A systematic review of novel cannabinoids and their targets: Insights into the significance of structure in activity.

To provide a comprehensive framework of the current information on the potency and efficacy of interaction between phyto- and synthetic cannabinoids and their respective receptors, an electronic search of the PubMed, Scopus, and EMBASE literature was performed. Experimental studies included reports of mechanistic data providing affinity, efficacy, and half-maximal effective concentration (EC50). Among the 108 included studies, 174 structures, and 16 targets were extracted. The most frequent ligands belonged to the miscellaneous category with 40.2% followed by phytocannabinoid-similar, indole-similar, and pyrrole-similar structures with an abundance of 17.8%, 16.6%, and 12% respectively. 64.8% of structures acted as agonists, 17.1 % appeared as inverse agonists, 10.8% as antagonists, and 7.2% of structures were reported with antagonist/inverse agonist properties. Our outcomes identify the affinity, EC50, and efficacy of the interactions between cannabinoids and their corresponding receptors and the subsequent response, evaluated in the available evidence. Considering structures' significance and very important effects of on the activities, the obtained results also provide clues to drug repurposing.

Identification of Four Populations of Meloidogyne incognita in Georgia, United States, Capable of Parasitizing Tomato-Bearing Mi-1.2 Gene.

Meloidogyne incognita, the southern root-knot nematode (RKN), is the most predominant plant-parasitic nematode species of tomato and causes significant yield loss. The Mi-1.2 gene confers resistance in tomatoes to M. incognita; however, virulent RKN populations capable of parasitizing resistant tomato cultivars have been reported from different regions in the world. Four naturally occurring virulent populations of M. incognita were found in vegetable fields from four counties in Georgia with no history of tomato cultivation of the Mi gene. Two consecutive greenhouse trials showed that all four virulent RKN populations reproduced on tomato cultivars, including Amelia, Skyway, and Myrtle, with the Mi-1 gene, while an avirulent population of M. incognita race 3 was unable to overcome host resistance. Virulent RKN populations varied in reproduction among resistant cultivars, with Ma6 population having the greatest reproduction potential. No difference in penetration potential of the virulent (Ma6) and avirulent populations was found on susceptible and resistant tomato cultivars. However, virulent Ma6 population females were successful at egg-laying, whereas avirulent female development was arrested in the resistant cultivars. The virulent Ma6 population also induced feeding sites in the roots of resistant cultivars, whereas the avirulent population did not. To our knowledge, this is the first report of resistance-breaking populations of M. incognita in Georgia and the second state in the United States after California.

Differences in parasitism of root-knot nematodes (Meloidogyne spp.) on oilseed radish and oat.

Oilseed radish and oat are cool season annual crops that are potentially used as "trap" or "biofumigant" crops for the suppression of plant-parasitic nematodes in soil. Cultivars of oilseed radish (Carwoodi, Cardinal, Final, Image, Concorde, Control, Eco-Till, Karakter and Cannavaro), white (Tachiibuki) and black (Pratex) oats were evaluated for their ability to reduce reproduction of three root-knot nematode species: Meloidogyne javanica, M. incognita race 3, and M. arenaria race 1. Nematode penetration and development were also evaluated using selected resistant and susceptible cultivars under greenhouse conditions. Root galling severity, number of eggs per gram of fresh root, and rate of reproduction varied among the cultivars in response to nematode infection. Oilseed radish cv. Carwoodi was resistant to M. javanica, whereas Karakter and Concorde were maintenance hosts allowing the nematode to maintain or increase its population on the plants. For M. incognita, Control and Carwoodi oilseed radish and Tachiibuki oat were resistant hosts. The cultivars that supported little reproduction of M. arenaria were Karakter and Carwoodi radish, and Tachiibuki oat. Comparable numbers of nematodes entered the roots of susceptible and resistant cultivars of oilseed radish and oat during early stages of infection. However, the development of the nematodes as evident from counting young and egg-laying females in roots were significantly decreased or inhibited in the resistant cultivars compared to the susceptible cultivars indicating that resistance occurs at post-infection stages. Histopathological examinations of galled-root tissues also revealed the susceptibility and resistance responses of selected cultivars of oilseed radish and oat to these nematode species.Oilseed radish and oat are cool season annual crops that are potentially used as "trap" or "biofumigant" crops for the suppression of plant-parasitic nematodes in soil. Cultivars of oilseed radish (Carwoodi, Cardinal, Final, Image, Concorde, Control, Eco-Till, Karakter and Cannavaro), white (Tachiibuki) and black (Pratex) oats were evaluated for their ability to reduce reproduction of three root-knot nematode species: Meloidogyne javanica, M. incognita race 3, and M. arenaria race 1. Nematode penetration and development were also evaluated using selected resistant and susceptible cultivars under greenhouse conditions. Root galling severity, number of eggs per gram of fresh root, and rate of reproduction varied among the cultivars in response to nematode infection. Oilseed radish cv. Carwoodi was resistant to M. javanica, whereas Karakter and Concorde were maintenance hosts allowing the nematode to maintain or increase its population on the plants. For M. incognita, Control and Carwoodi oilseed radish and Tachiibuki oat were resistant hosts. The cultivars that supported little reproduction of M. arenaria were Karakter and Carwoodi radish, and Tachiibuki oat. Comparable numbers of nematodes entered the roots of susceptible and resistant cultivars of oilseed radish and oat during early stages of infection. However, the development of the nematodes as evident from counting young and egg-laying females in roots were significantly decreased or inhibited in the resistant cultivars compared to the susceptible cultivars indicating that resistance occurs at post-infection stages. Histopathological examinations of galled-root tissues also revealed the susceptibility and resistance responses of selected cultivars of oilseed radish and oat to these nematode species.

Characterization of Resistance to Major Tropical Root-Knot Nematodes (Meloidogyne spp.) in Solanum sisymbriifolium.

Root-knot nematodes (Meloidogyne spp.) are important contributors to yield reduction in tomato. Though resistant cultivars to common species (Meloidogyne arenaria, M. incognita, and M. javanica) are available, they are not effective against other major species of root-knot nematodes. Cultivars or lines of Solanum sisymbriifolium were examined to assess the presence and level of resistance to five major species: M. arenaria race 1, M. incognita race 3, M. haplanaria, M. javanica, and M. enterolobii. Differences in S. sisymbriifolium response to the nematode infection were apparent when susceptibility or resistance was classified by the egg counts per gram fresh weight of root and the multiplication rate of the nematodes. The cultivar Diamond was highly susceptible, Quattro and White Star were susceptible, while Sis Syn II was resistant to M. arenaria. Quattro, White Star, and Sis Syn II exhibited a moderate to high level of resistance to M. incognita but the nematode increased 2.5-fold from the initial population of the M. incognita on Diamond. All S. sisymbriifolium cultivars were highly resistant to both M. haplanaria and M. enterolobii, while highly susceptible to M. javanica. A microplot study under field conditions using Sis Syn II confirmed that M. arenaria, M. incognita, and M. haplanaria were not pathogenic on the plant. Likewise, an examination on cross-sections of galled root tissues confirmed the susceptibility and resistance of S. sisymbriifolium lines to Meloidogyne spp. Using S. sisymbriifolium as a resistant rootstock or a new source of resistance may result in the development of nonchemical and sustainable management strategies to protect the tomato crop.

Graphitic carbon nitride (g-C3N4)/graphite nanocomposite as an extraordinarily sensitive sensor for sub-micromolar detection of oxalic acid in biological samples.

Nanosized graphitic carbon nitride (nano-g-C3N4) was synthesized using the thermal polymerization of melamine and utilized as a novel electrocatalyst for electrooxidation of oxalic acid (OA). The nano-g-C3N4 was characterized by Fourier transform infrared spectroscopy (FT-IR), X-ray diffraction (XRD) and field emission scanning electron microscopy (FE-SEM). The electrocatalytic performance of the g-C3N4-modified carbon paste electrode (g-C3N4/CPE) was investigated by cyclic voltammetry and electrochemical impedance spectroscopy (EIS). The modified electrode showed excellent electrocatalytic activity towards the oxidation of OA. The effects of electrode composition, pH and scan rate on the electrooxidation response of OA were studied. Under optimized conditions, the differential pulse voltammetric response of the electrode was linearly related to OA concentrations between 1 and 1000 µM, with a limit of detection (LOD) of 7.5 × 10-7 M. The electrode exhibited very high sensitivity of 1945 µA mM-1 cm-2 for OA assay. The developed method was successfully applied for the determination of OA in urine samples with satisfactory results.

First Report of Stubby-Root Nematode, Paratrichodorus minor, on Onion in Georgia, U.S.A.

Onions ( Allium cepa L.) are the leading vegetable crop in Georgia accounting for 13.7% of total state vegetable production ( Wolfe and Stubbs, 2017 ). In November 2017, two samples each of onion (var. Candy Ann) seedlings and soil were received from the University of Georgia Cooperative Extension office in Tattnall County, GA. The samples were collected from a nursery fumigated with metam sodium and used for sweet onion transplant production. Symptoms of the damaged plants included stunted growth both in the root system and foliage, tip die-back of the leaves ( Fig. 1A,B ), and slight swelling at the tip of roots. Vermiform life stages from the soil samples were extracted using centrifugal-flotation technique ( Jenkins, 1964 ). On an average, 67 stubby-root nematodes per 100 cm 3 of soil were obtained. Additional two soil samples were collected from the nursery in December 2017 to confirm the presence of the nematode. On an average, 1 and 75 nematodes per 100 cm 3 of soil were recovered from areas with healthy and infested plants, respectively. Because the male individuals were not found in the soil samples, females were used for species identification. Morphological and molecular analyses of females ( Fig. 2A-C ) identified the species as Paratrichodorus minor (Colbran) Siddiqi; ( Decraemer, 1995 ). Nematode body shape was "cigar-shaped" with dorsally curved "onchiostyle" stylet Females had an oval-shaped vagina, vulva a transverse slit, and lateral body pores were absent. The measurements of females ( n = 20) included: body length 671.1 (570.1-785.3) µm; body width 32.5 (27.8-37.0) µm; onchiostyle 32.5 (31.1-34.8) µm; anterior end to esophagus-intestinal valve 117.6 (101.2-128.5) µm; a 21.5 (15.3-28.1) µm; b 5.2 (4.9-6.3) µm; V 52.9% (48.1-55.4%) µm; and vagina length 8.7 (7.8-10.7) µm. To confirm the identity of P. minor, DNA was extracted from single females ( n = 3) using Extract-N-Amp ™ Tissue PCR Kit (Sigma-Alredich Inc., St. Louis, MO). The partial 18S rRNA, the D2-D3 expansion segments of 28S rRNA, and ITS1 rDNA were amplified using primer pairs 360F (5' CTACCACATCCAAGGAAGGC 3')/932R (5' TATCTGATCGCTGTCGAACC 3'), D2A (5' ACAAGTACCGTGAGGGAAAGTTG 3')/D3B (5' TCGGAAGGAACCAGCTACTA 3'), and BL18 (5' CCCGTCGCTACTACCGATT 3')/5818 (5' ACGARCCGAGTGATCCAC 3'), respectively ( Riga et al., 2007 ; Duarte et al., 2010 ; Ye et al., 2015 ; Shaver et al., 2016 ). The obtained PCR fragments were purified using QIAquick Gel Extraction Kit (Qiagen Inc., Santa Clara, CA, USA), sequenced and deposited in the GenBank databases (18S rRNA: MG856931; 28S rRNA: MG856933; ITS1 rDNA: MH464152). The 18S rRNA, 28S D2-D3, and ITS1 rDNA sequences shared 99% similarity (100% coverage) with GenBank accessions of P. minor from California, Arkansas, and China (18S rRNA: JN123365; 28S D2-D3: JN123395; ITS1 rDNA: GU645811). In a pathogenicity test, five sweet onion seeds var. Pirate were planted (one per pot) in 11.5-cm-diameter polyethylene pots containing 1,000 cm 3 of equal parts of pasteurized field soil and sand, and then inoculated with 1,000 fresh P. minor . Plants were grown for 9 wk in a greenhouse at 25 ± 2°C prior to extraction of nematodes from soil. Plant roots were abbreviated and final population density of P. minor was 2,856 ± 104 per pot (285 nematodes/100 cm 3 of soil) confirming the nematode parasitism on onion. To our knowledge, this is the first report of P. minor parasitizing onion in Georgia. Stubby-root nematode ( Paratrichodorus sp.) has already been reported on corn, St. Augustine grass, and switchgrass in Georgia ( Heald and Perry, 1969 ; Davis and Timper, 2000 ; Mekete et al., 2011 ). In the U.S.A, P. minor is known to occur on diverse crops in most of the states ( Decraemer, 1995 ; CABI/EPPO, 2002 ). A survey of vegetable-producing areas in Georgia is currently under investigation to determine the distribution of this economically important nematode species. Figure 1Damage symptoms caused by stubby-root nematode Paratrichodorus minor on sweet onion in Georgia. A large area of stunted and chlorotic plant foliage (A); Infested seedlings with abbreviated roots and necrotic leaf tips (B). Figure 2Light microscopy micrographs showing morphological characters of stubby-root nematode, Paratrichodorus minor. Entire body (A), anterior end (B), and posterior region (C) of female nematode.

Dientamoeba fragilis diagnosis by fecal screening: relative effectiveness of traditional techniques and molecular methods.

INTRODUCTION: Dientamoeba fragilis, an intestinal trichomonad, occurs in humans with and without gastrointestinal symptoms. Its presence was investigated in individuals referred to Milad Hospital, Tehran. METHODOLOGY: In a cross-sectional study, three time-separated fecal samples were collected from 200 participants from March through June 2011. Specimens were examined using traditional techniques for detecting D. fragilis and other gastrointestinal parasites: direct smear, culture, formalin-ether concentration, and iron-hematoxylin staining. The presence of D. fragilis was determined using PCR assays targeting 5.8S rRNA or small subunit ribosomal RNA. RESULTS: Dientamoeba fragilis, Blastocystis sp., Giardia lamblia, Entamoeba coli, and Iodamoeba butschlii were detected by one or more traditional and molecular methods, with an overall prevalence of 56.5%. Dientamoeba was not detected by direct smear or formalin-ether concentration but was identified in 1% and 5% of cases by culture and iron-hematoxylin staining, respectively. PCR amplification of SSU rRNA and 5.8S rRNA genes diagnosed D. fragilis in 6% and 13.5%, respectively. Prevalence of D. fragilis was unrelated to participant gender, age, or gastrointestinal symptoms. CONCLUSIONS: This is the first report of molecular assays to screen for D. fragilis in Iran. The frequent finding of D. fragilis via fecal analysis indicated the need to include this parasite in routine stool examination in diagnostic laboratories. As the length of amplification target correlates to the sensitivity of PCR, this assay targeting the D. fragilis 5.8S rRNA gene seems optimal for parasite detection and is recommended in combination with conventional microscopy for diagnosing intestinal parasites.

Determination of subnanomolar levels of mercury (II) by using a graphite paste electrode modified with MWCNTs and Hg(II)-imprinted polymer nanoparticles.

Mercury ion-imprinted polymer nanoparticles (Hg-IP-NPs) were synthesized via precipitation polymerization by using itaconic acid as a functional monomer. A carbon paste electrode was impregnated with the synthesized Hg-IP-NPs and MWCNTs to obtain a highly sensitive and selective electrode for determination of Hg(II). Mercury ion is first accumulated on the electrode surface via an open circuit procedure. After reduction of Hg(II) ions to its metallic form at a negative pre-potential, square wave anodic stripping voltammetry was applied to generate the electrochemical signal. The high affinity of the Hg-IP-NPs for Hg(II) was substantiated by comparing of the signals of electrodes with imprinted and non-imprinted polymer. The beneficial effect of MWCNTs on the voltammetric signal is also demonstrated. Under the optimized conditions and at a typical working potential of +0.05 V (vs. Ag/AgCl), the electrode has a linear response in the 0.1-20 nmol L-1 Hg(II) concentration range and a 29 pM detection limit. The electrochemical sensitivity is as high as 1441 A·M-1·cm-2 which is among the best values known. The electrode was applied to the determination of Hg(II) in water samples. Graphical abstract Schematic representation of the sensor electrode modified with mercury-imprinted polymer nanoparticles, and the recognition and voltammetric determination steps.