A naphthalene diimide G-quadruplex ligand inhibits cell growth and down-regulates BCL-2 expression in an imatinib-resistant gastrointestinal cancer cell line.

Gastro-intestinal tumours (GISTs) are driven by aberrant expression of the c-KIT oncoprotein. They can be effectively treated by the kinase inhibitor imatinib, which locks the c-KIT kinase domain into an inactive conformation. However resistance to imatinib, driven by active-site mutations, is a recurrent clinical challenge, which has been only partly met by the subsequent development of second and third-generation c-KIT inhibitors. It is reported here that a tetra-substituted naphthalene diimide derivative, which is a micromolar inhibitor of cell growth in a wild-type patient-derived GIST cell line, has a sub-micromolar activity in two distinct patient-derived imatinib-resistant cell lines. The compound has been previously shown to down-regulate expression of the c-KIT protein in a wild-type GIST cell line. It does not affect c-KIT protein expression in a resistant cell line to the same extent, whereas it profoundly down-regulates the expression of the anti-apoptopic protein BCL-2. It is proposed that the mechanism of action involves targeting quadruplex nucleic acid structures, and in particular those in the BCL-2 gene and its RNA transcript. The BCL-2 protein is up-regulated in the GIST-resistant cell line, and is strongly down-regulated after treatment. The compound strongly stabilises a range of G-quadruplexes including a DNA one from the BCL-2 promoter and an RNA quadruplex from its 5'-UTR region. A reporter assay construct incorporating the 5'-UTR quadruplex sequence demonstrates down-regulation of BCL-2 expression.

Targeting Multiple Effector Pathways in Pancreatic Ductal Adenocarcinoma with a G-Quadruplex-Binding Small Molecule.

Human pancreatic ductal adenocarcinoma (PDAC) involves the dysregulation of multiple signaling pathways. A novel approach to the treatment of PDAC is described, involving the targeting of cancer genes in PDAC pathways having over-representation of G-quadruplexes, using the trisubstituted naphthalene diimide quadruplex-binding compound 2,7-bis(3-morpholinopropyl)-4-((2-(pyrrolidin-1-yl)ethyl)amino)benzo[ lmn][3,8]phenanthroline-1,3,6,8(2 H,7 H)-tetraone (CM03). This compound has been designed by computer modeling, is a potent inhibitor of cell growth in PDAC cell lines, and has anticancer activity in PDAC models, with a superior profile compared to gemcitabine, a commonly used therapy. Whole-transcriptome RNA-seq methodology has been used to analyze the effects of this quadruplex-binding small molecule on global gene expression. This has revealed the down-regulation of a large number of genes, rich in putative quadruplex elements and involved in essential pathways of PDAC survival, metastasis, and drug resistance. The changes produced by CM03 represent a global response to the complexity of human PDAC and may be applicable to other currently hard-to-treat cancers.

A G-quadruplex-binding compound showing anti-tumour activity in an in vivo model for pancreatic cancer.

We report here that a tetra-substituted naphthalene-diimide derivative (MM41) has significant in vivo anti-tumour activity against the MIA PaCa-2 pancreatic cancer xenograft model. IV administration with a twice-weekly 15 mg/kg dose produces ca 80% tumour growth decrease in a group of tumour-bearing animals. Two animals survived tumour-free after 279 days. High levels of MM41 are rapidly transported into cell nuclei and were found to accumulate in the tumour. MM41 is a quadruplex-interactive compound which binds strongly to the quadruplexes encoded in the promoter sequences of the BCL-2 and k-RAS genes, both of which are dis-regulated in many human pancreatic cancers. Levels of BCL-2 were reduced by ca 40% in tumours from MM41-treated animals relative to controls, consistent with BCL-2 being a target for MM41. Molecular modelling suggests that MM41 binds to a BCL-2 quadruplex in a manner resembling that previously observed in co-crystal structures with human telomeric quadruplexes. This supports the concept that MM41 (and by implication other quadruplex-targeting small molecules) can bind to quadruplex-forming promoter regions in a number of genes and down-regulate their transcription. We suggest that quadruplexes within those master genes that are up-regulated drivers for particular cancers, may be selective targets for compounds such as MM41.

Macrocyclic naphthalene diimides as G-quadruplex binders.

The synthesis, biological and molecular modeling evaluation of a series of macrocyclic naphthalene diimides is reported. The present investigation expands on the study of structure-activity relationships of prototype compound 2 by constraining the molecule into a macrocyclic structure with the aim of improving its G-quadruplex binding activity and selectivity. The new derivatives, compounds 4-7 carry spermidine- and spermine-like linkers while in compound 8 the inner basic nitrogen atoms of spermine have been replaced with oxygen atoms. The design strategy has led to potent compounds stabilizing both human telomeric (F21T) and c-KIT2 quadruplex sequences, and high selectivity for quadruplex in comparison to duplex DNA. Antiproliferative effects of the new derivatives 4-8 have been evaluated in a panel of cancer cell lines and all the tested compounds showed activity in the low micromolar or sub-micromolar range of concentrations. In order to rationalize the molecular basis of the DNA G-quadruplex versus duplex recognition preference, docking and molecular dynamics studies have been performed. The computational results support the observation that the main driving force in the recognition is due to electrostatic factors.

KRAS oncogene repression in colon cancer cell lines by G-quadruplex binding indolo[3,2-c]quinolines.

KRAS is one of the most frequently mutated oncogenes in human cancer, yet remaining undruggable. To explore a new therapeutic strategy, a library of 5-methyl-indolo[3,2-c]quinoline derivatives (IQc) with a range of alkyldiamine side chains was designed to target DNA and RNA G-quadruplexes (G4) in the promoter and 5'-UTR mRNA of the KRAS gene. Biophysical experiments showed that di-substituted IQc compounds are potent and selective KRAS G4 stabilizers. They preferentially inhibit the proliferation of KRAS mutant cancer cell lines (0.22 < IC50 < 4.80 µM), down-regulate KRAS promoter activity in a luciferase reporter assay, and reduce both KRAS mRNA and p21(KRAS) steady-state levels in mutant KRAS colon cancer cell lines. Additionally, IQcs induce cancer cell death by apoptosis, explained in part by their capacity to repress KRAS expression. Overall, the results suggest that targeting mutant KRAS at the gene level with G4 binding small molecules is a promising anticancer strategy.

Indolo[3,2-c]quinoline G-quadruplex stabilizers: a structural analysis of binding to the human telomeric G-quadruplex.

A library of 5-methylindolo[3,2-c]quinolones (IQc) with various substitution patterns of alkyldiamine side chains were evaluated for G-quadruplex (G4) binding mode and efficiency. Fluorescence resonance energy transfer melting assays showed that IQcs with a positive charge in the heteroaromatic nucleus and two weakly basic side chains are potent and selective human telomeric (HT) and gene promoter G4 stabilizers. Spectroscopic studies with HT G4 as a model showed that an IQc stabilizing complex involves the binding of two IQc molecules (2,9-bis{[3-(diethylamino)propyl]amino}-5-methyl-11H-indolo[3,2-c]quinolin-5-ium chloride, 3 d) per G4 unit, in two non-independent but equivalent binding sites. Molecular dynamics studies suggest that end-stacking of 3 d induces a conformational rearrangement in the G4 structure, driving the binding of a second 3 d ligand to a G4 groove. Modeling studies also suggest that 3 d, with two three-carbon side chains, has the appropriate geometry to participate in direct or water-mediated hydrogen bonding to the phosphate backbone and/or G4 loops, assisted by the terminal nitrogen atoms of the side chains. Additionally, antiproliferative studies showed that IQc compounds 2 d (2-{[3-(diethylamino)propyl]amino}-5-methyl-11H-indolo[3,2-c]quinolin-5-ium chloride) and 3 d are 7- to 12-fold more selective for human malignant cell lines than for nonmalignant fibroblasts.

Discovery of new G-quadruplex binding chemotypes.

We report here on the discovery and preliminary evaluation of a novel non-macrocyclic low molecular weight quadruplex-stabilizing chemotype. The lead compounds, based on a furan core, show high G-quadruplex stabilisation and selectivity as well as potent in vitro anti-proliferative activity.

Crystal structure of a promoter sequence in the B-raf gene reveals an intertwined dimer quadruplex.

The sequence d(GGGCGGGGAGGGGGAAGGGA) occurs in the promoter region of the B-raf gene. An X-ray crystallographic study has found that this forms an unprecedented dimeric quadruplex arrangement, with a core of seven consecutive G-quartets and an uninterrupted run of six potassium ions in the central channel of the quadruplex. Analogy with previously reported promoter quadruplexes had initially suggested that in common with these a monomeric quadruplex was to be expected. The structure has a distorted G·C·G·C base quartet at one end and four flipped-out adenosine nucleosides at the other. The only loops in the structure are formed by the cytosine and by the three adenosines within the sequence, with all of the guanosines participating in G-quartet formation. Solution UV and circular dichroism data are in accord with a stable quadruple arrangement being formed. 1D NMR data, together with gel electrophoresis measurements, are consistent with a dimer being the dominant species in potassium solution. A single-chain intramolecular quadruplex has been straightforwardly constructed using molecular modeling, by means of a six-nucleotide sequence joining 3' and 5' ends of each strand in the dimer. A human genomic database search has revealed a number of sequences containing eight or more consecutive short G-tracts, suggesting that such intramolecular quadruplexes could be formed within the human genome.

A new plant-derived antibacterial is an inhibitor of efflux pumps in Staphylococcus aureus.

An in-depth evaluation was undertaken of a new antibacterial natural product (1) recently isolated and characterised from the plant Hypericum olympicum L. cf. uniflorum. Minimum inhibitory concentrations (MICs) were determined for a panel of bacteria, including: meticillin-resistant and -susceptible strains of Staphylococcus aureus, Staphylococcus epidermidis and Staphylococcus haemolyticus; vancomycin-resistant and -susceptible Enterococcus faecalis and Enterococcus faecium; penicillin-resistant and -susceptible Streptococcus pneumoniae; group A streptococci (Streptococcus pyogenes); and Clostridium difficile. MICs were 2-8 mg/L for most staphylococci and all enterococci, but were ≥16 mg/L for S. haemolyticus and were >32 mg/L for all species in the presence of blood. Compound 1 was also tested against Gram-negative bacteria, including Escherichia coli, Pseudomonas aeruginosa and Salmonella enterica serovar Typhimurium but was inactive. The MIC for Mycobacterium bovis BCG was 60 mg/L, and compound 1 inhibited the ATP-dependent Mycobacterium tuberculosis MurE ligase [50% inhibitory concentration (IC(50)) = 75 µM]. In a radiometric accumulation assay with a strain of S. aureus overexpressing the NorA multidrug efflux pump, the presence of compound 1 increased accumulation of (14)C-enoxacin in a concentration-dependent manner, implying inhibition of efflux. Only moderate cytotoxicity was observed, with IC50 values of 12.5, 10.5 and 8.9 µM against human breast, lung and fibroblast cell lines, respectively, highlighting the potential value of this chemotype as a new antibacterial agent and efflux pump inhibitor.

Optimization of anti-proliferative activity using a screening approach with a series of bis-heterocyclic G-quadruplex ligands.

Using a phenotypic screening and SAR optimization approach, a phenyl-bis-oxazole derivative has been identified with anti-proliferative activity, optimized with the use of a panel of cancer cell lines. The lead compound was synthesized by means of a short and effective two-step synthesis using Pd-catalyzed direct arylation. The compound stabilizes several quadruplex DNA sequences including a human telomeric DNA and one from the promoter of the HSP90 gene, although the structure-activity relationships of the series are not obviously related to the quadruplex binding.

The influence of positional isomerism on G-quadruplex binding and anti-proliferative activity of tetra-substituted naphthalene diimide compounds.

The synthesis together with biophysical and biological evaluation of a series of tetra-substituted naphthalene diimide (ND) compounds, are presented. These compounds are positional isomers of a recently-described series of quadruplex-binding ND derivatives, in which the two N-methyl-piperidine-alkyl side-chains have now been interchanged with the positions of side-chains bearing a range of end-groups. Molecular dynamics simulations of a pair of positional isomers are in accord with the quadruplex stabilization and biological data for these compounds. Analysis of structure-activity data indicates that for compounds where the side-chains are not of equivalent length then the positional isomers described here tend to have improved cell proliferation potency and in some instances, superior quadruplex stabilization ability.

Structure-based design and evaluation of naphthalene diimide G-quadruplex ligands as telomere targeting agents in pancreatic cancer cells.

Tetra-substituted naphthalene diimide (ND) derivatives with positively charged termini are potent stabilizers of human telomeric and gene promoter DNA quadruplexes and inhibit the growth of human cancer cells in vitro and in vivo. The present study reports the enhancement of the pharmacological properties of earlier ND compounds using structure-based design. Crystal structures of three complexes with human telomeric intramolecular quadruplexes demonstrate that two of the four strongly basic N-methyl-piperazine groups can be replaced by less basic morpholine groups with no loss of intermolecular interactions in the grooves of the quadruplex. The new compounds retain high affinity to human telomeric quadruplex DNA but are 10-fold more potent against the MIA PaCa-2 pancreatic cancer cell line, with IC50 values of ~10 nM. The lead compound induces cellular senescence but does not inhibit telomerase activity at the nanomolar dosage levels required for inhibition of cellular proliferation. Gene array qPCR analysis of MIA PaCa-2 cells treated with the lead compound revealed significant dose-dependent modulation of a distinct subset of genes, including strong induction of DNA damage responsive genes CDKN1A, DDIT3, GADD45A/G, and PPM1D, and repression of genes involved in telomere maintenance, including hPOT1 and PARP1.

Thioester derivatives of the natural product psammaplin A as potent histone deacetylase inhibitors.

There has been significant interest in the bioactivity of the natural product psammaplin A, most recently as a potent and isoform selective HDAC inhibitor. Here we report our preliminary studies on thioester HDAC inhibitors derived from the active monomeric (thiol) form of psammaplin A, as a means to improve compound delivery into cells. We have discovered that such compounds exhibit both potent cytotoxicity and enzymatic inhibitory activity against recombinant HDAC1. The latter effect is surprising since previous SAR suggested that modification of the thiol functionality should detrimentally affect HDAC potency. We therefore also report our preliminary studies on the mechanism of action of this observed effect.

Sequences in the HSP90 promoter form G-quadruplex structures with selectivity for disubstituted phenyl bis-oxazole derivatives.

The HSP90 protein is an important target in cancer. We report here that stable quadruplex DNAs can be formed from a promoter sequence in the HSP90 gene, on the basis of melting, circular and NMR studies, and show that these can be selectively targeted by non-macrocyclic quadruplex-stabilizing phenyl bis-oxazole derivatives. These do not bind significantly to duplex DNA and show low stabilization of the human telomeric quadruplex. These results suggest an approach to targeting HSP90 at the DNA level.

The prenylated dioxopiperazine alkaloid Cristatin A has selective telomeric DNA G-quadruplex stabilising properties.

Cristatin A (1a/b), a prenylated dioxopiperazine alkaloid, has been shown to bind selectively to telomeric quadruplex DNA using a FRET-based DNA melting assay. Crucially, the molecule is more drug-like than most previously identified quadruplex-binding agents, and provides a unique chemical scaffold for future chemical biology and drug discovery studies.

Bioactive compounds from Carissa spinarum.

In our continuing efforts to find new antiherpetic agents from plants, an extract prepared from the stems of Carissa spinarum L. was found to possess appreciable activity against herpes simplex viruses (HSV I and II). A chemical study of this plant was then initiated, and this led to the isolation of 12 compounds, including a coumarin, two cardiac glycosides and nine lignans. These isolated compounds were evaluated for several biological activities, including antiherpetic, cytotoxic, antioxidant and antibacterial effects. The cardiac glycoside evomonoside was found to be the only antiherpetic principle, showing moderate activity against herpes simplex virus types I and II in the inactivation method. The lignans (-)-carinol, (-)-carissanol and (-)-nortrachelogenin exhibited cytotoxicity against breast (MCF7) and lung (A549) cancer cells. Moderate anti-DPPH free radical activity was observed for all the lignans. None of the isolates showed antibacterial activity.

Defining the mechanism of action and enzymatic selectivity of psammaplin A against its epigenetic targets.

Psammaplin A (11c) is a marine metabolite previously reported to be a potent inhibitor of two classes of epigenetic enzymes: histone deacetylases and DNA methyltransferases. The design and synthesis of a focused library based on the psammaplin A core has been carried out to probe the molecular features of this molecule responsible for its activity. By direct in vitro assay of the free thiol generated upon reduction of the dimeric psammaplin scaffold, we have unambiguously demonstrated that 11c functions as a natural prodrug, with the reduced form being highly potent against HDAC1 in vitro (IC(50) 0.9 nM). Furthermore, we have shown it to have high isoform selectivity, being 360-fold selective for HDAC1 over HDAC6 and more than 1000-fold less potent against HDAC7 and HDAC8. SAR around our focused library revealed a number of features, most notably the oxime functionality to be important to this selectivity. Many of the compounds show significant cytotoxicity in A549, MCF7, and W138 cells, with the SAR of cytotoxicity correlating to HDAC inhibition. Furthermore, compound treatment causes upregulation of histone acetylation but little effect on tubulin acetylation. Finally, we have found no evidence for 11c functioning as a DNMT inhibitor.

Molecular basis of structure-activity relationships between salphen metal complexes and human telomeric DNA quadruplexes.

The first X-ray crystal structures of nickel(II) and copper(II) salphen metal complexes bound to a quadruplex DNA are presented. Two structures have been determined and show that these salphen-metal complexes bind to human telomeric quadruplexes by end-stacking, with the metal in each case almost in line with the potassium ion channel. Quadruplex and duplex DNA binding is presented for these two and other related salphen complexes, all with side-chains terminating in pyrrolidino end-groups and differing patterns of substitution on the salphen core. The crystal structures are able to provide rationalizations for the structure-activity data, and in particular for the superior quadruplex-binding of the nickel complexes compared to that of the copper-containing ones. The complexes show significant antiproliferative activity for the compounds in a panel of cancer cell lines. They also show telomerase inhibitory activity in the telomerase TRAP-LIG assay.

Targeting pancreatic cancer with a G-quadruplex ligand.

The integrity of telomeres in most cancer cells is maintained by the action of the telomerase enzyme complex, which catalyzes the synthesis of telomeric DNA repeats in order to replace those lost during replication. Telomerase is especially up-regulated in metastatic cancer and is thus emerging as a major therapeutic target. One approach to telomerase inhibition involves the sequestration of the single-stranded 3' ends of telomeric DNA into higher-order quadruplex structures. We have recently shown that tetra-substituted naphthalene diimide compounds are potent quadruplex-stabilizing molecules with telomerase inhibitory activity in cells. We show here that one such compound, BMSG-SH-3, which has been optimized by computer modeling, has significant in vivo antitumor activity against a model for pancreatic cancer, a cancer that is especially resistant to current therapies. A large reduction in telomerase activity in treated tumors was observed and the naphthalene diimide compound was found to be selectively localized in the treated tumors. We find that the expression of the therapeutically important chaperone protein HSP90, a regulator of telomerase is also reduced in vivo by BMSG-SH-3 treatment. The compound is a potent stabilizer of two G-quadruplex sequences found in the promoter region of the HSP90 gene, as well as a G-quadruplex from human telomeric DNA. It is proposed that the simultaneous targeting of these quadruplexes may be an effective anti-tumor strategy.

Tetrasubstituted naphthalene diimide ligands with selectivity for telomeric G-quadruplexes and cancer cells.

A series of tetrasubstituted naphthalene diimide compounds with N-methylpiperazine end groups has been synthesized and evaluated as G-quadruplex ligands. They have high affinity and selectivity for telomeric G-quadruplex DNA over duplex DNA. CD studies show that they induce formation of a parallel G-quadruplex topology. They inhibit the binding of hPOT1 and topoisomerase IIIα to telomeric DNA and inhibit telomerase activity in MCF7 cells. The compounds have potent activity in a panel of cancer cell lines, with typical IC(50) values of ∼0.1 µM, and up to 100-fold lower toxicity in a normal human fibroblast cell line.