Proton Pump Inhibitors in Germany: Status Quo of a Growing Market.

Introduction: The volume of prescriptions for proton pump inhibitors (PPIs) remains high, although the literature increasingly points to excessive prescribing in relation to guideline recommendations. No very recent data is available on the specific situation in Germany, particularly on the proportion of PPI consumption from over-the-counter (OTC) sales and self-selection, following PPI down-scheduling. The aim of this study was to determine the actual amount of prescribed and OTC PPIs in Germany. Methods: For this retrospective study, several IQVIA databases were used, representing all prescriptions billed to statutory and private health insurers in Germany, as well as OTC sales. Analyses were performed for the period November 2020 to October 2021 or partially November 2018 to October 2021 and were descriptive in nature. Mainly, data were collected from IQVIATM PharmaScope National® as well as IQVIA TM DPM® databases. Results: A total of 2.87 billion PPI tablets were shown to have been sold between November 2020 and October 2021, with most drugs prescribed in the largest packages and strengths. In addition, the OTC PPI market increased by an average of 14% per year over a 3-year period. Conclusions: The results of this study suggest the substantial size of the PPI market in Germany is based on prescriptions, a consistent increase in OTC PPI purchases and a recent increase in prescriptions.

Structure of the acidianus filamentous virus 3 and comparative genomics of related archaeal lipothrixviruses.

Four novel filamentous viruses with double-stranded DNA genomes, namely, Acidianus filamentous virus 3 (AFV3), AFV6, AFV7, and AFV8, have been characterized from the hyperthermophilic archaeal genus Acidianus, and they are assigned to the Betalipothrixvirus genus of the family Lipothrixviridae. The structures of the approximately 2-mum-long virions are similar, and one of them, AFV3, was studied in detail. It consists of a cylindrical envelope containing globular subunits arranged in a helical formation that is unique for any known double-stranded DNA virus. The envelope is 3.1 nm thick and encases an inner core with two parallel rows of protein subunits arranged like a zipper. Each end of the virion is tapered and carries three short filaments. Two major structural proteins were identified as being common to all betalipothrixviruses. The viral genomes were sequenced and analyzed, and they reveal a high level of conservation in both gene content and gene order over large regions, with this similarity extending partly to the earlier described betalipothrixvirus Sulfolobus islandicus filamentous virus. A few predicted gene products of each virus, in addition to the structural proteins, could be assigned specific functions, including a putative helicase involved in Holliday junction branch migration, a nuclease, a protein phosphatase, transcriptional regulators, and glycosyltransferases. The AFV7 genome appears to have undergone intergenomic recombination with a large section of an AFV2-like viral genome, apparently resulting in phenotypic changes, as revealed by the presence of AFV2-like termini in the AFV7 virions. Shared features of the genomes include (i) large inverted terminal repeats exhibiting conserved, regularly spaced direct repeats; (ii) a highly conserved operon encoding the two major structural proteins; (iii) multiple overlapping open reading frames, which may be indicative of gene recoding; (iv) putative 12-bp genetic elements; and (v) partial gene sequences corresponding closely to spacer sequences of chromosomal repeat clusters.

Genome of the Acidianus bottle-shaped virus and insights into the replication and packaging mechanisms.

The Acidianus bottle-shaped virus, ABV, infects strains of the hyperthermophilic archaeal genus Acidianus and is morphologically distinct from all other known viruses. Its genome consists of linear double-stranded DNA, containing 23,814 bp with a G+C content of 35%, and it exhibits a 590-bp inverted terminal repeat. Of the 57 predicted ORFs, only three produced significant matches in public sequence databases with genes encoding a glycosyltransferase, a thymidylate kinase and a protein-primed DNA polymerase. Moreover, only one homologous gene is shared with other sequenced crenarchaeal viruses. The results confirm the unique nature of the ABV virus, and support its assignment to the newly proposed viral family the Ampullaviridae. Exceptionally, one region at the end of the linear genome of ABV is similar in both gene content and organization to corresponding regions in the genomes of the bacteriophage varphi29 and the human adenovirus. The region contains the genes for a putative protein-primed DNA polymerase, and a small putative RNA with a predicted secondary structure closely similar to that of the prohead RNA of bacteriophage varphi29. The apparent similarities in the putative mechanisms of DNA replication and packaging of ABV to those of bacterial and eukaryal viruses are most consistent with the concept of a primordial gene pool as a source of viral genes.

Structural and genomic properties of the hyperthermophilic archaeal virus ATV with an extracellular stage of the reproductive cycle.

A novel virus, ATV, of the hyperthermophilic archaeal genus Acidianus has the unique property of undergoing a major morphological development outside of, and independently of, the host cell. Virions are extruded from host cells as lemon-shaped tail-less particles, after which they develop long tails at each pointed end, at temperatures close to that of the natural habitat, 85 degrees C. The extracellularly developed tails constitute tubes, which terminate in an anchor-like structure that is not observed in the tail-less particles. A thin filament is located within the tube, which exhibits a periodic structure. Tail development produces a one half reduction in the volume of the virion, concurrent with a slight expansion of the virion surface. The circular, double-stranded DNA genome contains 62,730 bp and is exceptional for a crenarchaeal virus in that it carries four putative transposable elements as well as genes, which previously have been associated only with archaeal self-transmissable plasmids. In total, it encodes 72 predicted proteins, including 11 structural proteins with molecular masses in the range of 12 to 90 kDa. Several of the larger proteins are rich in coiled coil and/or low complexity sequence domains, which are unusual for archaea. One protein, in particular P800, resembles an intermediate filament protein in its structural properties. It is modified in the two-tailed, but not in the tail-less, virion particles and it may contribute to viral tail development. Exceptionally for a crenarchaeal virus, infection with ATV results either in viral replication and subsequent cell lysis or in conversion of the infected cell to a lysogen. The lysogenic cycle involves integration of the viral genome into the host chromosome, probably facilitated by the virus-encoded integrase and this process can be interrupted by different stress factors.

Virology: independent virus development outside a host.

Viruses are thought to be functionally inactive once they are outside and independent of their host cell. Here we describe an exceptional property of a newly discovered virus that infects a hyperthermophilic archaeon growing in acidic hot springs: the lemon-shaped viral particle develops a very long tail at each of its pointed ends after being released from its host cell. The process occurs only at the temperature of the host's habitat (75-90 degrees C) and it does not require the presence of the host cell, an exogenous energy source or any cofactors. This host-independent morphological development may be a strategy for viral survival in an environment that is unusually harsh and has limited host availability.

Viral diversity in hot springs of Pozzuoli, Italy, and characterization of a unique archaeal virus, Acidianus bottle-shaped virus, from a new family, the Ampullaviridae.

Virus-like particles with five different morphotypes were observed in an enriched environmental sample from a hot, acidic spring (87 to 93 degrees C, pH 1.5) in Pozzuoli, Italy. The morphotypes included rigid rods, flexible filaments, and novel, exceptional forms. Particles of each type were isolated, and they were shown to represent viable virions of five novel viruses which infect members of the hyperthermophilic archaeal genus Acidianus. One of these, named the Acidianus bottle-shaped virus, ABV, exhibits a previously unreported morphotype. The bottle-shaped virion carries an envelope which encases a funnel-shaped core. The pointed end of the virion is likely to be involved in adsorption and channeling of viral DNA into host cells. The broad end exhibits 20 (+/- 2) thin filaments which appear to be inserted into a disk, or ring, and are interconnected at their bases. These filaments are apparently not involved in adsorption. ABV virions contain six proteins in the size range 15 to 80 kDa and a 23.9-kb linear, double-stranded DNA genome. Virus replication does not cause lysis of host cells. On the basis of its unique morphotype and structure, we propose to assign ABV to a new viral family, the Ampullaviridae.

Structure and genome organization of AFV2, a novel archaeal lipothrixvirus with unusual terminal and core structures.

A novel filamentous virus, AFV2, from the hyperthermophilic archaeal genus Acidianus shows structural similarity to lipothrixviruses but differs from them in its unusual terminal and core structures. The double-stranded DNA genome contains 31,787 bp and carries eight open reading frames homologous to those of other lipothrixviruses, a single tRNA(Lys) gene containing a 12-bp archaeal intron, and a 1,008-bp repeat-rich region near the center of the genome.

A novel rudivirus, ARV1, of the hyperthermophilic archaeal genus Acidianus.

Virus ARV1, the first member of the family Rudiviridae infecting hyperthermophilic archaea of the genus Acidianus, was isolated from a hot spring in Pozzuoli, Italy. The rod-shaped virions, 610 +/- 50 nm long and 22 +/- 3 nm wide, are non-enveloped and carry a helical nucleoprotein core, with three tail fibers protruding at each end which appear to be involved in adsorption onto the host cell surface. The virions contain two protein components, a major one of 14.4 kDa, which is glycosylated and a minor of about 124 kDa. The linear double-stranded DNA genome yielded 24,655 bp of sequence, including 1365 bp inverted terminal repeats. Coding is on both strands and about 40% of the predicted genes are homologous to those of other hyperthermophilic crenarchaeal viruses, mainly rudiviruses. They include genes encoding the coat protein, two glycosyl transferases and a Holliday junction resolvase. Other assigned functions include a thymidylate synthase and three DNA-binding proteins. The genome sequence and composition differ strongly from those of the Sulfolobus rudiviruses SIRV1 and SIRV2, and the genome stability is very high, with no sequence variants being detected. Although the sequences of the inverted terminal repeats of the three rudiviruses are different, they all carry the motif AATTTAGGAATTTAGGAATTT near the genome ends which may constitute a signal for the Holliday junction resolvase and DNA replication.

Morphology and genome organization of the virus PSV of the hyperthermophilic archaeal genera Pyrobaculum and Thermoproteus: a novel virus family, the Globuloviridae.

A novel virus, termed Pyrobaculum spherical virus (PSV), is described that infects anaerobic hyperthermophilic archaea of the genera Pyrobaculum and Thermoproteus. Spherical enveloped virions, about 100 nm in diameter, contain a major multimeric 33-kDa protein and host-derived lipids. A viral envelope encases a superhelical nucleoprotein core containing linear double-stranded DNA. The PSV infection cycle does not cause lysis of host cells. The viral genome was sequenced and contains 28337 bp. The genome is unique for known archaeal viruses in that none of the genes, including that encoding the major structural protein, show any significant sequence matches to genes in public sequence databases. Exceptionally for an archaeal double-stranded DNA virus, almost all the recognizable genes are located on one DNA strand. The ends of the genome consist of 190-bp inverted repeats that contain multiple copies of short direct repeats. The two DNA strands are probably covalently linked at their termini. On the basis of the unusual morphological and genomic properties of this DNA virus, we propose to assign PSV to a new viral family, the Globuloviridae.