Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 15 de 15
Filtrar
Mais filtros

Base de dados
Tipo de documento
Intervalo de ano de publicação
1.
Chirality ; 36(6): e23695, 2024 Jun.
Artigo em Inglês | MEDLINE | ID: mdl-38890151

RESUMO

Chirality plays a fundamental role in natural phenomena, yet its manifestation on solid surfaces remains relatively unexplored. In this study, we investigate the formation of chiroptical melanin-based self-assembled films on quartz substrates, leveraging mussel-inspired surface chemistry. Water-soluble porphyrins serve as molecular synthons, facilitating the spontaneous formation of hetero-aggregates in phosphate-buffered saline containing L- or D-DOPA. Spectroscopic analysis reveals chiral transfer from DOPA enantiomers to porphyrin hetero-aggregates, followed by the disruption of these latter and subsequent generation of chiral melanin structures in solution. Quartz substrates inserted into these solutions spontaneously accumulate homogeneous melanin-like films over days, demonstrating the feasibility of self-assembly. The resulting films exhibit characteristic UV/Vis and CD spectra, with distinct signals indicating successful chiral induction. Interestingly, the AFM characterizations reveal a distinct surface morphology, and in addition, some thermal and mechanical properties have been taken into account. Overall, this study sheds light on the formation, stability, and chiroptical properties of melanin-based films, paving the way for their application in various fields.

2.
Nanoscale ; 16(10): 5137-5148, 2024 Mar 07.
Artigo em Inglês | MEDLINE | ID: mdl-38305723

RESUMO

Recent discoveries have revealed that mature miRNAs could form highly ordered structures similar to aptamers, suggesting diverse functions beyond mRNA recognition and degradation. This study focuses on understanding the secondary structures of human miR-26b-5p (UUCAAGUAAUUCAGGAUAGGU) using circular dichroism (CD) and chiroptical probes; in particular, four achiral porphyrins were utilized to both act as chiroptical probes and influence miRNA thermodynamic stability. Various spectroscopic techniques, including UV-Vis, fluorescence, resonance light scattering (RLS), electronic circular dichroism (ECD), and CD melting, were employed to study their interactions. UV-Vis titration revealed that meso-tetrakis(4-N-methylpyridyl) porphyrin (H2T4) and meso-tetrakis(4-carboxyphenylspermine) porphyrin (H2TCPPSpm4) formed complexes with distinct binding stoichiometries up to 6 : 1 and 3 : 1 ratios, respectively, and these results were supported by RLS and fluorescence, while the zinc(II) derivative porphyrin ZnT4 exhibited a weaker interaction. ZnTCPPSpm4 formed aggregates in PBS with higher organization in the presence of miRNA. CD titrations displayed an induced CD signal in the Soret region for every porphyrin investigated, indicating that they can be used as chiroptical probes for miR-26b-5p. Lastly, CD melting experiments revealed that at a 1 : 1 ratio, porphyrins did not significantly affect miRNA stability, except for H2TCPPSpm4. However, at a 3 : 1 ratio, all porphyrins, except ZnTCPPSpm4, exhibited a strong destabilizing effect on miRNA secondary structures. These findings shed light on the structural versatility of miR-26b-5p and highlight the potential of porphyrins as chiroptical probes and modulators of miRNA stability.


Assuntos
MicroRNAs , Porfirinas , Humanos , Porfirinas/química , Zinco , Oligonucleotídeos , Dicroísmo Circular
3.
Inorg Chem ; 63(8): 3850-3858, 2024 Feb 26.
Artigo em Inglês | MEDLINE | ID: mdl-38353116

RESUMO

This contribution reports, through a combined thermogravimetric analysis, differential scanning calorimetry, UV-vis, powder X-ray diffraction, and Rietveld refinement analysis, on the stimuli-responsive chromic properties of a substituted Zn(salmal) Schiff-base Lewis acidic complex with unique and distinct thermo- and vapochromic characteristics. The solid complex obtained in air or by evaporation of the solvent from their THF solutions shows a marked thermochromism associated with a phase transition, unusually triggered by the reversible desorption/adsorption of one lattice water molecule. In contrast, the anhydrous solid, achieved from THF solutions of the complex by evaporation of the solvent under anhydrous conditions, behaves very differently as it does not show any absorption of water or thermochromism and exhibits varied vapochromic properties. Detection of volatile organic compounds having Lewis basicity is demonstrated by using the anhydrous solid or the related cast films on glass or paper substrates. In both cases, a marked vapochromism is observed upon exposure to vapors of various volatile species and involves well-defined optical absorptions and naked-eye color changes, also allowing the discrimination of primary aliphatic amines. Vapochromic behavior with the formation of stable, stoichiometric adducts is also demonstrated for both the solid obtained in air and the anhydrous solid or for the related cast films after exposure to vapors of pyridine.

4.
Anal Bioanal Chem ; 415(10): 1829-1840, 2023 Apr.
Artigo em Inglês | MEDLINE | ID: mdl-36808276

RESUMO

The possibility to monitor peptide and protein aggregation is of paramount importance in the so-called conformational diseases, as the understanding of many physiological pathways, as well as pathological processes involved in the development of such diseases, depends very much on the actual possibility to monitor biomolecule oligomeric distribution and aggregation. In this work, we report a novel experimental method to monitor protein aggregation, based on the change of the fluorescent properties of carbon dots upon protein binding. The results obtained in the case of insulin with this newly proposed experimental approach are compared with those obtained with other common experimental techniques normally used for the same purpose (circular dichroism, DLS, PICUP and ThT fluorescence). The greatest advantage of the hereby presented methodology over all the other experimental methods considered is the possibility to monitor the initial stages of insulin aggregation under the different experimental conditions sampled and the absence of possible disturbances and/or molecular probes during the aggregation process.


Assuntos
Insulina , Pontos Quânticos , Insulina/química , Carbono/química , Agregados Proteicos , Pontos Quânticos/química , Dicroísmo Circular , Corantes Fluorescentes/química
5.
Chemistry ; 29(7): e202202337, 2023 Feb 01.
Artigo em Inglês | MEDLINE | ID: mdl-36224099

RESUMO

Protonated achiral H2 TPPS4 spontaneously self-arranges at acids pH and high ionic strength to build mesoscopic J-aggregates that are intrinsically chiral. According to the symmetry rule aggregation leads to a racemate that, however, can be unbalanced by chemical (chiral pollutants) or physical stimuli (as vortexing the solution). Vortexing the title racemate, in principle, might either induce chiral separation or chiral enrichment. Indeed, herein it is shown that vortices enable the resolution of this racemic solution exploiting the tendency to deposit, onto the quartz cuvette walls, of the enantiomer favored by the stirring sense. Simultaneously, over time, it was found that the opposite chiral conformation becomes prevalent in solution realizing a significant enantiomeric resolution. Therefore, after removing all stirring-favored chiral J-aggregate from the solution, the recovering and isolating of the desired enantiomers from the cuvette walls was successfully obtained without complex procedures. In this sense, it has been demonstrated that the stirring forces are executively able to fulfil the chiral separation in H2 TPPS4 J-aggregates, employed as model of a self-assembled system in aqueous solution.

6.
J Colloid Interface Sci ; 625: 405-414, 2022 Nov.
Artigo em Inglês | MEDLINE | ID: mdl-35724463

RESUMO

The possibility to design rational carbon dots surface functionalization for specific analytical and bioanalytical applications is hindered by the lack of a full knowledge of the surface chemical features driving fluorescent properties. In this model study, we have synthesized four different peptides, three of which are isobaric and not distinguishable by common MSMS experiments. After having characterized the peptides conformations by CD analyses, we have covalently bonded all four peptides to carbon dots by using different experimental procedures, which produce different functional groups on the carbon dots surface. The peptide orientations obtained on the differently functionalized surface of the nanoparticles were different and produced different fluorescent responses. The reported results indicate the possibility to design amino and carboxyl enriched surface carbon dots to answer specific chemical requirements, paving the way for the use of these nanoparticles as a versatile and useful new chemical and biochemical tool.


Assuntos
Nanopartículas , Pontos Quânticos , Carbono/química , Corantes , Nanopartículas/química , Peptídeos , Pontos Quânticos/química , Propriedades de Superfície
7.
Molecules ; 26(3)2021 Jan 29.
Artigo em Inglês | MEDLINE | ID: mdl-33572895

RESUMO

The pivotal role played by potassium ions in the noncovalent synthesis of discrete porphyrin-calixarene nanostructures has been examined. The flattened-cone conformation adopted by the two cavities of octa-cationic calix[4]tube C4T was found to prevent the formation of complexes with well-defined stoichiometry between this novel water-soluble calixarene and the tetra-anionic phenylsulfonate porphyrin CuTPPS. Conversely, preorganization of C4T into a C4v-symmetrical scaffold, triggered by potassium ion encapsulation (C4T@K+), allowed us to carry out an efficient hierarchical self-assembly process leading to 2D and 3D nanostructures. The stepwise formation of discrete CuTPPS/C4T@K+ noncovalent assemblies, containing up to 33 molecular elements, was conveniently monitored by UV/vis spectroscopy by following the absorbance of the porphyrin Soret band.


Assuntos
Calixarenos/química , Ferroquelatase/química , Nanoestruturas/química , Porfirinas/química , Complexos de Coordenação/química , Íons/química , Metaloporfirinas/química , Conformação Molecular , Estrutura Molecular , Potássio/química , Ésteres do Ácido Sulfúrico/química
8.
Chirality ; 32(10): 1243-1249, 2020 10.
Artigo em Inglês | MEDLINE | ID: mdl-32794305

RESUMO

In this work, we have characterized the interactions of monospermine porphyrin derivative with calf thymus DNA (ct-DNA) and poly (dG-dC)2 in both B and Z conformation. By several spectroscopic techniques (UV-vis, electronic circular dichroism and resonance light scattering), the binding modes of monospermine porphyrin derivative with different DNA sequences have been elucidated. In the presence of ct-DNA, the porphyrin binds along the external double helix as well as in the presence of B conformation of poly (dG-dC)2 . Whilst when the Z form of the poly (dG-dC)2 is induced, a slight intercalation of the porphyrin between the basis has been detected.


Assuntos
DNA/química , Porfirinas/química , Espermina/química , Dicroísmo Circular , Conformação de Ácido Nucleico , Espectrofotometria Ultravioleta
9.
Int J Mol Sci ; 21(11)2020 May 27.
Artigo em Inglês | MEDLINE | ID: mdl-32471075

RESUMO

Antibiotics represent essential drugs to contrast the insurgence of bacterial infections in humans and animals. Their extensive use in livestock farming, including aquaculture, has improved production performances and food safety. However, their overuse can implicate a risk of water pollution and related antimicrobial resistance. Consequently, innovative strategies for successfully removing antibiotic contaminants have to be advanced to protect human health. Among them, photodegradation TiO2-driven under solar irradiation appears not only as a promising method, but also a sustainable pathway. Hence, we evaluated several composite TiO2 powders with H2TCPP, CuTCPP, ZnTCPP, and SnT4 porphyrin for this scope in order to explore the effect of porphyrins sensitization on titanium dioxide. The synthesis was realized through a fully non-covalent functionalization in water at room conditions. The efficacy of obtained composite materials was also tested in photodegrading oxolinic acid and oxytetracycline in aqueous solution at micromolar concentrations. Under simulated solar irradiation, TiO2 functionalized with CuTCPP has shown encouraging results in the removal of oxytetracycline from water, by opening the way as new approaches to struggle against antibiotic's pollution and, finally, to represent a new valuable tool of public health.


Assuntos
Antibacterianos/química , Farmacorresistência Bacteriana , Fotólise , Porfirinas/química , Gestão de Riscos , Titânio/química , Água/química , Adsorção , Ácido Oxolínico/química , Oxitetraciclina/química , Espectrofotometria Ultravioleta
10.
Chemistry ; 26(16): 3515-3518, 2020 Mar 18.
Artigo em Inglês | MEDLINE | ID: mdl-31990096

RESUMO

The hierarchical assembly, in aqueous solution, of a new multi-metalloporphyrin/calixarene aggregate has been accomplished. In this supramolecular system transfer of chirality, from the outermost components to the central porphyrin reporter, takes place as a result of favorable and fully noncovalent long-range electronic communication.

11.
Front Chem ; 8: 616961, 2020.
Artigo em Inglês | MEDLINE | ID: mdl-33409269

RESUMO

Chiral porphyrin hetero-aggregates, produced from meso-tetrakis(4-N-methylpyridyl) porphyrin H2T4 and copper(II) meso-tetrakis(4-sulfonatophenyl)porphyrin CuTPPS by an imprinting effect in the presence of L-3,4-dihydroxyphenylalanine (L-DOPA), are shown herein to serve as templates for the generation of chiral structures during the oxidative conversion of the amino acid to melanin. This remarkable phenomenon is suggested to involve the initial role of L-DOPA and related chiral intermediates like dopachrome as templates for the production of chiral porphyrin aggregates. When the entire chiral pool from DOPA is lost, chiral porphyrin hetero-aggregate would elicit axially chiral oligomer formation from 5,6-dihydroxyindole intermediates in the later stages of melanin synthesis. These results, if corroborated by further studies, may open unprecedented perspectives for efficient strategies of asymmetric melanin synthesis with potential biological and technological applications.

12.
Molecules ; 24(18)2019 Sep 14.
Artigo em Inglês | MEDLINE | ID: mdl-31540076

RESUMO

The dispersion of para-nitroaniline (p-NA) in water poses a threat to the environment and human health. Therefore, the development of functional adsorbents to remove this harmful compound is crucial to the implementation of wastewater purification strategies, and electrospun mats represent a versatile and cost-effective class of materials that are useful for this application. In the present study, we tested the ability of some polyethersulfone (PES) nanofibers containing adsorbed porphyrin molecules to remove p-NA from water. The functional mats in this study were obtained by two different approaches based on fiber impregnation or doping. In particular, meso-tetraphenyl porphyrin (H2TPP) or zinc(II) meso-tetraphenyl porphyrin (ZnTPP) were immobilized on the surface of PES fiber mats by dip-coating or added to the PES electrospun solution to obtain porphyrin-doped PES mats. The presence of porphyrins on the fiber surfaces was confirmed by UV-Vis spectroscopy, fluorescence measurements, and XPS analysis. p-NA removal from water solutions was spectrophotometrically detected and evaluated.


Assuntos
Compostos de Anilina/química , Nanofibras/química , Polímeros/química , Sulfonas/química , Águas Residuárias/química , Purificação da Água , Porfirinas/química
13.
Molecules ; 24(1)2018 Dec 27.
Artigo em Inglês | MEDLINE | ID: mdl-30591641

RESUMO

We report of the interactions between four amino acids lysine (Lys), arginine (Arg), histidine (His), and phenylalanine (Phe) with the J-aggregates of the protonated 5,10,15,20-tetrakis(4-sulfonatophenyl)-porphyrin H4TPPS. Several aspects of these self-assembled systems have been analyzed: (i) the chiral transfer process; (ii) the hierarchical effects leading to the aggregates formation; and, (iii) the influence of the amino acid concentrations on both transferring and storing chiral information. We have demonstrated that the efficient control on the J-aggregates chirality is obtained when all amino acids are tested and that the chirality transfer process is under hierarchical control. Finally, the chiral porphyrin aggregates obtained exhibit strong chiral inertia.


Assuntos
Aminoácidos/química , Porfirinas/química , Dicroísmo Circular , Ponto Isoelétrico , Espectrofotometria Ultravioleta , Estereoisomerismo
14.
Angew Chem Int Ed Engl ; 57(33): 10656-10660, 2018 08 13.
Artigo em Inglês | MEDLINE | ID: mdl-29939459

RESUMO

Cationic polylysine promotes, under neutral conditions, the spontaneous aggregation of opposite charged ZnTPPS in water. Spectroscopic investigations evidence a different preorganization of ZnTPPS onto the polypeptide matrix depending on the chain length. Spinodal decomposition theory in confined geometry is used to model this mechanism by considering the time evolution of a homogeneous distribution of randomly adsorbed particles (porphyrins) onto a rodlike polyelectrolyte (polymer) of variable length L.

15.
Chem Commun (Camb) ; 52(55): 8518-21, 2016 Jun 30.
Artigo em Inglês | MEDLINE | ID: mdl-27291354

RESUMO

Herein, we exploit the induction of chirality by chiral Zn(ii) Schiff-base complexes, followed by their spontaneous dissociation in aqueous solution, providing for the first time a possibility of overcoming the template removal steps, to demonstrate memorization of chirality in porphyrin hetero-aggregates.

SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA