[A questionnaire survey for gout management in physicians in Beijing].

Objective: To provide helpful continued medical education (CME) for physicians and improve gout treatment, we conducted a questionnaire survey to investigate physicians' knowledge in nine districts of Beijing. Methods: A questionnaire survey including ten gout-related questions was conducted among 298 physicians in Beijing. Demographic data and previous gout CME experience were collected. Chi-square test or Student's t test, univariate analysis and logistic regression analysis were used to evaluate the relevant factors of physicians' knowledge level. Results: A total of 250 valid copies were collected including 127 from community service centers (CSC), 123 from tertiary hospitals. The correct answer rate of gout etiology, pathogenesis and attack symptoms were over 70% in both groups. 45.5% (56/123) CSC doctors and 57.4% (66/115) tertiary doctors answered right drugs to control acute gout attack (P=0.067). Only 42.3% (52/123) in CSC and 53.4% (63/118) in hospitals chose allopurinol as a urate-lowering drug (ULT), while 46.3% (57/123) and 32.2% (38/118) doctors considered colchicine as a ULT drug (P=0.084) respectively. Near half doctors considered that gout patients should take long-term ULT [40.5% (51/126) vs. 57.6%(68/118)respectively, P=0.007]. Univariate analysis showed that CME training could improve gout-related knowledge in CRC doctors. Conclusion: Most CSC doctors generally understand basic knowledge of gout, while confusion of treatment is still significant. CME especially including standard gout treatment should be performed by doctors in tertiary hospitals.

[Glycogen storage disease type â a: a rare cause of gout in adolescent and young adult patients].

Objective: To analyze the clinical features of secondary gout in glycogen storage disease type Ⅰa (GSD Ⅰa), so as to improve the awareness of this disease. Methods: The clinical features, laboratory findings, treatments and prognosis of 5 GSD Ⅰa patients with secondary gout who had been admitted to the Peking Union Medical College Hospital during 2006 to 2016 were collected and analyzed. GSD Ⅰa was confirmed by liver biopsy and genotyping. Results: Among the 5 patients (median age: 27 years), 3 were males and 2 were females. The mean age of gout onset was 17 ranging from 10 to 22 years old. The common manifestations of GSD included hepatomegaly since childhood, hypoglycemia, growth retardation, anemia, hyperlactacidemia and hyperlipidemia. All the 5 patients were complicated with gouty tophi and kidney stone. Gouty tophi and kidney stone were identified 3.8 years and 10.2 years after the first occurrence of articular symptoms, respectively. Renal damage occurred in 3 cases. All the patients underwent several therapeutic modalities including lifestyle intervention, allopurinol, and raw corn starch treatment. Conclusions: Determination of the presence of primary disease should be performed actively for young-onset gout with early occurrence of gouty tophi. GSD should be suspected if there exist clinical manifestations like hepatomegaly, recurrent hypoglycemia, growth retardation. Early management of hyperuricemia and gout in GSD patients is important to prevent complications and improve prognosis.

[The clinical characteristics, diagnosis and treatment of patients with gout in China].

Objective: To investigate the demographic characteristics, clinical features, diagnosis and treatment of patients with gout in China. Methods: Clinical data of 6 814 patients with gout from 100 hospitals in 27 provinces, municipalities or autonomous regions in China were collected and analyzed. Results: (1) The ratio of male to female in patients with gout was 14.7∶1. The mean age of onset was (48.8±15.1) years old. Mean serum urate level was (526.7±132.3) µmol/L. Patients' education background was of U-shaped distribution; (2) Hypertension was the most common comorbidity [15.8%(1 079/6 814)], then overweight or obesity [51.9%(3 536/6 814)]; (3) Alcohol and high-purine food intake were dominant triggering factors in men. The diagnosis of gout was made after onset in majority of patients with cardinal symptom arthralgia. Most patients had the disease less than 5 years, and the longer the course, the more flares in the previous year of entry; (4) Febuxostat was the mostly used urate-lowering medication. 20.7%(1 412/6 814), 10.8%(739/6 814) and 3.9%(265/6 814) of patients were followed up in 4 weeks, 12 weeks and 24 weeks after registration, and 18.9%(267/1 412), 29.1%(215/739) and 38.1%(101/265) of them reached the control target of serum urate levels, respectively. After treatment, patients' liver function was not affected, but serum creatinine levels decreased significantly. Conclusions: The proportion of gout patients who reach target serum urate level is very low. Further steps including education and survey need to be carried on.

[The associations between adenosine triphosphate binding cassette subfamily G member-2 single nucleotide polymorphism and hyperuricemia in a Chinese tertiary hospital faculty cohort].

Objective: To investigate gender specific association between single nucleotide polymorphism rs2231142 and hyperuricemia. Method: A matched case-control study was conducted in a faculty cohort of a tertiary hospital in Beijing. The enrollment criteria were faculty member of the hospital with signed consent. The exclusion criteria were tumor, previous renal diseases, renal function damage, pregnancy, currently taking medicines that could increase or decrease serum uric acid level, and those who had gout. Males with serum uric acid>416.4 µmol/L and females with serum uric acid> 359.6 µmol/L were enrolled as hyperuricemia group. Subjects with normal serum uric acid were randomly enrolled at 1∶2 ratio after matching for gender, age, renal function and body mass index. Rs2231142(C>A) was assayed by amplification refractory mutation system polymerase chain reaction, with common forward primer: 5' GGCTTTGCAGACATCTATGG 3', C specific reverse primer: 5'CGAAGAGCTGCTGAGAAATG 3', and A specific reverse primer: 5' CGAAGAGCTGCTGAGAAATT 3'.Association between rs2231142 and hyperuricemia was analyzed in the general study group, as well as different gender and age groups. Results: A total of 198 subjects with hyperuricemia and 370 controls were enrolled. The A allele frequency of rs2231142 was significantly higher in the hyperuricemia group than control group (38.38% vs 26.62%, P<0.001), with an OR for hyperuricemia of 2.89 (95%CI 1.91-4.37, P<0.001). After adjustment for hypertension, hyperglycemia and dyslipidemia, the OR was 2.99 (95%CI 1.94 - 4.62, P<0.001). Subgroup analysis showed that the ORs were 3.83 (95%CI 2.03-7.24, P<0.001) in male and 2.30 (95%CI 1.32-4.00, P=0.003) in female. In those 55 years or older, the gender differences of ORs were decreased, with ORs of 3.23 (95%CI 1.02-10.29, P=0.047) in male and 3.06 (95%CI 1.37-6.84, P=0.006) in female. While in those less than 55 years, the gender differences of ORs were enlarged, with ORs of 4.11 (95%CI 1.92-8.79, P<0.001) in males and 1.73 (95%CI 0.80-3.76, P=0.165) in females. Interaction study between gender and rs2231142 did not reach significant level in both the gender group and two age groups. Conclusion: Single nucleotide polymorphism rs2231142 A allele is an independent risk factor for hyperuricemia in this tertiary hospital faculty cohort. The ORs are higher in male than those in female, especially in those less than 55 years old.

[Identification of a new pro-invasion factor in tumor microenvironment: progress in function and mechanism of extracellular ATP].

Up to 90% of all cancer related morbidity and mortality can be attributed to metastasis. In recent years the study of tumor microenvironment, its cellular and molecular components, and how they can affect neoplastic progression toward metastasis, has become a hot focus in cancer research. Accumulated evidence shows that the formation of metastasis is a multi-step sequential process, in which, the tumor cells continuously interact with the host microenvironment. Host derived factors, i.e. growth factors/inhibitors, angiogenic factors, chemokines, etc. together with different types of host cells, play important roles in the tumor progression towards metastasis. The interaction between the tumor cells and host microenvironment determines the fate of metastasis. The reveal of this interaction mechanism provides us an opportunity to find effective mode of interference and develop novel anti-metastasis drugs. In this review, we have summarized our work on a new pro-invasion factor identified in tumor microenvironment and how it affects tumor invasion and metastass. Adenosine triphosphate (ATP), the key intracellular energy currency, accumulates within the tumor microenvironment and is closely involved in cancer cell metabolism and in antitumor immunity. The established role of ATP as a growth modulator and a proinflammatory mediator endues ATP and other purines with potential players in host-tumor interaction. Our study demonstrated that extracellular ATP stimulated human cancer invasion in in vitro tests. Increased migration and invasive ability across Matrigel was observed in some human carcinoma cell lines, including the prostate, breast, colon, melanoma and lung, when stimulated with ATP or its analogues. ATP enhanced the motility of cancer cells via increasing the amount and length of lamellipodia and filopodia, which were necessary for the cell motility. Significant increase in Rac1 and Cdc42 activities was observed. Using cDNA microarray we found that the expression of a panel of invasion/metastasis-related genes was significantly changed, including the increased expression of interleukin (IL)-8 and matrix metalloproteinase-3 (MMP-3) after ATP treatment. Changes of some epithelial-mesenchymal transition (EMT)-related factors were also observed, including the increase of snail, decrease of E-cadherin and claudin-1. Multiple P2Y receptors subtypes were expressed on tumor cells, but P2Y2 and P2X7 receptors were found to be mainly responsible for the pro-invasive effect of ATP. Down-regulation of either P2Y2 or P2X7 abolished ATP effect on cancer invasion and expression of EMT/invasion-related genes. Further, we found that P2Y2 receptor trans-activated with epidermal growth factor receptor (EGFR) and co-activated extracellular regulated protein kinases (ERK1/2) signaling pathway, which was involved in regulating expression of EMT and other related genes. In nude mice experiment, the pro-invasive effect of ATP was further confirmed. In summary, our results reveal that ATP is a potential pro-invasive factor in tumor microenvironment. P2Y2/P2X7 receptors act as a mediator in the regulation of ATP-induced EMT and invasion of cancer cells. Given that tumor microenvironment is rich in ATP and other purines, we hypothesize that ATP might be a potential invasion stimulator in tumor microenvironment. Blocking ATP receptor might be a therapeutic target on cancer.

[Association of single nucleotide polymorphisms in PAI-1 with breast cancer susceptibility and prognosis].

OBJECTIVE: To study the effects of single nucleotide polymorphisms (SNP) in Plasminogen activator inhibitor 1(PAI-1) on breast cancer susceptibility and patients' prognosis among a Chinese Han women population. METHODS: Six tag SNP (tSNP) of PAI-1 were selected according to HapMap CHB population, and TaqMan realtime PCR method was used to genotype the 6 tSNP in 1 160 breast cancer cases and 1 318 age-matched controls among Chinese Han women. Haplotypes and diplotypes were inferred according to genotyping data and linkage disequilibrium. Finally, the associations of tSNP, haplotypes and dipltypes with breast cancer susceptibility and patients' prognosis were analyzed. RESULTS: Regarding to breast cancer susceptibility, for rs6090 (G>A), AA genotype carriers had 3.79 times higher risk of developing breast cancer (OR=4.79, 95%CI=1.01-22.64, P=0.048 0) than GG or GA genotype carriers. For rs2227672 (G>T), TT genotype carriers had 1.52 times higher breast cancer risk than GG or GT genotype carriers (OR=2.52, 95%CI=1.26-5.01, P=0.008 6). Regarding to breast cancer prognosis, women who carried rs2227692 (C>T) CT genotype had 46% lower risk of developing recurrence, metastasis or death than CC genotype carriers (HR=0.54, 95%CI=0.30-0.97, P=0.040 4). Using stratified association analysis, among BMI<23 patients, those women who carried AA genotype of rs2227631 (G>A) had 3.99 times higher risk of developing the events (recurrence, metastasis or death) than GG or GA genotype carriers (HR=4.99, 95%CI=1.66-15.02, P=0.004 2). Among HER2 positive patients, those women who carried AA genotype of rs2227667 (G>A) had 2.98 times higher risk of developing the events (recurrence, metastasis or death) than GG or GA genotype carriers (HR=3.98, 95%CI=1.47-10.80, P=0.006 7). Among patients with tumors>2 cm, those women who carried rs2227692 (C>T) CT or TT genotype had 51% lower risk of developing the events (recurrence, metastasis or death) than CC genotype carriers (HR=0.49, 95%CI=0.27-0.88, P=0.017 0). CONCLUSIONS: The study indicates that single nucleotide polymorphisms in PAI-1 may affect breast cancer susceptibility and survival in Chinese Han women. The study may contribute to individualized evaluation of breast cancer risk and patients' prognosis if these data are validated in some other Chinese Han populations.

P2Y2 receptor promotes cell invasion and metastasis in prostate cancer cells.

BACKGROUND: Our previous study demonstrated that extracellular adenosine 5'-triphosphate (ATP) stimulated prostate cancer cell invasion via P2Y receptors. However, the purinergic receptor subtype(s) involved in this process remains unclear. Here we aimed to determine whether P2Y2, one subtype of P2Y receptors, was involved in the invasion and metastasis of prostate cancer cells, and elucidated the underlying mechanism. METHODS: RNAi was introduced to silence the expression of P2Y2. In vitro invasion and migration assays and in vivo experiments were carried out to examine the role of P2Y2 receptor in cell invasion and metastasis. cDNA microarray was performed to identify the differentially expressed genes downstream of ATP treatment. RESULTS: P2Y2 was significantly expressed in the prostate cancer cells. Knockdown of P2Y2 receptor suppressed cell invasion and metastasis in vitro and in vivo. Further experiments identified that ATP could promote IL-8 and Snail expression and inhibit E-cadherin and Claudin-1 expression. Knockdown of P2Y2 receptor affected the expression of these EMT/invasion-related genes in vitro and in vivo. CONCLUSION: P2Y2 receptor promotes cell invasion and metastasis in prostate cancer cells via some EMT/invasion-related genes. Thereby, P2Y2 receptor could be a potential therapeutic target for the treatment of prostate cancer.

Elevated PLGF contributes to small-cell lung cancer brain metastasis.

Brain metastasis (BM) is a major cause of mortality in small-cell lung cancer (SCLC) patients; however, the molecular pathway of SCLC BM remains largely unknown because of a lack of investigation. Here we screen the levels of some candidate-soluble factors in the serum of SCLC patients and find that SCLC patients with high levels of placental growth factor (PLGF) are prone to BM. Using in vitro blood-brain barrier model, we show that PLGF derived from SCLC cells triggers vascular endothelial growth factor receptor-1-Rho-extracellular regulated protein kinase 1/2 signaling axis activation, results in disassembly of tight junction in brain endothelial cells and promotes SCLC cell transendothelial migration. Furthermore, the downregulation of PLGF suppresses SCLC cell metastasis to the brain in an experimental BM model. These data suggest that PLGF is a potential signature of SCLC BM and a prospective therapeutic target for SCLC BM.

[The inhibition effect of retinoic acid on the invasion and metastasis abilities of metastatic human lung cancer cell subline].

Pre-treatment of metastatic human lung cancer cell subline (PGCL3) with all trans retinoic acid (RA) resulted in inhibition of cell growth in vitro and invasion through the reconstituted basement membrane. RA was also noticed to inhibit the experimental metastatic ability of PGCL3. Data showed that 5/6, 3/6 and 2/6 of the nude mice developed lung colonization in the control, the 5 mumol/L and the 10 mumol/L RA treated PGCL3 cells respectively. Data from DNA-RNA dot blot hybridization further showed that the 10 mumol/L RA treated cells expressed high levels of the human tissue inhibitors of metalloproteinases (Timp-1 and Timp-2) in comparing to the untreated cells. These results may help to clarify the mechanism of RA-induced inhibition effect on tumor invasion and metastasis.

[Effects of retinoic acid on the adhesion and motility of metastatic human lung cancer cell subline (PGCL3)].

Effects of all-trans Retinoic Acid (RA) on the adhesion and motility of metastatic human lung cancer cell subline (PGCL3) were observed in vitro. The results showed that treatment of PGCL3 with RA for 5 days decreased the adhesion of cells to laminin substrate and the migrative ability through the polycarbonate filter of Boyden chamber, and those inhibitory effects became more obvious with the increase of RA concentration. Further investigation by DNA-RNA dot blot hybridization and immunohistochemistry denoted that RA-treated PGCL3 cells expressed lower level of 67-KD LN-R compared to untreated cells. The data from DNA-RNA dot blot hybridization also showed that RA could reduce the expression of AMF-R significantly. These results raise the possibility that the previously reported suppression by RA of PGCL3 invasion and metastasis may be related to suppression of cell adhesion and motility resulting from the decreased expression of the LN-R and AMF-R respectively.

Terminal neuroendocrine differentiation of human prostate carcinoma cells in response to increased intracellular cyclic AMP.

Recent clinicopathologic studies have shown that many prostatic adenocarcinomas express focal neuroendocrine differentiation and that neuroendocrine differentiation is most apparent in advanced anaplastic tumors. While studying growth-regulatory signal transduction events in human prostate carcinoma cell lines, we found that in two of four cell lines, the androgen-sensitive line LNCaP and the highly metastatic androgen-independent line PC-3-M, elevation of cAMP through addition of cAMP analogues or phosphodiesterase inhibitors induced a markedly neuronal morphology. Also in LNCaP cells ultrastructural analysis showed that cAMP induced the appearance of neurosecretory cell-like dense-core granules. Phenotypic analysis of untreated LNCaP and PC-3-M cells showed that both cell lines express markers of the neural crest including S-100, chromogranin A, pp60c-src, and neuron-specific enolase as well as the epithelial marker KS1/4 and stage-specific embryonic antigen 4. In PC-3-M cells, cAMP markedly elevated neuron-specific enolase protein and caused an increase in the specific activity of the neuroendocrine marker pp60c-src, and in both cell lines expression of KS1/4 and stage-specific embryonic antigen 4 was down-regulated. In addition to effects on lineage markers, cAMP treatment induced G1 synchronization, growth arrest, and loss of clonogenicity, indicating terminal differentiation. Our data provide direct evidence of plasticity in the lineage commitment of adenocarcinoma of the prostate. We have shown that cell-permeant cAMP analogues can induce terminal differentiation, suggesting that hydrolysis-resistant cyclic nucleotides may present an additional approach to the treatment of advanced prostate cancer.

[Study on the mechanisms of thrombin to inhibit neurite outgrowth].

In the present study, we investigated the effects and signal transduction mechanisms of thrombin on neuronal differentiation of human primitive neuroectodermal tumor cell line CHP-100. Thrombin inhibited neurite outgrowth of CHP-100 cells in culture induced by serum removal. The inhibitory effects were found to be associated with activation of phosphatidylinositol turnover/calcium mobilization signal transduction pathway by thrombin, since stimulation with thrombin induced significant inositol-1, 4, 5 trisphosphate accumulation and intracellular free calcium transient in CHP-100 cells. In addition, the most potent inhibitor of thrombin hirudin, which reversed the inhibitory effect of thrombin on neurite outgrowth of CHP-100 cells, also inhibited thrombin-stimulated calcium transient. These results suggest a specific role of thrombin signal transduction pathway in the regulation of neuronal differentiation.

Differential growth regulation of a metastatic human lung carcinoma cell line through activation of phosphatidyl inositol turnover signal transduction pathway.

Until recently, the signal transduction pathways involved in the processes of tumor growth have been poorly understood. In the present study, we investigated cell surface receptors which utilize phosphatidylinositol (Pl) turnover/Ca2+ mobilization as a signal transduction pathway to regulate cell growth in a metastatic human lung carcinoma cell line, PG. We found that purinoceptor agonists, including ATP and its analogs, and bombesin, an amphibian tetradeca-peptide of mammalian homology gastrin-releasing peptide, induced rapid transient increase of cytoplasmic-free Ca2+ in PG cells loaded with fura-2. The Ca2+ responses were derived both from release from internal stores and the opening of plasma membrane Ca2+ channels. HPLC analysis of inositol 1,4,5-triphosphate (Ins(1,4,5)P3) and its isomers showed a receptor-linked phospholipase C activation by ATP and bombesin. Although ATP and bombesin were both able to induce Pl turnover and Ca2+ mobilization in PG cells, they had differential growth regulatory effects on PG cells. Treatment with bombesin stimulated PG cell growth while treatment with ATP inhibited significantly PG cell growth. Pharmacological studies showed that the purinoceptors on PG cells were of the P2 subtype. Other hydrolysis-resistant P2 purinoceptor agonists, including ATP gamma S and AMP-PNP, were as effective as ATP in stimulating Pl turnover and Ca2+ mobilization as well as in inhibiting PG cell growth in vitro, suggesting the potential usefulness of such ATP analogs in clinical trials. Preliminary results suggest G protein involvement in the differential regulation of ATP and bombesin signal transduction pathways.

[Signal transduction study on the growth regulation of cells from human giant cell lung carcinoma in vitro].

The signal transduction involved in growth regulation of cells originally from a human giant cell lung carcinoma(PG) was investigated. The purinergic receptor agonists, ATP and its analogues, as well as bombesin all played a significant growth regulatory role on PG cells. ATP showed a growth inhibitory effect while bombesin showed a growth stimulatory effect on PG cells in vitro. Further investigation showed that ATP and bombesin activated phosphatidylinositol turnover/calcium mobilization signal transduction pathways in PG cells. and increased production of inositol-(1,4,5) trisphosphate and mobilization of intracellular free calcium, in which ATP and bombesin effects were dose-dependent. The purinergic receptor on PG cells was characterized by P2y subtype according to the order of PG cell responses to a series of ATP analogues. Pretreatment with cholera toxin showed different effects on the functions of ATP and bombesin, suggesting that the major difference between ATP and bombesin on signal transduction pathways may be at the G protein level.

P2-purinergic receptor agonists inhibit the growth of androgen-independent prostate carcinoma cells.

To develop a new approach to the treatment of advanced, hormone-refractory prostate cancer, the signal transductions regulating the growth of human androgen-independent prostate carcinoma cell lines were studied. Agonist-stimulated Ca2+ mobilization, a critical regulatory event in other secretory cell types, was studied as a means of identifying previously undescribed plasma membrane receptors that may transduce a growth inhibitory signal. In all of the cell lines tested, P2-purinergic receptor agonists, including ATP and certain hydrolysis-resistant adenine nucleotides, induced a rapid, transient increase in cytoplasmic free Ca2+ that was detectable at 50 to 100 nM ATP, was maximal at 100 microM ATP, and was inhibited approximately 50% by chelation of extracellular Ca2+. Within 8 s after addition, ATP stimulated accumulation of the polyphosphatidylinositol products inositol (1, 4, 5) trisphosphate, inositol (1, 3, 4) trisphosphate, and inositol tetrakisphosphate. In addition to stimulating phosphatidylinositol turnover and Ca2+ mobilization, ATP and hydrolysis-resistant ATP analogues induced greater than 90% inhibition of the growth of all lines tested. These data demonstrate that human androgen-independent prostate carcinoma cells express functional P2-purinergic receptors linked to phospholipase C, and that agonists of this receptor are markedly growth inhibitory, suggesting a novel therapeutic approach to this common adult neoplasm.

[Study on metastasis of NIH/3T3 cells transfected with DNA from metastatic human lung carcinoma].

In order to study the genetic mechanisms involved in tumor metastasis, high molecular weight DNA fragments were extracted from human PG tumor cells which were known to be highly metastatic in the nude mice. The DNA fragments were incorporated into NIH/3T3 cells by using calcium phosphate precipitate method. The transfected NIH/3T3 cells were tumorigenic and after a second-round transfection, one of the transfectants (TF87-2-10) was found metastatic to the lungs of nude mice. Human Alu sequences were detected in TF87-2-10 cells by Southern blot analysis. So, it seems that the metastatic capacity of TF87-2-10 cells is associated with the transfection of DNA fragments from PG tumor cells. The relationship between expression of metastatic phenotype of TF87-2-10 cells and host immune mechanisms was studied by injecting TF87-2-10 cells into athymic nude mice and beige nude mice. TF87-2-10 cells showed a higher metastatic rate in beige nude mice (6/13, 46%) than in the athymic nude mice (5/25, 20%). The results suggest that the metastatic expression of TF87-2-10 cells is subject to the influence of host NK cell activities.

Comparative study of metastatic behavior of a human tumor cell line in athymic (nu/nu) and beige nude mice (bg/bg-nu/nu).

In this experiment, the "nu" gene was introduced into "beige" mutant mice, which are immunodeficient in NK cell activity. The resultant beige nude mice (bg/bg-nu/nu) have combined immunodeficiency in both T and NK cell activities. The level of NK cell activity in beige nude mice is slightly higher than that in beige mice, but much lower than that in nude mice. This is consistent with other studies. In order to elucidate the role of the metastatic behavior of a human tumor cell line PAa in both athymic nude mice and beige nude mice. The PAa cell line was originally established from a human lung adenocarcinoma and maintained as a solid tumor by serial s.c. passage in nude mice. During the first 18 passages in nude mice, PAa cells were found to have metastasized spontaneously to regional lymph nodes in only 4 animals, but metastases were no longer found in subsequent passages. The total incidence of metastasis in nude mice was 9% (4/44). However, when inoculated s.c. into beige nude mice, the metastatic rate of PAa cells was 43% (9/21) to the regional lymph nodes and 10% (2/21) to the lungs in two separate experiments. We conclude from the results that NK cells may play an important, if not exclusive, role in host resistance to tumor metastasis. Beige nude mice could serve as a useful in vivo model in studies of the biology and heterogeneity of human tumor metastasis.

[In vivo metastasis of human tumor transplant in T and NK cell immune-deficient mice].

Beige-nude mice with combined T and NK cell deficiency were produced by introducing "nu" gene into the beige mice of C57BL/6 background. The beige-nude mice were characterized by morphological features, level and activity of the NK cell in spleen and peripheral blood. NK cell level of the beige-nude mice was higher than the beige mice and similar to the ordinary nude mice though its NK cell activity was markedly lower than the nude mice. Human lung adenocarcinoma (PAa) was transplanted subcutaneously to the beige-nude mice and nude mice of BALB/cA background. No metastasis was found in BALB/cA nude mice (0/7), while in beige-nude mice, spontaneous lymph node metastasis rate was 36.3% (4/11). It should be noted that the transplanted PAa metastasized to lungs, which had never been seen in BALB/cA nude mice in previous experiments. The increase of metastatic rate is correlated with the relative low NK cell activity of the beige-nude mice. Our observation is that the beige-nude mice could be a suitable experimental model for in vivo study on metastatic behavior of the human tumors.