Single-Molecule MicroRNA Electrochemiluminescence Detection Using Cyclometalated Dinuclear Ir(III) Complex with Synergistic Effect.

The realization of electrochemiluminescence (ECL) detection at the single-molecule level is a longstanding goal of ECL assay that requires a novel ECL probe with significantly enhanced luminescence. Here, the synergistic effect of electrochemiluminescence (ECL) is observed unprecedentedly in a new cyclometalated dinuclear Ir(III) complex [Ir2(dfppy)4(imiphenH)]PF6 (1·PF6, PF6- = hexafluorophosphate) in which two {Ir(dfppy)2}+ units are bridged by an imiphenH- ligand. The ECL intensity from complex 1·PF6 is 4.4 and 28.7 times as high as that of its reference mononuclear complexes 2 and 3·PF6, respectively. Theoretical calculation reveals that the S0 to S1 excitation is a local excitation in 1·PF6 with two electron-coupled Ir(III) centers, which contributes to the enhanced ECL. The synergistic effect of ECL in 1·PF6 can be used to detect microRNA 21 at the single-molecule level (microRNA 21: UAGCUUAUCAGACUGAUGUUGA), with detectable ECL emission from this complex intercalated in DNA/microRNA 21 duplex as low as 90 helix molecules. The finding of the synergistic effect of ECL will not only provide a novel strategy for the modulation of ECL intensity but also enable the detection of microRNA at the single-molecule level.

Cyclometalated Ir(iii) complexes [Ir(tpy)(bbibH2)Cl][PF6] and [Ir(tpy)(bmbib)Cl][PF6]: intramolecular ππ interactions leading to facile synthesis and enhanced luminescence.

Cyclometalated Ir(iii) complexes [Ir(tpy)(bbibH2)Cl][PF6] (1·PF6) and [Ir(tpy)(bmbib)Cl][PF6] (2·PF6), and the control complex [Ir(tpy)(mbib)Cl][PF6] (3·PF6) were synthesized at 135 °C for 10 hours for the former two complexes, while at 190 °C for 24 hours for the latter complex, in which the cyclometalated ligands bbibH2-, bmbib- and mbib- incorporate one or two N-methylbenzoimidazole/benzimidazole units in order to explore the influence of the molecular structures of these complexes on their synthesis conditions and luminescence behaviors. The 1H NMR and crystal structure measurements indicate that both 1·PF6 and 2·PF6 contain intramolecular ππ stacking interactions between the non-coordinated N-methylbenzoimidazole/benzimidazole unit and the tpy ligand, but there are no such ππ interactions in 3·PF6. At room temperature, these complexes in CH3CN reveal an emission with a combination of 3MLCT and 3LC characteristics, occurring at 534 nm with a quantum yield Φ = 39.5% and a lifetime τ = 2.39 µs for 1·PF6, 536 nm with Φ = 66.4% and τ = 2.94 µs for 2·PF6, and 558 nm with Φ = 27.0% and τ = 1.75 µs for 3·PF6. Moreover, both 1·PF6 and 2·PF6 exhibit a TFA-induced luminescence decrease. Based on the comparison among 1·PF6, 2·PF6 and 3·PF6, we discuss the influence of intramolecular ππ interactions and Nimidazole-H/Nimidazole-CH3 units in 1·PF6 and 2·PF6 on their syntheses and luminescence.

Aggregation-Induced Electrochemiluminescence from a Cyclometalated Iridium(III) Complex.

Aggregation-induced emission has been extensively found in organic compounds and metal complexes. In contrast, aggregation-induced electrochemiluminescence (AI-ECL) is rarely observed. Here, we employ two tridentate ligands [2,2':6',2″-terpyridine (tpy) and 1,3-bis(1 H-benzimidazol-2-yl)benzene (bbbiH3)] to construct a cyclometalated iridium(III) complex, [Ir(tpy)(bbbi)] (1), showing strong AI-ECL. Its crystal structure indicates that neighboring [Ir(tpy)(bbbi)] molecules are connected through both π-π-stacking interactions and hydrogen bonds. These supramolecular interactions can facilitate the self-assembly of complex 1 into nanoparticles in an aqueous solution. The efficient restriction of molecular vibration in these nanoparticles leads to strong AI-ECL emission of complex 1. In a dimethyl sulfoxide-water (H2O) mixture with a gradual increase in the H2O fraction from 20% to 98%, complex 1 showed a ∼39-fold increase in the electrochemiluminescence (ECL) intensity, which was ∼4.04 times as high as that of [Ru(bpy)3]2+ under the same experimental conditions. Moreover, the binding of bovine serum albumin to the nanoparticles of complex 1 can improve the ECL emission of this complex, facilitating the understanding of the mechanism of AI-ECL for future applications.

Coordination mode-induced isomeric cyclometalated [Ir(tpy)(nbi)Cl](PF6) complexes: distinct luminescence, self-assembly and cellular imaging behaviors.

Two isomeric Ir(iii) complexes Ir-O and Ir-R arising from the different coordination mode of a naphthalene-containing ligand, show distinct luminescence, self-assembly ability and cellular imaging behaviors.

Cyclometalated Ir(iii) complexes incorporating a photoactive anthracene-based ligand: syntheses, crystal structures and luminescence switching by light irradiation.

Two cyclometalated complexes [Ir(dfppy)2(aip)](PF6) (1) and [Ir(ppy)2(aip)](PF6) (2) have been synthesized based on a photoactive anthracene-based ligand aip and cyclometalating ligands dfppyH and ppyH [dfppyH = (2-(2,4-difluorophenyl)-pyridine), ppyH = 2-phenyl-pyridine]. Their crystal structures indicate that an aip ligand uses its phenanthroline moiety to chelate an {Ir(dfppy)2}+ unit in 1, while an {Ir(ppy)2}+ unit in 2. In CH2Cl2, the anthracene units in aip, 1 and 2 underwent photo-oxidation upon irradiation with 365 nm light, forming species aip-O, 1-O and 2-O, respectively. This photo-oxidation resulted in luminescence switching, from a luminescent state (emission at 493 nm) to a non-luminescent state for aip, while from a non-luminescent state to a luminescent state with an emission at 519 nm for 1 and 578 nm for 2. Additionally, the luminescence of aip, 1-O and 2-O in CH2Cl2 can be modulated by using TFA to protonate the imidazole units and/or non-coordinated phenanthroline moiety in these compounds. Upon adding TFA, aip showed luminescence quenching, while species 1-O and 2-O revealed both luminescence-intensity decrease and emission-wavelength increase (Δλ = 9 nm for 1-O, and Δλ = 4 nm for 2-O). In this paper, we discuss the luminescence switching/modulation of aip, 1 and 2 by light-irradiation-induced photo-oxidation of their anthracene units and by TFA treatment.

Cyclometalated Ir(iii) complexes based on 2-(2,4-difluorophenyl)-pyridine and 2,2'-(2-phenyl-1H-imidazole-4,5-diyl)dipyridine: acid/base-induced structural transformation and luminescence switching, and photocatalytic activity for hydrogen evolution.

Based on ligands dfppyH and pidpyH, cyclometalated Ir(iii) complexes [Ir(dfppy)2(pidpyH)](PF6) (1·PF6) and [Ir(dfppy)2(pidpy)] (2) have been synthesized. The crystal structures indicate that each {Ir(dfppy)2}+ unit is coordinated by a neutral ligand pidpyH in 1·PF6, while by a pidpy- anion in 2. The packing structure of 1·PF6 only exhibits electrostatic interactions and van der Waals interactions among [Ir(dfppy)2(pidpyH)]+ cations and PF6- ions. In contrast, the neighboring molecules in 2 are linked into a supramolecular chain structure through aromatic stacking interactions between two dfppy- ligands. In solution, 1·PF6 and 2 show acid/base-induced structural transformation due to the protonation/deprotonation of their pyridyl groups and/or imidazole units, which can be confirmed by their 1H NMR spectra. At room temperature, compounds 1·PF6, 2 and pidpyH in CH2Cl2 reveal TFA-induced luminescence switching behaviors, from a non-luminescence state to a luminescence state with an emission at 582 nm for both 1·PF6 and 2, and emission switching from 392 nm to 502 nm for pidpyH. These switching behaviors are associated with the protonation of pyridyl groups and/or imidazole units in 1·PF6, 2 and pidpyH. Moreover, compounds 1·PF6 and 2 were used as photosensitizers (PS) for reduction of water to hydrogen under the same experimental conditions. It was found that the amount of evolved hydrogen and the PS turnover number are 512 µmol and 102 for 1·PF6, and 131 µmol and 26 for 2, respectively. Thus, compound 1·PF6 has better photocatalytic activity than 2. In this paper, we discuss the modulation of luminescence and photocatalytic activities of 1·PF6 and 2 by varying the coordination mode and/or protonation extent of pidpyH/pidpy- ligands.

Cyclometalated Ir(iii) complexes containing quinoline-benzimidazole-based N

Cyclometalated Ir(iii) complexes [Ir(dfppy)2(qbiH)](PF6) (1), [Ir(dfppy)2(qbim)](PF6)·H2O (2), [Ir(dfppy)2(qbio)](PF6) (3) and [Ir(dfppy)2(qbi)] (4) have been designed and prepared, in which the N^N ligands qbiH, qbim and qbio incorporate different substituent groups R on their imidazole units (H atom, CH3 group and n-C8H17 group, respectively) in order to explore the influence of the substituent groups R and the protonation/deprotonation state of imidazole units in these Ir(iii) complexes on their structures and luminescence behaviors. Crystal structures indicate that an {Ir(dfppy)2}+ unit is coordinated by neutral ligands qbiH in 1, qbim in 2 and qbio in 3, while a qbi- anion in 4. These Ir(iii) complexes show clearly different molecular stacking modes. In compound 1, neighboring [Ir(dfppy)2(qbiH)]+ cations are linked into a supramolecular chain through ππ stacking interactions between adjacent dfppy-/qbiH ligands. In 2 and 4, two neighboring iridium complex units connect each other through ππ stacking interactions between dfppy- ligands in the former, while between qbi- ligands in the latter, forming supramolecular dimers. Compared to 1, 2 and 4, compound 3 only exhibits intermolecular van der Waals interactions. At room temperature, these Ir(iii) complexes in CH2Cl2 reveal phosphorescence with a mixing of 3MLCT and 3LC characters, emissions at 558 and 585 nm for 1, 572 (or 573) and 600 nm for 2 and 3, and 546 nm for 4. Compared to 1-3, compound 4 displays relatively weak luminescence intensity. Interestingly, upon addition of NEt3/TFA, both 1 and 4 in CH2Cl2 can switch their luminescence between strong emission at 558 nm and weak emission at 546 nm, due to their acid-/base-induced structural interconversion between the protonation state and the deprotonation state of the qbiH ligand. The emissions of 1-4 in the solid state reveal different degrees of the red shift compared to their corresponding emissions in CH2Cl2, the broad emission bands at 542, 572 and 611 nm for 1, 553, 581 and 612 nm for 2, 544, 578 and 630 nm for 3, and 595 and 633 nm for 4. Based on the crystal structures of 1-4, this work discusses the luminescence modulation of these Ir(iii) complexes by varying their substituent groups or the protonation/deprotonation state of the imidazole units.