Artificial Intelligence, Computational Simulations, and Extended Reality in Cardiovascular Interventions.

Artificial intelligence, computational simulations, and extended reality, among other 21st century computational technologies, are changing the health care system. To collectively highlight the most recent advances and benefits of artificial intelligence, computational simulations, and extended reality in cardiovascular therapies, we coined the abbreviation AISER. The review particularly focuses on the following applications of AISER: 1) preprocedural planning and clinical decision making; 2) virtual clinical trials, and cardiovascular device research, development, and regulatory approval; and 3) education and training of interventional health care professionals and medical technology innovators. We also discuss the obstacles and constraints associated with the application of AISER technologies, as well as the proposed solutions. Interventional health care professionals, computer scientists, biomedical engineers, experts in bioinformatics and visualization, the device industry, ethics committees, and regulatory agencies are expected to streamline the use of AISER technologies in cardiovascular interventions and medicine in general.

Multi-layer CRISPRa/i circuits for dynamic genetic programs in cell-free and bacterial systems.

CRISPR-Cas transcriptional circuits hold great promise as platforms for engineering metabolic networks and information processing circuits. Historically, prokaryotic CRISPR control systems have been limited to CRISPRi. Creating approaches to integrate CRISPRa for transcriptional activation with existing CRISPRi-based systems would greatly expand CRISPR circuit design space. Here, we develop design principles for engineering prokaryotic CRISPRa/i genetic circuits with network topologies specified by guide RNAs. We demonstrate that multi-layer CRISPRa/i cascades and feedforward loops can operate through the regulated expression of guide RNAs in cell-free expression systems and E. coli. We show that CRISPRa/i circuits can program complex functions by designing type 1 incoherent feedforward loops acting as fold-change detectors and tunable pulse-generators. By investigating how component characteristics relate to network properties such as depth, width, and speed, this work establishes a framework for building scalable CRISPRa/i circuits as regulatory programs in cell-free expression systems and bacterial hosts. A record of this paper's transparent peer review process is included in the supplemental information.

Complex dependence of CRISPR-Cas9 binding strength on guide RNA spacer lengths.

It is established that for CRISPR-Cas9 applications guide RNAs with 17-20 bp long spacer sequences are optimal for accurate target binding and cleavage. In this work we perform cell-free CRISPRa (CRISPR activation) and CRISPRi (CRISPR inhibition) experiments to demonstrate the existence of a complex dependence of CRISPR-Cas9 binding as a function of the spacer length and complementarity. Our results show that significantly truncated or mismatched spacer sequences can form stronger guide-target bonds than the conventional 17-20 bp long spacers. To explain this phenomenon, we take into consideration previous structural and single-molecule CRISPR-Cas9 experiments and develop a novel thermodynamic model of CRISPR-Cas9 target recognition.

Portable bacterial CRISPR transcriptional activation enables metabolic engineering in Pseudomonas putida.

CRISPR-Cas transcriptional programming in bacteria is an emerging tool to regulate gene expression for metabolic pathway engineering. Here we implement CRISPR-Cas transcriptional activation (CRISPRa) in P. putida using a system previously developed in E. coli. We provide a methodology to transfer CRISPRa to a new host by first optimizing expression levels for the CRISPRa system components, and then applying rules for effective CRISPRa based on a systematic characterization of promoter features. Using this optimized system, we regulate biosynthesis in the biopterin and mevalonate pathways. We demonstrate that multiple genes can be activated simultaneously by targeting multiple promoters or by targeting a single promoter in a multi-gene operon. This work will enable new metabolic engineering strategies in P. putida and pave the way for CRISPR-Cas transcriptional programming in other bacterial species.

Challenges and opportunities with CRISPR activation in bacteria for data-driven metabolic engineering.

Creating CRISPR gene activation (CRISPRa) technologies in industrially promising bacteria could be transformative for accelerating data-driven metabolic engineering and strain design. CRISPRa has been widely used in eukaryotes, but applications in bacterial systems have remained limited. Recent work shows that multiple features of bacterial promoters impose stringent requirements on CRISPRa-mediated gene activation. However, by systematically defining rules for effective bacterial CRISPRa sites and developing new approaches for encoding complex functions in engineered guide RNAs, there are now clear routes to generalize synthetic gene regulation in bacteria. When combined with multi-omics data collection and machine learning, the full development of bacterial CRISPRa will dramatically improve the ability to rapidly engineer bacteria for bioproduction through accelerated design-build-test-learn cycles.

Effective CRISPRa-mediated control of gene expression in bacteria must overcome strict target site requirements.

In bacterial systems, CRISPR-Cas transcriptional activation (CRISPRa) has the potential to dramatically expand our ability to regulate gene expression, but we lack predictive rules for designing effective gRNA target sites. Here, we identify multiple features of bacterial promoters that impose stringent requirements on CRISPRa target sites. Notably, we observe narrow, 2-4 base windows of effective sites with a periodicity corresponding to one helical turn of DNA, spanning ~40 bases and centered ~80 bases upstream of the TSS. However, we also identify two features suggesting the potential for broad scope: CRISPRa is effective at a broad range of σ70-family promoters, and an expanded PAM dCas9 allows the activation of promoters that cannot be activated by S. pyogenes dCas9. These results provide a roadmap for future engineering efforts to further expand and generalize the scope of bacterial CRISPRa.

Author Correction: Synthetic CRISPR-Cas gene activators for transcriptional reprogramming in bacteria.

In the original version of the Supplementary Information file associated with this Article, the sequence '1x MS2 scRNA.b2' was incorrectly given as 'GAAGATCCGGCCTGCAGCCAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCGCACATGAGGATCACCCATGTGCTTTTTT' and should have read 'GAAGATCCGGCCTGCAGCCAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACATGAGGATCACCCATGTGCTTTTTTT'. The error has now been fixed and the corrected version of the Supplementary Information PDF is available to download from the HTML version of the Article.

Synthetic CRISPR-Cas gene activators for transcriptional reprogramming in bacteria.

Methods to regulate gene expression programs in bacterial cells are limited by the absence of effective gene activators. To address this challenge, we have developed synthetic bacterial transcriptional activators in E. coli by linking activation domains to programmable CRISPR-Cas DNA binding domains. Effective gene activation requires target sites situated in a narrow region just upstream of the transcription start site, in sharp contrast to the relatively flexible target site requirements for gene activation in eukaryotic cells. Together with existing tools for CRISPRi gene repression, these bacterial activators enable programmable control over multiple genes with simultaneous activation and repression. Further, the entire gene expression program can be switched on by inducing expression of the CRISPR-Cas system. This work will provide a foundation for engineering synthetic bacterial cellular devices with applications including diagnostics, therapeutics, and industrial biosynthesis.

Prospects for engineering dynamic CRISPR-Cas transcriptional circuits to improve bioproduction.

Dynamic control of gene expression is emerging as an important strategy for controlling flux in metabolic pathways and improving bioproduction of valuable compounds. Integrating dynamic genetic control tools with CRISPR-Cas transcriptional regulation could significantly improve our ability to fine-tune the expression of multiple endogenous and heterologous genes according to the state of the cell. In this mini-review, we combine an analysis of recent literature with examples from our own work to discuss the prospects and challenges of developing dynamically regulated CRISPR-Cas transcriptional control systems for applications in synthetic biology and metabolic engineering.

Regulated Expression of sgRNAs Tunes CRISPRi in E. coli.

Methods for implementing dynamically-controlled multi-gene programs could expand capabilities to engineer metabolism for efficiently producing high-value compounds. This work explores whether CRISPRi repression can be tuned in E. coli through the regulated expression of the CRISPRi machinery. When dCas9 is not limiting, variations in sgRNA expression alone can lead to CRISPRi repression levels ranging from 5- to 300-fold. Titrating sgRNA expression over a 2.5-fold range results in 16-fold changes in reporter gene expression. Many different classes of genetic controllers can generate 2.5-fold differences in transcription, suggesting they may be integrated into dynamically-regulated CRISPRi circuits. Finally, CRISPRi cannot be reversed for up to 12 hours by expressing a competing sgRNA later in the growth phase, indicating that CRISPR-Cas:DNA interactions can be persistent in vivo. Collectively, these results identify genetic architectures for tuning CRISPRi repression through regulated sgRNA expression and suggest that dynamically-regulated CRISPRi systems targeting multiple genes may be within reach.

Two-Way Chemical Communication between Artificial and Natural Cells.

Artificial cells capable of both sensing and sending chemical messages to bacteria have yet to be built. Here we show that artificial cells that are able to sense and synthesize quorum signaling molecules can chemically communicate with V. fischeri, V. harveyi, E. coli, and P. aeruginosa. Activity was assessed by fluorescence, luminescence, RT-qPCR, and RNA-seq. Two potential applications for this technology were demonstrated. First, the extent to which artificial cells could imitate natural cells was quantified by a type of cellular Turing test. Artificial cells capable of sensing and in response synthesizing and releasing N-3-(oxohexanoyl)homoserine lactone showed a high degree of likeness to natural V. fischeri under specific test conditions. Second, artificial cells that sensed V. fischeri and in response degraded a quorum signaling molecule of P. aeruginosa (N-(3-oxododecanoyl)homoserine lactone) were constructed, laying the foundation for future technologies that control complex networks of natural cells.

Integrating artificial with natural cells to translate chemical messages that direct E. coli behaviour.

Previous efforts to control cellular behaviour have largely relied upon various forms of genetic engineering. Once the genetic content of a living cell is modified, the behaviour of that cell typically changes as well. However, other methods of cellular control are possible. All cells sense and respond to their environment. Therefore, artificial, non-living cellular mimics could be engineered to activate or repress already existing natural sensory pathways of living cells through chemical communication. Here we describe the construction of such a system. The artificial cells expand the senses of Escherichia coli by translating a chemical message that E. coli cannot sense on its own to a molecule that activates a natural cellular response. This methodology could open new opportunities in engineering cellular behaviour without exploiting genetically modified organisms.

Dominant-negative Hsp90 reduces VEGF-stimulated nitric oxide release and migration in endothelial cells.

OBJECTIVE: Heat-shock protein 90 (Hsp90) coordinates the regulation of diverse signaling proteins. We try to develop a new tool to explore the regulatory functions of Hsp90 in endothelial cells (ECs) instead of the existing chemical approaches. METHODS AND RESULTS: We designed a dominant-negative Hsp90 construct by site-direct mutagenesis of residue Asp-88 to Asn (D88N-Hsp90) based on the structure of the ATP/ADP-binding site. Recombinant wild-type Hsp90 protein binds ATP-Sepharose beads in manner inhibited by ATP or 17-AAG, a specific inhibitor for Hsp90, however the binding activity of D88N-Hsp90 was markedly reduced and the inhibitory effects of ATP or 17-AAG were negligible. The dimerization between endogenous Hsp90alpha and exogenous HA-Hsp90beta was confirmed by immunoprecipitation, however the association between eNOS and D88N-Hsp90 was less than WT-Hsp90. Furthermore, adenoviral transduction of bovine aortic ECs with D88N-Hsp90 suppressed VEGF-induced phosphorylation of Akt, eNOS, and NO release and the inhibitory effect was blocked by okadaic acid. Moreover, D88N-Hsp90 abolished VEGF-stimulated Rac activation and suppressed VEGF-induced stress fiber formation. Transduction with D88N-Hsp90 decreased growth medium mediated migration of wild-type ECs, but not Akt1(-/-) ECs suggesting that Akt is key target of Hsp90. CONCLUSIONS: Our data demonstrate that dominant-negative Hsp90 modulates endothelial cell mobility mainly through PP2A-mediated dephosphorylation of Akt and Rac activation.

Targeting of endothelial nitric-oxide synthase to the cytoplasmic face of the Golgi complex or plasma membrane regulates Akt- versus calcium-dependent mechanisms for nitric oxide release.

The heterogeneous localization of endothelial nitricoxide synthase (eNOS) on the Golgi complex versus the plasma membrane has made it difficult to dissect the regulation of each pool of enzyme. Here, we generated fusion proteins that specifically target the plasma membrane or cytoplasmic aspects of the Golgi complex and have assessed eNOS activation. Plasma membrane-targeted eNOS constructs were constitutively active, phosphorylated, and responsive to transmembrane calcium fluxes, yet were insensitive to further activation by Akt-mediated phosphorylation. In contrast, cis-Golgi complex-targeted eNOS behaved similarly to wild-type eNOS and was less sensitive to calcium-dependent activation and highly responsive to Akt-dependent phosphorylation compared with plasma membrane versions. In plasma membrane- and Golgi complex-targeted constructs, Ser1179 is critical for NO production. This study provides clear evidence for functional roles of plasma membrane- and Golgi complex-localized eNOS and supports the concept that proteins thought to be regulated and to function exclusively in the plasma membrane of cells can indeed signal and be regulated in internal Golgi membranes.

Vanadate is a potent activator of endothelial nitric-oxide synthase: evidence for the role of the serine/threonine kinase Akt and the 90-kDa heat shock protein.

We investigated the molecular mechanisms of sodium vanadate (vanadate)-induced nitric oxide (NO) production. Exposure of bovine lung microvascular cells (BLMVEC) to vanadate increased the release of biologically active NO in endothelium/smooth muscle cocultures, as measured by the accumulation of its surrogate marker, cGMP. This release was sensitive to NO synthase (NOS) inhibition and was greater than that observed with ionomycin. Although calcium chelators (BAPTA, EGTA) inhibited basal and ionomycin-induced NO production, they failed to inhibit vanadate-induced NO release. Moreover, in the absence of calcium/calmodulin, cell lysates from vanadate-treated cells exhibited greater NOS activity compared with control cells. Vanadate activates the phosphoinositide3-kinase (PI3-K)/Akt pathway, which is known to increase endothelial NOS (eNOS) activity by direct phosphorylation of Ser-1179. Treatment of BLMVEC with vanadate resulted in phosphorylation of both Akt and endothelial NOS. In addition, wortmannin, a PI3-K inhibitor, blocked both the vanadate-induced phosphorylation of eNOS and the increase in cGMP accumulation. Similarly, adenovirus-mediated gene transfer of an activation deficient form of Akt (AA-Akt) blocked the release of NO brought about by vanadate. To further investigate the mechanism of action of vanadate, eNOS was immunoprecipitated and its association with proteins that alter eNOS activity was tested. Immunoblots demonstrated that the eNOS-caveolin interaction remained unaffected by vanadate, whereas vanadate promoted recruitment of the 90-kDa heat shock protein (hsp90) to eNOS. We conclude that vanadate causes NO release via a mechanism that involves Akt-induced eNOS phosphorylation and increased binding of the activator protein hsp90 to eNOS.

Heat shock protein 90 and tyrosine kinase regulate eNOS NO* generation but not NO* bioactivity.

An increase in the association of heat shock protein 90 (HSP90) with endothelial nitric oxide (NO) synthase (eNOS) is well recognized for increasing NO (NO*) production. Despite the progress in this field, the mechanisms by which HSP90 modulates eNOS remain unclear due, in part, to the fact that geldanamycin (GA) redox cycles to generate superoxide anion (O(2)(-*) and the fact that inhibiting HSP90 with GA or radicicol (RAD) destabilizes tyrosine kinases that rely on the chaperone for maturation. In this report, we determine the extent to which these side effects alter vascular and endothelial cell function in physiologically relevant systems and in cultured endothelial cells. Vascular endothelial growth factor (VEGF)-stimulated vascular permeability, as measured by Evans blue leakage in the ears of male Swiss mice in vivo, and acetylcholine-induced vasodilation of isolated, pressurized mandibular arterioles from male C57BL6 mice ex vivo were attenuated by N(omega)-nitro-L-arginine methyl ester (L-NAME), GA, and RAD. Z-1[N-(2-aminoethyl)-N-(2-ammonoethyl)amino]diazen-1-ium-1,2-dioate (DETA-NONOate), a slow releasing NO. donor, increased vasodilation of arterioles pretreated with GA, RAD, and L-NAME equally well except at 10(-5) M, the highest concentration used, where vasodilation was greater in pressurized arterioles treated with L-NAME than in arterioles pretreated with GA or RAD alone. Both GA and RAD reduced NO* release from stimulated endothelial cell cultures and increased O(2)(-*) production in the endothelium of isolated aortas by an L-NAME-inhibitable mechanism. Pretreatment with RAD increased stimulated O(2)(-*) production from eNOS, whereas pretreatment with genistein (GE), a broad-spectrum tyrosine kinase inhibitor, did not; however, pretreatment with GE + RAD resulted in a super-induced state of uncoupled eNOS activity upon stimulation. These data suggest that the tyrosine kinases, either directly or indirectly, and HSP90-dependent signaling pathways act in concert to suppress uncoupled eNOS activity.

Regulation of survivin function by Hsp90.

Pathways controlling cell proliferation and cell survival require flexible adaptation to environmental stresses. These mechanisms are frequently exploited in cancer, allowing tumor cells to thrive in unfavorable milieus. Here, we show that Hsp90, a molecular chaperone that is central to the cellular stress response, associates with survivin, an apoptosis inhibitor and essential regulator of mitosis. This interaction involves the ATPase domain of Hsp90 and the survivin baculovirus inhibitor of apoptosis repeat. Global suppression of the Hsp90 chaperone function or targeted Abmediated disruption of the survivin-Hsp90 complex results in proteasomal degradation of survivin, mitochondrial-dependent apoptosis, and cell cycle arrest with mitotic defects. These data link the cellular stress response to an antiapoptotic and mitotic checkpoint maintained by survivin. Targeting the survivin-Hsp90 complex may provide a rational approach for cancer therapy.

Native low-density lipoprotein induces endothelial nitric oxide synthase dysfunction: role of heat shock protein 90 and caveolin-1.

Although native LDL (n-LDL) is well recognized for inducing endothelial cell (EC) dysfunction, the mechanisms remain unclear. One hypothesis is n-LDL increases caveolin-1 (Cav-1), which decreases nitric oxide (*NO) production by binding endothelial nitric oxide synthase (eNOS) in an inactive state. Another is n-LDL increases superoxide anion (O(2)(*-)), which inactivates *NO. To test these hypotheses, EC were incubated with n-LDL and then analyzed for *NO, O(2)(*-), phospho-eNOS (S1179), eNOS, Cav-1, calmodulin (CaM), and heat shock protein 90 (hsp90). n-LDL increased NOx by more than 4-fold while having little effect on A23187-stimulated nitrite production. In contrast, n-LDL decreased cGMP under basal and A23187-stimulated conditions and increased O(2)(*-) by a mechanism that could be inhibited by L-nitroargininemethylester (L-NAME) and BAPTA/AM. n-LDL increased phospho-eNOS by 149%, eNOS by approximately 34%, and Cav-1 by 28%, and decreased the association of hsp90 with eNOS by 49%. n-LDL did not appear to alter eNOS distribution between membrane fractions (approximately 85%) and cytosol (approximately 15%). Only 3-6% of eNOS in membrane fractions was associated with Cav-1. These data support the hypothesis that n-LDL increases O(2)(*-), which scavenges *NO, and suggest that n-LDL uncouples eNOS activity by decreasing the association of hsp90 as an initial step in signaling eNOS to generate O(2)(*-).

Domain mapping studies reveal that the M domain of hsp90 serves as a molecular scaffold to regulate Akt-dependent phosphorylation of endothelial nitric oxide synthase and NO release.

Protein-protein interactions with the molecular chaperone hsp90 and phosphorylation on serine 1179 by the protein kinase Akt leads to activation of endothelial nitric oxide synthase. However, the interplay between these protein-protein interactions remains to be established. In the present study, we show that vascular endothelial growth factor stimulates the coordinated association of hsp90, Akt, and resultant phosphorylation of eNOS. Characterization of the domains of hsp90 required to bind eNOS, using yeast 2-hybrid, cell-based coprecipitation experiments, and GST-fusion proteins, revealed that the M region of hsp90 interacts with the amino terminus of eNOS and Akt. The addition of purified hsp90 to in vitro kinase assays facilitates Akt-driven phosphorylation of recombinant eNOS protein, but not a short peptide encoding the Akt phosphorylation site, suggesting that hsp90 may function as a scaffold for eNOS and Akt. In vivo, coexpression of adenoviral or the cDNA for hsp90 with eNOS promotes nitric oxide release; an effect eliminated using a catalytically functional phosphorylation mutant of eNOS. These results demonstrate that stimulation of endothelial cells with vascular endothelial growth factor recruits eNOS and Akt to an adjacent region on the same domain of hsp90, thereby facilitating eNOS phosphorylation and enzyme activation.