Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 68
Filtrar
1.
Physiol Rep ; 12(14): e16124, 2024 Jul.
Artigo em Inglês | MEDLINE | ID: mdl-39016119

RESUMO

Alpha-1-antitrypsin (AAT) plays a homeostatic role in attenuating excessive inflammation and augmenting host defense against microbes. We demonstrated previously that AAT binds to the glucocorticoid receptor (GR) resulting in significant anti-inflammatory and antimycobacterial consequences in macrophages. Our current investigation aims to uncover AAT-regulated genes that rely on GR in macrophages. We incubated control THP-1 cells (THP-1control) and THP-1 cells knocked down for GR (THP-1GR-KD) with AAT, performed bulk RNA sequencing, and analyzed the findings. In THP-1control cells, AAT significantly upregulated 408 genes and downregulated 376 genes. Comparing THP-1control and THP-1GR-KD cells, 125 (30.6%) of the AAT-upregulated genes and 154 (41.0%) of the AAT-downregulated genes were significantly dependent on GR. Among the AAT-upregulated, GR-dependent genes, CSF-2 that encodes for granulocyte-monocyte colony-stimulating factor (GM-CSF), known to be host-protective against nontuberculous mycobacteria, was strongly upregulated by AAT and dependent on GR. We further quantified the mRNA and protein of several AAT-upregulated, GR-dependent genes in macrophages and the mRNA of several AAT-downregulated, GR-dependent genes. We also discussed the function(s) of selected AAT-regulated, GR-dependent gene products largely in the context of mycobacterial infections. In conclusion, AAT regulated several genes that are dependent on GR and play roles in host immunity against mycobacteria.


Assuntos
Macrófagos , Receptores de Glucocorticoides , alfa 1-Antitripsina , alfa 1-Antitripsina/genética , alfa 1-Antitripsina/metabolismo , Receptores de Glucocorticoides/metabolismo , Receptores de Glucocorticoides/genética , Humanos , Macrófagos/metabolismo , Macrófagos/imunologia , Células THP-1 , Regulação da Expressão Gênica , Fator Estimulador de Colônias de Granulócitos e Macrófagos/metabolismo , Fator Estimulador de Colônias de Granulócitos e Macrófagos/genética
2.
Int J Biol Macromol ; 268(Pt 2): 130853, 2024 May.
Artigo em Inglês | MEDLINE | ID: mdl-38570000

RESUMO

BACKGROUND: Pulmonary hypertension (PH) is a complex vascular disorder, characterized by pulmonary vessel remodeling and perivascular inflammation. Pulmonary arterial smooth muscle cells (PASMCs) pyroptosis is a novel pathological mechanism implicated of pulmonary vessel remodeling. However, the involvement of circRNAs in the process of pyroptosis and the underlying regulatory mechanisms remain inadequately understood. METHODS: Western blotting, PI staining and LDH release were used to explore the role of circLrch3 in PASMCs pyroptosis. Moreover, S9.6 dot blot and DRIP-PCR were used to assess the formation of R-loop between circLrch3 and its host gene Lrch3. Chip-qPCR were used to evaluate the mechanism of super enhancer-associated circLrh3, which is transcriptionally activated by the transcription factor Tbx2. RESULTS: CircLrch3 was markedly upregulated in hypoxic PASMCs. CircLrch3 knockdown inhibited hypoxia induced PASMCs pyroptosis in vivo and in vitro. Mechanistically, circLrch3 can form R-loop with host gene to upregulate the protein and mRNA expression of Lrch3. Furthermore, super enhancer interacted with the Tbx2 at the Lrch3 promoter locus, mediating the augmented transcription of circLrch3. CONCLUSION: Our findings clarify the role of a super enhancer-associated circLrch3 in the formation of R-loop with the host gene Lrch3 to modulate pyroptosis in PASMCs, ultimately promoting the development of PH.


Assuntos
Miócitos de Músculo Liso , Artéria Pulmonar , Piroptose , RNA Circular , Piroptose/genética , RNA Circular/genética , RNA Circular/metabolismo , Animais , Artéria Pulmonar/metabolismo , Artéria Pulmonar/patologia , Miócitos de Músculo Liso/metabolismo , Ratos , Proteínas com Domínio T/genética , Proteínas com Domínio T/metabolismo , Hipóxia Celular/genética , Músculo Liso Vascular/metabolismo , Masculino , Hipertensão Pulmonar/genética , Hipertensão Pulmonar/metabolismo , Hipertensão Pulmonar/patologia , Regulação da Expressão Gênica , Elementos Facilitadores Genéticos/genética , Hipóxia/genética , Hipóxia/metabolismo , Super Intensificadores
3.
Mater Horiz ; 11(13): 3166-3177, 2024 Jul 01.
Artigo em Inglês | MEDLINE | ID: mdl-38644769

RESUMO

In the leather manufacturing industry, the management of substantial quantities of solid waste containing chrome shavings remains a formidable challenge. Concurrently, there is a pressing need for the development of pH-universal and economically viable electrocatalysts for the hydrogen evolution reaction (HER). In response to these intertwined challenges, this study proposes an innovative approach wherein the amino groups present on the surface of chrome shavings are utilized to immobilize single ruthenium atoms during pyrolysis, thereby facilitating the synthesis of hydrogen evolution electrocatalysts. The optimized sample, denoted as CN/Cr2O3/Ru-1, demonstrates exceptional electrocatalytic performance, exhibiting an ultra-low overpotential of -28 mV in 1.0 M KOH at a current density of 10 mA cm-2, and it also exhibits good performance in acidic and neutral electrolytes. Importantly, these overpotentials surpass those reported for many previous ruthenium-based catalysts. Density functional theory (DFT) calculations elucidate that both oxygen (O) and chromium (Cr) moieties within Cr2O3 can engage in favorable interactions with the coordination patterns of the ruthenium (Ru) atoms, thereby elucidating the synergistic enhancement conferred by the chromium element in CN/Cr2O3/Ru, which ultimately facilitates and promotes the catalytic activity of the ruthenium atoms serving as the catalytic center. This facile synthesis route not only presents a green solution for addressing waste chromium pollutants but also offers a promising avenue for the development of high-performance, cost-efficient electrocatalysts.

4.
Sci Rep ; 14(1): 8534, 2024 04 12.
Artigo em Inglês | MEDLINE | ID: mdl-38609394

RESUMO

CD36 may defect on platelets and/or monocytes in healthy individuals, which was defined as CD36 deficiency. However, we did not know the correlation between the molecular and protein levels completely. Here, we aim to determine the polymorphisms of the CD36 gene, RNA level, and CD36 on platelets and in plasma. The individuals were sequenced by Sanger sequencing. Bioinformational analysis was used by the HotMuSiC, CUPSAT, SAAFEC-SEQ, and FoldX. RNA analysis and CD36 protein detection were performed by qPCR, flow cytometry, and ELISA. In this study, we found c.1228_1239delATTGTGCCTATT (allele frequency = 0.0072) with the highest frequency among our cohort, and one mutation (c.1329_1354dupGATAGAAATGATCTTACTCAGTGTTG) was not present in the dbSNP database. 5 mutations located in the extracellular domain sequencing region with confirmation in deficient individuals, of which c.284T>C, c.512A>G, c.572C>T, and c.869T>C were found to have a deleterious impact on CD36 protein stability. Furthermore, the MFI of CD36 expression on platelets in the mutation-carry, deleterious-effect, and deficiency group was significantly lower than the no-mutation group (P < 0.0500). In addition, sCD36 levels in type II individuals were significantly lower compared with positive controls (P = 0.0060). Nevertheless, we found the presence of sCD36 in a type I individual. RNA analysis showed CD36 RNA levels in platelets of type II individuals were significantly lower than the positive individuals (P = 0.0065). However, no significant difference was observed in monocytes (P = 0.7500). We identified the most prevalent mutation (c.1228_1239delATTGTGCCTATT) among Kunming donors. Besides, our results suggested RNA level alterations could potentially underlie type II deficiency. Furthermore, sCD36 may hold promise for assessing immune reaction risk in CD36-deficient individuals, but more studies should be conducted to validate this hypothesis.


Assuntos
Transtornos Plaquetários , Antígenos CD36 , Humanos , Antígenos CD36/genética , Plaquetas , Bases de Dados Factuais , RNA
5.
J Transl Med ; 22(1): 287, 2024 Mar 16.
Artigo em Inglês | MEDLINE | ID: mdl-38493183

RESUMO

BACKGROUND: Protein cysteine oxidation is substantially involved in various biological and pathogenic processes, but its implications in pancreatic cancer development remains poorly understood. METHODS AND RESULTS: In this study, we performed a global characterization of protein oxidation targets in PDAC cells through iodoTMT-based quantitative proteomics, which identified over 4300 oxidized cysteine sites in more than 2100 proteins in HPDE6c7 and PANC-1 cells. Among them, 1715 cysteine residues were shown to be differentially oxidized between HPDE6c7 and PANC-1 cells. Also, charged amino acids including aspartate, glutamate and lysine were significantly overrepresented in flanking sequences of oxidized cysteines. Differentially oxidized proteins in PANC-1 cells were enriched in multiple cancer-related biological processes and signaling pathways. Specifically, the HIF-1 signaling proteins exhibited significant oxidation alterations in PANC-1 cells, and the reduced PHD2 oxidation in human PDAC tissues was correlated with lower survival time in pancreatic cancer patients. CONCLUSION: These investigations provided new insights into protein oxidation-regulated signaling and biological processes during PDAC pathogenesis, which might be further explored for pancreatic cancer diagnosis and treatment.


Assuntos
Carcinoma Ductal Pancreático , Neoplasias Pancreáticas , Humanos , Cisteína/metabolismo , Proteômica , Neoplasias Pancreáticas/patologia , Carcinoma Ductal Pancreático/patologia , Oxirredução , Linhagem Celular Tumoral
6.
Bioinformatics ; 40(2)2024 Feb 01.
Artigo em Inglês | MEDLINE | ID: mdl-38366607

RESUMO

MOTIVATION: Nanopore sequencing is a new macromolecular recognition and perception technology that enables high-throughput sequencing of DNA, RNA, even protein molecules. The sequences generated by nanopore sequencing span a large time frame, and the labor and time costs incurred by traditional analysis methods are substantial. Recently, research on nanopore data analysis using machine learning algorithms has gained unceasing momentum, but there is often a significant gap between traditional and deep learning methods in terms of classification results. To analyze nanopore data using deep learning technologies, measures such as sequence completion and sequence transformation can be employed. However, these technologies do not preserve the local features of the sequences. To address this issue, we propose a sequence-to-image (S2I) module that transforms sequences of unequal length into images. Additionally, we propose the Transformer-based T-S2Inet model to capture the important information and improve the classification accuracy. RESULTS: Quantitative and qualitative analysis shows that the experimental results have an improvement of around 2% in accuracy compared to previous methods. The proposed method is adaptable to other nanopore platforms, such as the Oxford nanopore. It is worth noting that the proposed method not only aims to achieve the most advanced performance, but also provides a general idea for the analysis of nanopore sequences of unequal length. AVAILABILITY AND IMPLEMENTATION: The main program is available at https://github.com/guanxiaoyu11/S2Inet.


Assuntos
Nanoporos , Software , Análise de Sequência de DNA/métodos , Algoritmos , Sequenciamento de Nucleotídeos em Larga Escala/métodos
7.
ACS Appl Mater Interfaces ; 16(4): 5168-5182, 2024 Jan 31.
Artigo em Inglês | MEDLINE | ID: mdl-38234121

RESUMO

Metal coordination hydrogels (MC-HGs) that introduce dynamically coordinate bonds together with metal ionic conduction have attracted considerable attention in flexible electronics. However, the traditional soaking method alleged to have technical scalability faces the challenge of forming MC-HGs with a "core-shell" structure, which undoubtedly reduces the whole mechanical properties and ionic stimulation responsiveness required for flexible electronics materials. Herein, a novel strategy referred to as "masking" has been proposed based on the theory of the valence bond and coordination chemistry. By regulating the masking agents and their concentrations as well as pairing mode with the metal ions, the whole mechanical properties of the resulting composites (MC-HGsMasking) show nearly double the values of their traditional soaking samples (MC-HGsSoaking). For example, the fracture stress and toughness of Fe-HGsMasking(SA, 5.0 g/L) are 1.55 MPa and 2.14 MJ/m3, almost twice those of Fe-HGsSoaking (0.83 MPa and 0.93 MJ/m3, respectively). Microstructure characterization combined with finite element analysis, molecular dynamics, and first-principles simulations demonstrates that the masking strategy first facilitating interfacial permeation of metal complexes and then effective coordination with functional ligands (carboxylates) of the hydrogels is the mechanism to strengthen the mechanical properties of composites MC-HGsMasking, which has the potential to break through the limitations of current MC-HGs in flexible electronic sensor applications.

8.
Plast Reconstr Surg ; 153(2): 325-335, 2024 02 01.
Artigo em Inglês | MEDLINE | ID: mdl-37010471

RESUMO

BACKGROUND: The authors propose a hybrid breast augmentation (HBA) method combining implants and fat grafting and explore the outcome and safety through a retrospective, single-center, propensity score-matched, comparative study. METHODS: Outcome, satisfaction, and complications were compared between the HBA group (302 cases) and the implant-based breast augmentation (IBA) group (353 cases), and between the HBA group and the autologous fat grafting (AFG) group (277 cases). RESULTS: The mean follow-up period was 31.7 months. After propensity score matching (PSM), 270 cases were matched between the HBA and IBA groups, and 156 cases were matched between the HBA and AFG groups. Compared with the IBA group, HBA achieved higher scores of implant visibility/palpability and upper pole contour with the specialists' evaluations (before and after PSM; P < 0.05). Regarding patient satisfaction, the scores of softness (before and after PSM), smoothness of the upper pole (before PSM), and overall satisfaction (after PSM) of the HBA group were better ( P < 0.05). Implant-related complications occurred at a similar rate. Compared with the AFG group, HBA achieved higher scores of shape (before and after PSM) and symmetry (after PSM) with evaluations by specialists ( P < 0.05). The scores of shape, symmetry, and overall satisfaction in the HBA group were better (before and after PSM; P < 0.05). The HBA group showed a lower incidence of palpable cysts, fat necrosis, oil cysts, and fat calcification (before PSM; P < 0.05). CONCLUSION: When the three techniques were compared objectively, HBA presented better indices of aesthetic outcomes, satisfaction, and acceptable complications rates when compared with IBA and AFG. CLINICAL QUESTION/LEVEL OF EVIDENCE: Therapeutic, II.


Assuntos
Implantes de Mama , Cistos , Mamoplastia , Humanos , Estudos Retrospectivos , Tecido Adiposo/transplante , Mamoplastia/efeitos adversos , Mamoplastia/métodos , Complicações Pós-Operatórias/epidemiologia , Complicações Pós-Operatórias/etiologia , Complicações Pós-Operatórias/prevenção & controle , Transplante Autólogo/métodos , Resultado do Tratamento
9.
Int J Biol Macromol ; 254(Pt 3): 127999, 2024 Jan.
Artigo em Inglês | MEDLINE | ID: mdl-37949264

RESUMO

Manipulating the dispersibility and reactivity of two-dimensional nanomaterials in collagen fibers (CFs) matrix has aroused attention in the fabrication of multifunctional collagen-based nanocomposites. Here, α­zirconium phosphate nanoplatelets (ZrP NPs) were surface-functionalized with gallic acid (GA) to afford ZrP-GA NPs for engineering CFs matrix. The influence of ZrP-GA NPs on the ultraviolet barrier, antibacterial, and flame-retardant properties of resultant CFs matrix were investigated. Microstructural analysis revealed that ZrP-GA NPs were dispersed and bound within the collagen fibrils and onto the collagen strands in the CFs matrix. The resultant CFs matrix also maintained typical D-periodic structures of collagen fibrils and native branching and interwoven structures of CFs networks with increased porosity and enhanced ultraviolet barrier properties. Inhibition zone testing presented excellent antibacterial activities of the CFs matrix owing to surface grafting of antibacterial GA. Thanks to enhanced dispersion and binding of ZrP NPs with the CFs matrix by surface-functionalization with GA, the resultant CFs matrix reduced the peak heat release rate and the total heat release by 42.9 % and 39.0 %, respectively, highlighting improved flame-retardant properties. We envision that two-dimensional nanomaterials possess great potential in developing reasonable collagen-based nanocomposites towards the manufacture of emergent multifunctional collagen fibers-based wearable electronics.


Assuntos
Retardadores de Chama , Nanocompostos , Matriz Extracelular , Antibacterianos/farmacologia , Eletrônica , Ácido Gálico
10.
World J Clin Cases ; 11(35): 8310-8319, 2023 Dec 16.
Artigo em Inglês | MEDLINE | ID: mdl-38130623

RESUMO

BACKGROUND: There are many available treatment options for keloid; however, single treatments are usually less effective. Therefore, more scientifically rational and effective combined treatment methods should be sought to solve the pain associated with keloids. AIM: To explore the efficacy and safety of surgical resection and ultra-reduced tension suture combined with superficial radiation as keloid treatment. METHODS: Fifteen keloid patients admitted to Qingdao Eighth People's Hospital from June 2020 to January 2022 were enrolled in this retrospective analysis. All patients underwent a comprehensive treatment approach comprising surgical resection, ultra-reduced tension suture incision, and superficial radiation therapy within 24 h postoperatively. The modified Vancouver Scar Scale (mVSS) and Patient and Observer Scar Assessment Scale (POSAS) were used to evaluate the treatment effect, whereas the efficacy, adverse effects, and recurrence rate were observed according to the 12-mo follow-up after treatment. RESULTS: The mVSS and POSAS scores at 1 and 6 mo after combination treatment decreased compared to before treatment (P < 0.001), and the overall response rate was 93.3%. Only one case recurred, yielding a 6.7% recurrence rate. The incidence of local chromour sedimentation rate in 1-3 mo after radiotherapy was 33.3% (5 patients), all subsiding after 6-9 mo, without complications, such as delayed wound healing or dermatitis. CONCLUSION: Surgical resection, super subtraction sutures, and superficial radiotherapy are treatment methods with short courses, low recurrence rates, and good safety profiles.

11.
BMC Genomics ; 24(1): 592, 2023 Oct 06.
Artigo em Inglês | MEDLINE | ID: mdl-37798647

RESUMO

BACKGROUND: Antigenic stimulation through cross-linking the IgE receptor and epithelial cell-derived cytokine IL-33 are potent stimuli of mast cell (MC) activation. Moreover, IL-33 primes a variety of cell types, including MCs to respond more vigorously to external stimuli. However, target genes induced by the combined IL-33 priming and antigenic stimulation have not been investigated in human skin mast cells (HSMCs) in a genome-wide manner. Furthermore, epigenetic changes induced by the combined IL-33 priming and antigenic stimulation have not been evaluated. RESULTS: We found that IL-33 priming of HSMCs enhanced their capacity to promote transcriptional synergy of the IL1B and CXCL8 genes by 16- and 3-fold, respectively, in response to combined IL-33 and antigen stimulation compared to without IL-33 priming. We identified the target genes in IL-33-primed HSMCs in response to the combined IL-33 and antigenic stimulation using RNA sequencing (RNA-seq). We found that the majority of genes synergistically upregulated in the IL-33-primed HSMCs in response to the combined IL-33 and antigenic stimulation were predominantly proinflammatory cytokine and chemokine genes. Moreover, the combined IL-33 priming and antigenic stimulation increase chromatin accessibility in the synergy target genes but not synergistically. Transcription factor binding motif analysis revealed more binding sites for NF-κB, AP-1, GABPA, and RAP1 in the induced or increased chromatin accessible regions of the synergy target genes. CONCLUSIONS: Our study demonstrates that IL-33 priming greatly potentiates MCs' ability to transcribe proinflammatory cytokine and chemokine genes in response to antigenic stimulation, shining light on how epithelial cell-derived cytokine IL-33 can cause exacerbation of skin MC-mediated allergic inflammation.


Assuntos
Citocinas , Mastócitos , Humanos , Citocinas/genética , Citocinas/metabolismo , Mastócitos/metabolismo , Interleucina-33/genética , Interleucina-33/metabolismo , Quimiocinas/genética , Cromatina/metabolismo
12.
IEEE/ACM Trans Comput Biol Bioinform ; 20(6): 3851-3862, 2023.
Artigo em Inglês | MEDLINE | ID: mdl-37856269

RESUMO

In recent years, machine learning has gained increasing traction in the study of molecules, enabling researchers to tackle challenging tasks including molecular property prediction and drug design.Consequently, there remains an open challenge to develop a neural network architecture that can make use of extensive amounts of unlabeled data for training while still providing competitive results in various molecular property prediction tasks. To address this challenge, we propose a Molecule Graph Contrastive Learning approach based on the Transformer framework (T-MGCL). Our approach involves expanding numerous unsupervised molecular graphs and using a contrast estimator to ensure consistency among various graph expansions of the same molecule. Transformer framework is employed to consider the distance between atoms and molecular graph attributes, thereby accounting for structural information that may be overlooked by traditional graph neural networks. Our experimental results demonstrate that the T-MGCL model outperforms other models in several molecular property prediction tasks. Additionally, we observe that the attention weight learned by T-MGCL can be easily explained from a chemical perspective.


Assuntos
Desenho de Fármacos , Aprendizado de Máquina , Redes Neurais de Computação
13.
J Environ Manage ; 346: 119020, 2023 Nov 15.
Artigo em Inglês | MEDLINE | ID: mdl-37734212

RESUMO

Economically sustainable development requires more viable waste recycling solutions. In this context, we address the problem of utilizing chromium-containing sludge, a prevalent and environmentally hazardous waste. Meanwhile, sustainable energy development must develop ecology-friendly and low-cost electrocatalysts for the oxygen evolution reaction (OER) in alkaline media. Herein, we report an ultra-low-cost electrocatalyst from chromium-containing sludge. The optimum preparation conditions are determined by optimizing the calcination temperature and the loading of nickel acetylacetonate. The optimized catalyst delivers excellent stability and outstanding OER activity with overpotentials of 320 mV at 10 mA cm-2 in alkaline media. Density functional theory calculations reveal that the energy barrier of OER is decreased because of the catalyst's heterogeneous structure arrangement and confirm the influence of chromium on performance improvement. The concept of "turning waste into treasure" stimulates the search for methods to process Cr-containing waste and produce low-cost, high-performance electrocatalysts.

14.
ACS Appl Mater Interfaces ; 15(33): 39827-39836, 2023 Aug 23.
Artigo em Inglês | MEDLINE | ID: mdl-37578118

RESUMO

Recently, spiropyran-based composites have gained more attention on account of their stimuli-responsive essence, especially of the fascinating and green photo stimulus. However, the great dipole moment change between the ring-opened merocyanine and ring-closed spiropyran requires a large free volume available for isomerization, which significantly restrains the photoisomerization of spiropyran-based nanocomposites. Herein, a fascinating pathway by regulating the states both of spiropyran and the immobilized nanoparticle supports was put forward to facilitate the photoisomerization. The results demonstrated that the spiropyran grafting percentage of 5.18% and immobilized supports with less aggregation, high specific surface area, large pore size, and noncrystalline structure were suitable to fabricate spiropyran-based nanocomposites, which showed a significant improvement for Pb2+ and Cr3+ removal from aqueous solution on account of free photoisomerization of spiropyran on the support's surface. This work will pave the pathway to extend the exploitation of spiropyran-based nanocomposites in various fields such as biotechnology, physiology, and electronics to photonics and environmental-friendly fields.

15.
Chemosphere ; 339: 139606, 2023 Oct.
Artigo em Inglês | MEDLINE | ID: mdl-37499800

RESUMO

Excessive levels of formaldehyde (FA) represent serious health risks. Aiming at the detection of formaldehyde content, this paper proposes a self-assembly method of proportional nanoprobes. Spherical nanoparticles (NPs) were prepared by one-step condensation reaction between rhodamine B (RhB) and chitosan (CS). After CS was modified by RhB, the linear structure changed and self-assembled under the action of "hydrophilic/hydrophobic" to form a core-shell structure with a cavity structure. The hydrophobic small molecule probe N-Butyl-4-Hydrazo-1,8-Naphacticimide (NBHN) spontaneously entered into the hydrophobic cavity to form spherical particles Chitosan-Rhodamine B@N-Butyl-4-Hydrazo-1,8-Naphacticimide (CS-RhB@NBHN) with a size of about 60 nm. The hydroxyl groups on CS enrich formaldehyde through charge interaction, and promote the reaction of formaldehyde with NBHN, so that the probe can detect formaldehyde at a lower concentration (detection limit 87 nmol·L-1). The self-assembled CS-RhB@NBHN nanoparticles significantly increased the response speed of NBHN (from 30 min to 10 min). After the reaction of NBHN with formaldehyde, the PET effect is released, the fluorescence transition from red to yellow of CS-RhB@NBHN, and the visual fluorescence response effect to formaldehyde is significantly improved. With the help of smartphone color recognition software, we converted the color of the probe solution into RGB values to realize the quantitative and visual detection of formaldehyde. In addition, CS-RhB@NBHN was used for the detection of FA in leather and air.


Assuntos
Quitosana , Nanopartículas , Quitosana/química , Nanopartículas/química , Corantes , Formaldeído
16.
Aesthetic Plast Surg ; 2023 Jun 02.
Artigo em Inglês | MEDLINE | ID: mdl-37268792

RESUMO

BACKGROUND: Breast hypertrophy causes physical and psychological symptoms. Reduction mammaplasty is a surgical procedure to lessen discomfort. However, there is a dispute about whether the weight of breast resection is related to body weight. This study aims to provide Chinese data and assess the association between body weight and removed weight in women undergoing reduction mammaplasty. METHODS: Retrospective data were collected from 1777 breasts in a single center in 17 years. Simple linear regression analysis was performed to establish whether removed weight and removed weight ratio (removed weight/body weight) correlated with the body weight. The correlations were then analyzed again after grouping according to the removed weight. RESULTS: For all breasts included, removed weight or ratio positively correlates with body weight. When the removed weight is more than 1000g, there is no statistically significant correlation between body weight and removed breast weight. When removed per breast weight is more than 600g, there is no correlation between body weight and removed breast weight ratio. CONCLUSIONS: The correlation between body weight and removed weight or ratio decreased with increasing removed weight. When removed weight >600g, the degree of breast hypertrophy is not related to body shape. LEVEL OF EVIDENCE IV: This journal requires that authors assign a level of evidence to each article. For a full description of these evidence-based medicine ratings, please refer to the Table of Contents or the online Instructions to Authors www.springer.com/00266 . Therapeutic study.

17.
Small ; 19(44): e2303820, 2023 Nov.
Artigo em Inglês | MEDLINE | ID: mdl-37381641

RESUMO

Functional thin fabric with highly efficient cold protection properties are attracting the great attention of long-term dressing in a cold environment. Herein, a tri-layered bicomponent microfilament composite fabric comprised of a hydrophobic layer of PET/PA@C6 F13 bicomponent microfilament webs, an adhesive layer of LPET/PET fibrous web, and a fluffy-soft layer of PET/Cellulous fibrous web is designed and also successfully been fabricated through a facile process of dipping, combined with thermal belt bonding. The prepared samples exhibit a large resistance to wetting of alcohol, a high hydrostatic pressure of 5530 Pa, and brilliant water slipping properties, owing to the presence of dense micropores ranging from 25.1 to 70.3 µm, as well as to the smooth surface with an arithmetic mean deviation of surface roughness (Sa) ranging from 5.112 to 4.369 µm. Besides, the prepared samples exhibited good water vapor permeability, and a tunable CLO value ranging from 0.569 to 0.920, in addition to the fact that it exhibited a very suitable working temperature range of -5 °C to 15 °C. Additionally, it also showed excellent clothing tailorability including high mechanical strength with a remarkably soft texture and lightweight foldability that suitable for cold outdoor clothing applications.

18.
J Mater Chem B ; 11(21): 4619-4660, 2023 05 31.
Artigo em Inglês | MEDLINE | ID: mdl-37199698

RESUMO

Tannins, which are natural plant polyphenols, are widely used in different fields, especially in biomedical applications due to their unique properties, including high abundance, low cost, structural diversity, protein precipitation, biocompatibility, and biodegradability. However, they fail to satisfy the requirements in some specific applications (e.g., environmental remediation) on account of their water solubility, making their separation and regeneration difficult. Inspired by the design of composite materials, tannin-immobilized composites have emerged as promising and novel materials and combine or even surpass the advantages of each of their components. This strategy can endow tannin-immobilized composites with efficient manufacturing properties, high strength, good stability, easy chelating/coordinating ability, excellent antibacterial property, biological compatibility, bioactivity, chemical/corrosion resistance, and strong adhesive performance, which significantly expand their application in various fields. In this review, initially we summarize the design strategy of tannin-immobilized composites, mainly concentrating on the choice of immobilized substrate (e.g., natural polymers, synthetic polymers, and inorganic materials) as well as the binding interaction (e.g., Mannich reaction, Schiff base reaction, graft copolymerization, oxidation coupling, electrostatic interaction, and hydrogen bonding) between them. Further, the application of tannin-immobilized composites in the biomedical (tissue engineering, wound healing, cancer therapy, and biosensors) and other (leather materials, environmental remediation, and functional food packaging) fields is highlighted. Finally, we conclude with some thoughts on the open challenges and future perspectives of tannin composites. It can be anticipated that tannin-immobilized composites will continuously draw attention from more and more researchers, and further promising applications of tannin composites will be explored.


Assuntos
Polifenóis , Taninos , Taninos/química , Antibacterianos/farmacologia , Antibacterianos/química , Polímeros/química , Engenharia Tecidual
19.
Arterioscler Thromb Vasc Biol ; 43(7): 1179-1198, 2023 07.
Artigo em Inglês | MEDLINE | ID: mdl-37139839

RESUMO

BACKGROUND: Circular RNAs (circRNAs) have been implicated in pulmonary hypertension progression through largely unknown mechanisms. Pulmonary artery endothelial cell (PAEC) dysfunction is a hallmark in the pathogenesis of pulmonary hypertension. However, the specific role of circular RNAs in PAEC injury caused by hypoxia remains unclear. METHODS: In this study, using the Western blotting, RNA pull down, Dual-luciferase reporter assay, immunohistochemistry, and immunofluorescence, we identified a novel circular RNA derived from alternative splicing of the keratin 4 gene (circKrt4). RESULTS: CircKrt4 was upregulated in lung tissues and plasma and specifically in PAECs under hypoxic conditions. In the nucleus, circKrt4 induces endothelial-to-mesenchymal transition by interacting with the Pura (transcriptional activator protein Pur-alpha) to promote N-cadherin gene activation. In the cytoplasm, increased circKrt4 leads to mitochondrial dysfunction by inhibiting cytoplasmic-mitochondrial shuttling of mitochondrial-bound Glpk (glycerol kinase). Intriguingly, circKrt4 was identified as a super enhancer-associated circular RNA that is transcriptionally activated by a transcription factor, CEBPA (CCAAT enhancer binding protein alpha). Furthermore, RBM25 (RNA-binding-motif protein 25) was found to regulate circKrt4 cyclization by increase the back-splicing of Krt4 gene. CONCLUSIONS: These findings demonstrate that a super enhancer-associated circular RNA-circKrt4 modulates PAEC injury to promote pulmonary hypertension by targeting Pura and Glpk.


Assuntos
Hipertensão Pulmonar , Artéria Pulmonar , Camundongos , Animais , Artéria Pulmonar/metabolismo , RNA Circular/genética , RNA Circular/metabolismo , Proliferação de Células , Hipóxia/metabolismo , RNA/genética , Células Endoteliais/metabolismo
20.
Int J Biol Macromol ; 240: 124437, 2023 Jun 15.
Artigo em Inglês | MEDLINE | ID: mdl-37060985

RESUMO

Natural polysaccharide hydrogel, exemplified by chitosan­sodium alginate (CS-SA), has been prevailing in adsorption of chromium (III) (Cr(III)) containing contaminant. However, the traditional desorption of CS-SA-Cr(III) to recycle the adsorbent faces the problems including chemical desorbents secondary pollution, resource waste of the terminal CS-SA adsorbents, and tedious work of reusing the desorbed Cr(III). Herein, the adsorption product, CS-SA-Cr(III) gel, was degraded to CS/SA/Cr(III) sol and applied in leather re-tanning and filling processes directly. To achieve this goal, three degradation methods were used to transform the gel to sol. Due to the excellent overall performance of the CS/SA/Cr(III)-HMD4 sol (obtained by the hydrothermal-mechanical degradation method for 4 h (HMD4)), including wide size and distribution range, moderate viscosity (54 ± 3.1 mPa·s), high electronegativity (-38.6 ± 5.8 mV), and good stability, the resultant leather after re-tanning and filling by the sol achieved fascinating properties such as good thermal stability (Ts, 116.8 ± 1.8 °C; Td, 94.2 ± 1.7 °C), mechanical performance (tensile strength, 6.9 ± 0.52 MPa; elongation at break, 95 ± 3.0 %), and superduper thickening rate (31.8 %). Moreover, the mechanism of good re-tanning and filling effects was deciphered. Therefore, this work intends to overcome the limitation of traditional desorption technology and further realizes the high-valued application of the exhausted CS-SA-Cr(III) in leather re-tanning and filling processes.


Assuntos
Quitosana , Cromo , Cromo/química , Alginatos , Curtume , Poluição Ambiental
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA