de diferentes fases con complejidad creciente desarrolladas durante todo el periodo de formación especializada de forma continuada en laboratorio virtual y quirófano experimental. Los criterios de evaluación se basaron en criterios cuantificables: porcentaje de eficiencia y tiempo de realización de los ejercicios de McGill Inanimate System for Training and Evaluation of Laparoscopic Skills (MISTELS) al inicio y final del programa. Se realizó también el estudio económico. RESULTADOS: Han completado el programa 20 residentes. Los tiempos medios demuestran una reducción significativa en cada uno de los ejercicios. Los porcentajes de eficiencia al final fueron mayores que al inicio del programa (p < 0,001). El coste del programa supuso un ahorro del 67,89%. CONCLUSION: El nuevo programa de entrenamiento en CMI mejoró la calidad de aprendizaje en un entorno seguro, estableciendo criterios comunes entre las diferentes especialidades y un mayor aprovechamiento de los recursos.

Fetal hemoglobin regulating genetic variants identified in homozygous (HbSS) and heterozygous (HbSA) subjects from South Mexico.

Hemoglobin S is caused by a nucleotide change in HBB gene (HBB:c.20A>T, p.Glu6Val), is presented in diverse forms: simple carriers (HbSA), homozygotes (HbSS) also known as sickle cell anemia, and compound heterozygotes with other ß-hemoglobinopathies. It is worldwide distributed, in Mexico, is frequently observed in the southern states Guerrero, Oaxaca and Chiapas. Elevated fetal hemoglobin (HbF) is associated with mild phenotype; single-nucleotide variants (SNVs) in modifier genes, such as BCL11A, HBG2, HBBP1 pseudogene and HBS1L-MYB intergenic region, upregulate HbF synthesis. The aim of this study was to identify HbF regulating genetic variants in HbSS and HbSA Mexican subjects. We studied 39 individuals (HbSS = 24, 61%, HbSA = 15, 39%) from Chiapas (67%) and Guerrero (33%), peripheral blood was collected in ethylenediamine tetraacetic acid (EDTA) for molecular and hematological studies, DNA was isolated by salting-out technic and genotyping was performed through allelic discrimination by real time polymerase chain reaction (RT-PCR) using Taqman® probes for 15 SNV (in BCL11A: rs6706648, rs7557939, rs4671393, rs11886868, rs766432, rs7599488, rs1427407; HBS1L-MYB: rs28384513, rs7776054, rs9399137, rs4895441, rs9402686, rs1320963; HBG2: rs7482144; and HBBP1: rs10128556). The obtained data were analyzed using IMB SPSS v.22.0 software. All minor alleles were observed in frequencies over 0.05, the most frequent was rs9402686 (0.82), while the less frequent was rs101028556 (0.08). In HbSS group, the mean fetal hemoglobin was 11.9 ± 5.9% and was significantly elevated in BCL11A rs11886868 wildtype homozygotes and in carriers of HBS1L-MYB intergenic region rs7776054 (p = 0.04 and p = 0.03, respectively). In conclusion, in HbSS Mexican patients, two SNVs were observed related to increased HbF; BCL11A rs11886868 and HBS1L-MYB rs7776054.

Sickle cell anemia (SCA) is one of the most common types of hemoglobinopathies in people of African ancestry, it is caused by homozygosity of HbS mutation (HBB:c.20A>T). It is known that fetal hemoglobin plays a key role in decreasing HbS polymerization which damages the erythrocyte structure and is responsible for the characteristic hemolytic crises endured by these patients. Single-nucleotide variant (SNV) in genes that regulate fetal hemoglobin (HbF) after birth have been associated with its increment, thus ameliorating the hematologic phenotype of this pathology and other ß-hemoglobinopathies. Therefore, in this study, we identified, for the first time in Mexican patients with SCA (HbSS) and HbS carriers (HbSA), the presence of 15 SNVs on BCL11A, HBS1L-MYB and HBG2; all HbSS patients had anemia and elevated HbF; 2 variants were related to increased HbF rs11688888C of BCL11A and rs7776054G of HBSIL-MYB; and finally, all minor alleles were found at a frequency higher than 0.05.

[From in-person didactic sessions to videoconferencing during the COVID-19 pandemic: satisfaction survey among participants]. / Cambio de sesiones docentes presenciales a virtuales durante la pandemia de COVID-19 en un servicio de neurología: descripción del proceso y satisfacción de los usuarios.

INTRODUCTION AND AIM: COVID-19 pandemic has disturbed many hospital activities, including medical education. We describe the switch from in-person didactic sessions to videoconferencing in a Neurology department. We analyse the opinions and satisfaction of participants. MATERIAL AND METHODS: Narrative description of the adopted measures; Online survey among participants. RESULTS: One of the three weekly sessions was cancelled, and two switched to videoconferencing. There were more participants online than in the conference hall. 49 users answered the survey, 51% women, mean age 40.5 years (range 25-65). Satisfaction was higher for previous face-to-face meetings (8.68) than for videoconferencing (8.12) (p=0.006). There was a significant inverse correlation between age and satisfaction with virtual sessions (r=-0.37; p=0.01), that was not found for in-person attendance. Most users (75.5%) would prefer to continue with online sessions when the pandemic is over, and 87.8% support inter-hospital remote meetings, but the safety of web platforms is a concern (53.1%). CONCLUSIONS: The change from in-person to virtual sessions is an easy measure to implement in a neurology department, with a good degree of satisfaction among users. There are some unsolved problems with the use of commercial web platforms and inter-hospital connection. Most users recommend leadership and support from educational and health authorities.

TITLE: Cambio de sesiones docentes presenciales a virtuales durante la pandemia de COVID-19 en un servicio de neurología: descripción del proceso y satisfacción de los usuarios.Introducción y objetivo. La pandemia de COVID-19 ha trastornado la actividad hospitalaria, incluyendo la docente. Se describe el cambio de un sistema presencial a otro de sesiones en línea en un servicio de neurología, y se analizan la satisfacción y las opiniones de los usuarios. Material y métodos. Exposición de las medidas adoptadas para pasar a modalidad en línea y análisis de una encuesta entre los participantes. Resultados. Se pasó de tres a dos sesiones semanales, con restricción del público presencial. El público virtual superó al presencial. Contestaron la encuesta 49 participantes, un 51% mujeres, con una media de 40,5 años (rango: 25-65). La satisfacción de los asistentes fue mayor para las sesiones presenciales (8,68) que para las en línea (8,12) (p = 0,006). Existía una correlación inversa significativa entre la edad y la satisfacción con las sesiones en línea (r = ­0,37; p = 0,01) que no se daba para las sesiones presenciales. El 75,5% fue partidario de mantener las sesiones virtuales cuando se eliminaran las restricciones de aforo. Una mayoría (87,8%) apoyó sesiones interhospitalarias y recomienda que las autoridades sanitarias faciliten aplicaciones informáticas seguras (53,1%). Conclusiones. La introducción de sesiones virtuales es una medida fácil de implementar en un servicio de neurología, con un alto grado de satisfacción de los usuarios, aunque menor que con las sesiones presenciales. Existen problemas no resueltos respecto al uso de plataformas comerciales y conexión interhospitalaria. Sería recomendable que las autoridades sanitarias y educativas desarrollaran aplicaciones seguras y fomentaran la educación médica en línea.

Serum and CSF alpha-synuclein levels do not change in COVID-19 patients with neurological symptoms.

SARS-CoV-2 infection can associate diverse neurological manifestations. Several studies have provided proof to support the theory of neurotropic involvement of SARS-CoV-2. Alpha-synuclein has been described as a native antiviral factor within neurons, and upregulation of this protein can be seen in animals that suffered other neuroinvasive infections. To assess if increased expression of this protein takes place in COVID-19 patients with neurological symptoms, we analyzed serum total alpha-synuclein levels in three groups: seven COVID-19 patients with myoclonus, Parkinsonism and/or encephalopathy; thirteen age- and sex-matched COVID-19 patients without neurological involvement and eight age- and sex-matched healthy controls. We did not find differences among them. In a subset of four patients, the change in serum alpha-synuclein before and after the onset of neurological symptoms was not significant either. Cerebrospinal fluid alpha-synuclein levels were also similar between neurological COVID-19 and healthy controls. Overall, these results cannot support the hypothesis of alpha-synuclein upregulation in humans with neurological symptoms in COVID-19. Further research taking into account a larger group of COVID-19 patients including the whole spectrum of neurological manifestations and disease severity is needed.

IFN-γ mRNA expression is lower in Holstein cows infected with bovine leukemia virus with high proviral load and persistent lymphocytosis.

Bovine leukemia virus (BLV) is a retrovirus that affects primarily milky cows. Animals serologically positive to BLV show a Th1 cytokine profile with a predominance of interferon gamma (IFN-γ). IFN-γ has antiviral activity through mechanisms such as resistance to infection, inhibition of viral replication and apoptosis. The objective of this work was to determine the transcription levels of IFN-γ and its relationship with proviral load and persistent lymphocytosis in a population of Holstein cows of the province of Antioquia, Colombia. IFN-γ transcription levels were evaluated by qPCR in 140 Holstein cows. A one-way analysis of variance and a Student's t test were used to evaluate the differences between the means. The amount of IFN-γ mRNA found in BLV-positive cows was lower than in BLV-negative cows. Moreover, in the group of infected cows a lower level of IFN-γ mRNA expression was found in BLV and persistent lymphocytosis cows (BLV+PL) compared with BLV and aleukemia cows (BLV+AL). The level of IFN-γ mRNA expression was lower in cows with high proviral load (HPL) compared to cows with low proviral load (LPL). BLV infection is related to abnormal expression of IFN-γ mRNA, although IFN-γ has antiviral activity, its expression is affected by high proviral load. Keywords: cytokine; immune system; leukemia; bovine leukemia virus.

Pharmacologic management of patients with hepatic and pancreatic diseases that involve immunosuppressive therapies. Position statement within the framework of the SARS-CoV-2 (COVID-19) pandemic. / Manejo farmacológico de pacientes con enfermedades hepáticas y pancreáticas que involucran terapias inmunosupresoras. Posicionamiento en el marco de la pandemia de SARS-CoV-2 (COVID-19).

The coronavirus disease 2019 (COVID-19) is caused by the severe acute respiratory syndrome coronavirus2 (SARS-CoV-2) virus. COVID-19 affected more than 6million persons worldwide in fewer than 4 months, after the report of the first cases in China in December 2019. The relation of the disease caused by SARS-Cov-2 to immunosuppressive treatment used in different gastrointestinal disorders is uncertain, resulting in debate with regard to suspending immunosuppressive therapy to improve infection outcome. Said suspension implies the inherent risk for graft rejection or autoimmune disease exacerbation that can potentially worsen the course of the infection. Based on the presently available evidence, a treatment stance has been established for patients with gastrointestinal diseases that require immunosuppressive therapy.

Adaptation and validation of the Stanford Presenteeism Scale-6 in healthcare professionals.

AIM: To develop and psychometrically test the Stanford Presenteeism Scale-6 to assess presenteeism in the Spanish healthcare population. BACKGROUND: Presenteeism, referring to going to work despite being ill, has been associated with job stress, productivity losses, reduced patient safety and increased health problems among the professionals who suffer from it. INTRODUCTION: The highest prevalence of presenteeism in the healthcare sector is among nurses. Their decision to attend work while ill has been related to role overload, lack of supervisor support, mental health and physical conditions. METHODS: A cross-sectional and validation study was conducted between September 2015 and June 2016 in a hospital in Asturias, Spain. Four hundred and ninety-five healthcare professionals voluntarily agreed to participate (281 nurses, 122 physicians and 92 nursing assistants). RESULTS: Presenteeism prevalence was high; the majority of it being in the nursing category. Bartlett's test and the Kaiser-Meyer-Olkin test indicated that the data meet the conditions for factorial analysis, evidencing a small variability in the median of each sample item and a significant standard deviation. Adjustment rates obtained in the exploratory factor analysis showed adequacy, and reliability rates also showed adequacy for both factors. It was verified by a confirmatory analysis that the factors of presenteeism are positively associated with burnout. CONCLUSION: The Stanford Presenteeism Scale-6 showed good psychometric properties to study presenteeism in the Spanish healthcare sector. IMPLICATIONS FOR NURSING AND HEALTH POLICY: Nursing leaders must develop measurements to assess and control psychosocial risks in order to improve the physical and mental health of professionals and reduce patient safety risks.

[Cavernous sinus syndrome as the initial symptom of Burkitt's lymphoma: a case report and literature review]. / Sindrome del seno cavernoso como inicio de un linfoma de Burkitt: a proposito de un caso y revision de la bibliografia.

INTRODUCTION: The cavernous sinus is a structure in the base of the skull that houses several nerve and vascular structures. Its compromise leads to cavernous sinus syndrome, which is a combination of oculomotor disorders and others affecting the first two trigeminal branches, often accompanied by pain or proptosis. Infiltration due to Burkitt's lymphoma is a rare cause of this syndrome. CASE REPORT: A 43-year-old male, carrier of human immunodeficiency virus, with good control of the disease, who developed a clinical picture consisting of progressive painful ophthalmoplegia in the presence of a laterocervical adenopathy. Complementary tests allowed a diagnosis of Burkitt's lymphoma with extranodal extension to the cavernous sinus. A review of the cases published in Medline was also carried out: a total of 15 cases were detected and their epidemiological characteristics, form of presentation, extracranial involvement at the time of diagnosis and clinical progression were described. CONCLUSIONS: Burkitt's lymphoma is a high-grade lymphoproliferative syndrome. Its form associated with immunodeficiency is an important cause of morbidity and mortality in this subgroup of patients. In the cases analysed in the literature, the age of presentation varied and the form of onset was a progressive painful ophthalmoplegia or numb chin syndrome. Exclusive involvement of the cavernous sinus was infrequent, but in that case it entailed a poor prognosis. It is important to rule out a primary extracranial origin and not to confuse it with an idiopathic Tolosa-Hunt syndrome that would delay the beginning of antitumour treatment.

TITLE: Sindrome del seno cavernoso como inicio de un linfoma de Burkitt: a proposito de un caso y revision de la bibliografia.Introduccion. El seno cavernoso es una estructura de la base craneal que alberga varias estructuras nerviosas y vasculares. De su afectacion se deriva el sindrome del seno cavernoso, una combinacion de alteraciones oculomotoras y de las dos primeras ramas del trigemino, frecuentemente acompañadas de dolor o proptosis. La infiltracion por un linfoma de Burkitt es una causa infrecuente de este sindrome. Caso clinico. Varon de 43 años, portador del virus de la inmunodeficiencia humana, con buen control de la enfermedad, que desarrolla un cuadro consistente en oftalmoplejia dolorosa progresiva en presencia de adenopatia laterocervical. Las pruebas complementarias permiten el diagnostico de linfoma de Burkitt con extension extranodal al seno cavernoso. Tambien se realiza una revision de los casos publicados en Medline: se recogen un total de 15 casos y se describen sus caracteristicas epidemiologicas, forma de presentacion, afectacion extracraneal en el momento del diagnostico y evolucion clinica. Conclusiones. El linfoma de Burkitt es un sindrome linfoproliferativo de alto grado. Su forma asociada a inmunodeficiencia es una importante causa de morbimortalidad en este subgrupo de pacientes. En los casos analizados en la bibliografia, la edad de presentacion fue variable y la forma de inicio fue una oftalmoplejia dolorosa progresiva o un sindrome de numb chin. Fue infrecuente una afectacion exclusiva del seno cavernoso, pero en ese caso conllevaba un mal pronostico. Es importante descartar un origen primario extracraneal y no confundirlo con un sindrome de Tolosa-Hunt idiopatico que retrasaria el inicio del tratamiento antitumoral.

[«Salt and pepper¼ sign in the onset of a non-vascular pontine pathology]. / Signo de «sal y pimienta¼ como presentacion de una lesion pontina no vascular.

TITLE: Signo de «sal y pimienta¼ como presentacion de una lesion pontina no vascular.

Donation After Cardiac Death in Liver Transplantation: An Additional Source of Organs With Similar Results to Donation After Brain Death.

BACKGROUND: As new sources of organs are needed, liver transplantation using donors after cardiac death (DCD) is progressively increasing, but outcomes with this method are still questioned. This study was accomplished to verify that DCD outcomes are comparable to those seen in donation after brain death (DBD). METHODS: This was a prospective cohort study including 100 liver transplantation performed between 2014 and 2017, divided according to donor type in 75 DBD and 25 DCD. RESULTS: DCD donors were younger (mean age: DCD 56 years, DBD 59 years; P = .009). Mean Modified End-stage Liver Disease (MELD) score was lower for DCD (DCD 16, DBD 19; P < .001). No differences were found regarding ischemia times and development of postreperfusion syndrome or coagulopathy. Primary graft dysfunction was more frequent in DCD (60%, DCD 29.3%; P = .006). Rates of primary graft nonfunction (DCD 0%, DBD 1.3%; P = .562) and acute rejection (DCD 20%, DBD 16.4%; P = .685) were similar. Acute kidney injury occurred more often in DBD (DCD 32%, DBD 12%; P = .051). Length of stay was comparable. Rates of biliary complications (DCD 20%, DBD 26.7%; P = .505) were similar, unlike ischemic cholangiopathy (DCD 12%, DBD 1.3%; P = .018). Retransplantation rates were also similar (DCD 8%, DBD 4%; P = .427) as was survival rate after 3 years (DCD 84%, DBD 86.7%; P = .739). CONCLUSION: DCD represents an additional graft source with results that are encouraging and may be comparable to DBD with a careful donor and recipient selection.

Comparison of 3 Explant-Based Prognostic Models as Predictors of Hepatocellular Carcinoma Recurrence After Liver Transplantation: Analysis of Our Experience.

Tumor load is often underdiagnosed on radiological examination previous to liver transplantation (LT) for hepatocarcinoma (CHC). Thus, post-liver transplant explant analysis is required following transplantation to assess the risk of the recurrence of CHC. The objectives were to compare the characteristics of CHC on pre-LT radiological examination and explant histology and validate three models for the prediction of recurrence based on data from a cohort of patients treated in our hospital. METHODS: A retrospective study was undertaken of 105 LTs for CHC performed in our unit between January 2006 and January 2015. The minimum follow-up was five years. The preoperative radiological tumor stage was compared to the explant-based histologic stage. Three prognostic models were validated using our cohort of patients. RESULTS: Following Milan's criteria, the tumor load was underdiagnosed on pre-LT radiological examination in 20 patients, which accounted for 19% of the total sample. The 5-year overall recurrence was 6.6% for scores <4 and 33.3% for scores ≥4 according to Decaens' model; 7% for scores ≤7 and 25% for scores >7 in the Up-to-Seven model; and 3.6% for PCRS ≤0, 27.8% for PCRS1-2, and 100% for PCRS≥3 according to Chan's model. The predictive model for 5-year recurrence after LT with the greatest area under the curve was Chan's model (0.813 [95% CI: 0.650-0.977]) versus Decaens' model (0.674 [95% CI: 0.483-0.866]) and the Up-to-Seven model (0.481 [95% CI: 0.296-0.667]). CONCLUSIONS: A pre-LT radiological examination leads to the underdiagnosis of tumor load, and the risk for recurrence must be recalculated following LT. In light of the results obtained, Chan's model is more accurate in predicting 5-year recurrence of CHC post-LT based on 3 levels of risk. New prognostic models are needed to optimize the prediction of recurrence after liver transplantation for hepatocarcinoma.

Combined Flush With Histidine-Tryptophan-Ketoglutarate and University of Wisconsin Solutions in Liver Transplantation: Preliminary Results.

INTRODUCTION: Ischemia reperfusion injury (IRI) is the main cause of early allograft dysfunction (EAD) and subsequent primary allograft failure (PAF). OBJECTIVES: The purpose of this study is to compare IRI, EAD, and PAF in liver transplantation in a cohort of patients perfused with histidine-tryptophan-ketoglutarate (HTK) solution and University of Wisconsin (UW) solution versus HTK alone. METHODS: A randomized trial was performed to compare outcomes in liver recipients who underwent transplantation surgery in the University Regional Hospital of Malaga, Spain. Forty patients were randomized to two groups. Primary endpoints included IRI, EAD, PAF, re-intervention, acute cellular rejection, retransplantation, arterial complications, and biliary complications at postoperative day 90. RESULTS: Postoperative glutamic oxaloacetic transaminase (1869.15 ± 1559.75 UI/L vs. 953.15 ± 777.27 UI/L; P = .004) and glutamic pyruvic transaminase (1333.60 ± 1115.49 U/L vs. 721.70 ± 725.02 U/L; P = .023) were significantly higher in patients perfused with HTK alone. A clear tendency was observed in recipients perfused with HTK alone to present moderate to severe IRI (7 patients in the HTK + UW solution group vs. 15 patients in the HTK-alone solution group; P = .06), EAD (0 patients in the HTK + UW solution group vs. 0 patients in the HTK-alone solution group; P = .76), and PAF (3 patients in the HTK + UW solution group vs. 8 patients in the HTK-alone solution group; P = .15). CONCLUSIONS: Initial perfusion with HTK solution followed by UW solution in liver transplantation improves early liver function as compared to perfusion with HTK alone.

Multicentric Study of the Andalusian Experience in Polycystic Liver Disease as Indication for Liver Transplantation.

BACKGROUND: The purpose of this study was to determine the morbidity and survival in patients with polycystic liver disease (PLD) undergoing liver transplantation (LT) in 4 Spanish hospitals. METHODS: A multicentric retrospective study using a prospective database was designed including 19 LTs after PLD diagnosis performed from January 1, 1990, to December 31, 2016. Pediatric patients were excluded from the analysis. RESULTS: Of the included patients, 63.2% were female, the overall average age was 52.16 ± 11.276 years, median time on the waiting list was 394 days (interquartile range [IQR], 96.25-464.50) and most of them were classified with Model for End-Stage Liver Disease scores of ≤17. Eleven patients received isolated LT, 1 patient had a previous kidney transplantation (KT), and 7 patients received combined liver-kidney transplantation, 4 of them with a previous nephrectomy. Complications include hepatopulmonary syndrome in 10.5%, paralytic ileus in 10.5%, transient renal dysfunction in 10.5%, and hepatorenal syndrome in 5.3%. The most common surgical complication was bleeding (15.8%). Three patients presented graft rejection, which was treated by means of immunosuppressive optimization (15.8%), with corticosteroid addition needed in 1 of them. Thrombosis of the hepatic artery occurred in 3 patients, requiring retransplantation in 2 of them. Most of the patients had improved renal function after the procedure. The mortality rate was 15.8%, related to tumors or sepsis, with an estimated 86% 5-year graft survival. CONCLUSIONS: PLD as indication of LT presents a low complications rate and better graft survival and renal function, especially when KT is associated with LT.

Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of ß-Thalassemia in Mexican mestizo patients.

INTRODUCTION: Beta-thalassemia (ß-thal) is frequent in Mexican patients with microcytosis and hypochromia. We report three novel mutations and analyze the actual mutational spectrum in Mexican population. METHODS: One hundred and forty-nine ß-thal Mexican mestizo patients were studied (154 alleles). ARMS-PCR was performed to identify Cd39C>T, IVS1:1G>A, IVS1:110G>A, -28A>C, initiation codonA>G and IVS1:5G>A mutations, and gap-PCR for δß-thal Spanish type. DNA sequencing of HBB gene was carried out in negative samples for the initial screening. RESULTS: Fifteen different HBB gene mutations were observed in 148 alleles; three of them are novel: -90C>G, 20 bp deletion (at codons 78/85), and IVS2:2T>G; the mutation IVS1:6T>C that was observed for first time in our population; and eleven previously described mutations. Six alleles showed normal HBB sequence. To date, a total of 21 different mutations have been observed in Mexican patients; the four most frequent mutations are of Mediterranean origin: Cd39C>T (37.2%), IVS1:1G>A (17.3%), IVS1:110G>A (13.9%), and δß-thal Spanish type (9.0%), which represent 77.4% of the total studied alleles. CONCLUSION: Considering the novel mutations -90C>G, -20 bp Cd78/85, IVS2:2T>G and the first observation of IVS1:6T>C, the molecular spectrum of ß-thal in Mexicans comprises 21 different mutations, confirming the high allelic heterogeneity in Mexicans.

Up-to-7 Criteria for Hepatocellular Carcinoma Liver Transplantation: A Retrospective Analysis of Experiences.

INTRODUCTION: The expansion of criteria for hepatocellular carcinoma (HCC) liver transplantation should produce satisfactory outcomes in terms of survival and recurrence. OBJECTIVES: To investigate if the up-to-7 criteria are applicable to liver transplantation for HCC. METHODS: A review of all liver transplantations performed at our unit between January 2002 and December 2010 was conducted (645 patients). The 91 patients of the sample who had HCC were divided into 3 groups: in Milan criteria (MC; n = 74), in up-to-7 criteria (UTSC; n = 12), and outside of up-to-7 criteria (OUTSC; n = 5). A descriptive retrospective study was carried out to analyze the characteristics of liver tumors and recipients and to estimate recurrence and survival rates for this population of patients. RESULTS: The characteristics of transplant recipients of the 3 groups were comparable. Statistically significant differences were observed in the number of tumors (1 ± 0.65 for MC, 3 ± 1.05 for UTSC, 6 ± 4.10 for OUTSC; P < .001), largest tumor size (2.47 ± 1.12 cm for MC, 3.78 ± 0.04 cm for UTSC, 4.04 ± 1.73 cm for OUTSC; P < .001), and recurrence (5.4% for MC; 33.3% for UTSC; 20% for OUTSC; P = .008). Survival rates (MC, UTSC, and OUTSC) at 3 and 5 years were 71.6%, 66.7%, and 60%, and 58.1%, 58.3%, and 40%, respectively, whereas tumor-free survival rates were 70.3%, 58.3%, and 60%, and 58.1%, 50%, and 40%, respectively. CONCLUSIONS: Survival in patients with HCC transplanted under up-to-7 criteria is acceptable. However, the expansion of criteria involves an increase in the number of patients included in the waiting list and a higher probability of relapse.

Acute Liver Failure Caused by Primary Non-Hodgkin's Lymphoma of the Liver.

INTRODUCTION: Acute liver failure (ALF) is a rare syndrome involving maximum liver dysfunction. This disease is characterized by a less than 26-week history of coagulopathy (INR ≥1.5) and hepatic encephalopathy and generally occurs in patients without any previously known disease. METHODS: We report the case of a healthy 25-year-old subject who presented with fulminant liver failure caused by a primary non-Hodgkin's lymphoma of the liver that required emergency liver transplantation. Diagnosis was based on pathologic confirmation of T-cell/histiocyte-rich large B-cell lymphoma and submassive hepatocyte necrosis. One year after surgery, the patient remains in complete remission. CONCLUSIONS: Fulminant liver failure is a sudden-onset severe disease that can be caused by a primary non-Hodgkin's lymphoma of the liver, which accounts for <1% of extranodal lymphomas. The diagnosis of this rare disease demands high diagnostic suspicion, and progression can be prevented through liver transplantation.

Pancreas Preservation With Viaspan, Celsior, and Custodiol Solutions: An Initial Experience.

BACKGROUND: There is still controversy about which preservation solution in pancreas transplantation could be the best. The aim of this study was to analyze our initial experience with Custodiol solution (CuS) compared with Viaspan solution (VS) and Celsior solution (CS) in pancreas transplantation. METHODS: A retrospective study included 94 consecutive pancreatic transplants, from 2007 until 2015. We compared 3 groups, depending on preservation solution: Viaspan (n = 41), Celsior (n = 40), or Custodiol (n = 13). The primary end point was patient and pancreas survival at 1 year after pancreas transplantation. RESULTS: The recipient and donor characteristics were similar except in cold ischemia time; it was higher with Celsior. No differences were found in postoperative complications and pancreas graft function at 3 months, 6 months, and 1 year (glucose, HbA1c, C-peptide, creatinine). The pancreas and patient survival at 1 year was comparable (pancreas survival: VS, 80%; CS, 90%; CuS, 92%; log-rank, 0.875; and patient survival: VS, 92%; CS, 97%; CuS, 100%; log-rank, 0.9). CONCLUSIONS: In our institution, the Custodiol solution in pancreas transplantation presented similar outcomes in terms of postoperative complications, pancreas graft function, and 1-year survival.

Impact of Liver Graft Transport on Postoperative Results and Short-Term Liver Survival.

BACKGROUND: The Andalusian community has a specific management model of liver transplantation with a common waiting list, forcing transportation of 45% of hepatic grafts. These trips within the community have been made exclusively via expressway since 2012, sometimes surpassing 400 km in distance. The objective of this study was to analyze the effect of graft transportation on our community regarding postoperative results, primary dysfunction, and short-term graft survival. METHODS: This was a retrospective observational cohort study that included 110 patients recipients of liver transplants from 2009 to 2012. Group A (n = 53) were patients transplanted with grafts removed in Malaga, and group B (n = 57) were patients with transported grafts. RESULTS: In group B, significant increments in total and cold ischemia time (TIT and CIT) were found. We found a significant higher increase, mostly in 2012, in TIT and CIT in the greater transportation distance subgroup (>150 km). In postoperative variables analysis, differences were found in the bilirubin levels the 1st postoperative day, alkaline phosphatase levels the 1st and 3rd days, and factor V in the 1st day in favor of the nontransported grafts. In the multivariable analysis transport and distance travelled in km presented a relationship with the 1st day bilirubin levels and the primary dysfunction of the graft. CONCLUSIONS: Our results point to graft transportation having an influence on primary dysfunction and graft survival. This relationship can be multifaceted and influenced by currently unknown factors. This is a factor to consider regarding liver transplant management strategy decisions.

Results of Liver Transplantation With Donors Older than 75 Years: A Case-Control Study.

BACKGROUND: The inclusion of elderly donors can increase the pool of organs available for transplantation. The objective of this study was to compare clinical outcomes and survival rates of patients who received livers from donors aged ≥75 years versus younger donors. METHODS: We considered all liver transplantations performed in our unit from January 2006 to January 2015. Thirty-two patients received a liver from a cadaveric donor aged ≥75 years (study group), and their outcomes were compared with those of patients who received a liver from a younger donor (control group) immediately before and after each transplantation in the study group. This is a descriptive, retrospective, case-control study carried out to analyze the characteristics of donors and recipients as well as the clinical course and survival of recipients of older and younger donors. RESULTS: Statistically significant differences were observed according to donors' age (53.3 ± 13.6 vs 79 ± 3.4 years; P < .001). In total, 6.2% of the recipients of a liver from a donor aged <75 years required retransplantation versus 15.6% of recipients of donors ≥75 years. Patient survivals at 1, 3, and 5 years, respectively, were 89%, 78.6%, and 74.5% for recipients of donors <75 years versus 83.4%, 79.4%, and 59.6% for the study group. CONCLUSIONS: Livers from older donors can be safely used for transplantation with acceptable survival rates. However, survival rates are lower for recipients of livers from older donors compared with younger donors, and survival only increased with retransplantation.