Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 90
Filtrar
1.
Front Plant Sci ; 15: 1435632, 2024.
Artigo em Inglês | MEDLINE | ID: mdl-39290740

RESUMO

Various species of rhizobium establish compatible symbiotic relationships with soybean (Glycine max) leading to the formation of nitrogen-fixing nodules in roots. The formation of functional nodules is mediated through complex developmental and transcriptional reprogramming that involves the activity of thousands of plant genes. However, host transcriptome that differentiate between functional or non-functional nodules remain largely unexplored. In this study, we investigated differential compatibilities between rhizobium strains (Bradyrhizobium diazoefficiens USDA110 Bradyrhizobium sp. strain LVM105) and cultivated and wild soybeans. The nodulation assays revealed that both USDA110 and LVM105 strains effectively nodulate G. soja but only USDA110 can form symbiotic relationships with Williams 82. LVM105 formed pseudonodules on Williams 82 that consist of a central nodule-like mass that are devoid of any rhizobia. RNA-seq data revealed that USDA110 and LVM105 induce distinct transcriptome programing in functional mature nodules formed on G. soja roots, where genes involved in nucleosome assembly, DNA replication, regulation of cell cycle, and defense responses play key roles. Transcriptome comparison also suggested that activation of genes associated with cell wall biogenesis and organization and defense responses together with downregulation of genes involved in the biosynthesis of isoprenoids and antioxidant stress are associated with the formation of non-functional nodules on Williams 82 roots. Moreover, our analysis implies that increased activity of genes involved in oxygen binding, amino acid transport, and nitrate transport differentiates between fully-developed nodules in cultivated versus wild soybeans.

2.
Hortic Res ; 11(9): uhae206, 2024 Sep.
Artigo em Inglês | MEDLINE | ID: mdl-39286358

RESUMO

Root-knot nematodes (Meloidogyne spp.) are widely spread root parasites that infect thousands of vascular plant species. These highly polyphagous nematodes engage in sophisticated interactions with host plants that results in the formation of knot-like structures known as galls whose ontogeny remains largely unknown. Here, we determined transcriptome changes and alternative splicing variants induced by Megalaima incognita in galls and neighboring root cells at two distinct infective stages. M. incognita induced substantial transcriptome changes in tomato roots both locally in galls and systemically in neighboring cells. A considerable parallel regulation of gene expression in galls and neighboring cells were detected, indicative of effective intercellular communications exemplified by suppression of basal defense responses particularly during the early stage of infection. The transcriptome analysis also revealed that M. incognita exerts a tight control over the cell cycle process as a whole that results in an increase of ploidy levels in the feeding sites and accelerated mitotic activity of the gall cells. Alternative splicing analysis indicated that M. incognita significantly modulates pre-mRNA splicing as a total of 9064 differentially spliced events from 2898 genes were identified where intron retention and exon skipping events were largely suppressed. Furthermore, a number of differentially spliced events were functionally validated using transgenic hairy root system and found to impact gall formation and nematode egg mass production. Together, our data provide unprecedented insights into the transcriptome and spliceome reprogramming induced by M. incognita in tomato with respect to gall ontogeny and nematode parasitism.

3.
Mol Plant Pathol ; 25(5): e13461, 2024 May.
Artigo em Inglês | MEDLINE | ID: mdl-38695657

RESUMO

Mitogen-activated protein kinase (MPK) cascades play central signalling roles in plant immunity and stress response. The soybean orthologue of MPK kinase2 (GmMKK2) was recently identified as a potential signalling node whose expression is upregulated in the feeding site induced by soybean cyst nematode (SCN, Heterodera glycines). To investigate the role of GmMKK2 in soybean-SCN interactions, we overexpressed a catabolically inactive variant referred to as kinase-dead variant (KD-GmMKK2) using transgenic hairy roots. KD-GmMKK2 overexpression caused significant reduction in soybean susceptibility to SCN, while overexpression of the wild-type variant (WT-GmMKK2) exhibited no effect on susceptibility. Transcriptome analysis indicated that KD-GmMKK2 overexpressing plants are primed for SCN resistance via constitutive activation of defence signalling, particularly those related to chitin, respiratory burst, hydrogen peroxide and salicylic acid. Phosphoproteomic profiling of the WT-GmMKK2 and KD-GmMKK2 root samples upon SCN infection resulted in the identification of 391 potential targets of GmMKK2. These targets are involved in a broad range of biological processes, including defence signalling, vesicle fusion, chromatin remodelling and nuclear organization among others. Furthermore, GmMKK2 mediates phosphorylation of numerous transcriptional and translational regulators, pointing to the presence of signalling shortcuts besides the canonical MAPK cascades to initiate downstream signalling that eventually regulates gene expression and translation initiation. Finally, the functional requirement of specific phosphorylation sites for soybean response to SCN infection was validated by overexpressing phospho-mimic and phospho-dead variants of two differentially phosphorylated proteins SUN1 and IDD4. Together, our analyses identify GmMKK2 impacts on signalling modules that regulate soybean response to SCN infection.


Assuntos
Glycine max , Doenças das Plantas , Transdução de Sinais , Tylenchoidea , Glycine max/parasitologia , Glycine max/genética , Animais , Doenças das Plantas/parasitologia , Doenças das Plantas/genética , Tylenchoidea/fisiologia , Tylenchoidea/patogenicidade , Regulação da Expressão Gênica de Plantas , Plantas Geneticamente Modificadas , Raízes de Plantas/parasitologia , Raízes de Plantas/metabolismo , Raízes de Plantas/genética , Proteínas de Plantas/metabolismo , Proteínas de Plantas/genética , Resistência à Doença/genética
4.
Plant Cell Rep ; 43(6): 138, 2024 May 11.
Artigo em Inglês | MEDLINE | ID: mdl-38733408

RESUMO

KEY MESSAGE: The soybean gene GmSABP2-1 encodes methyl salicylate esterase and its overexpression led to significant reduction in development of pathogenic soybean cyst nematode. Soybean cyst nematode (SCN, Heterodera glycines) is one of the most devastating pests of soybean (Glycine max L. Merr.). In searching for SCN-defense genes, a soybean gene of the methylesterase (MES) family was found to be upregulated in an SCN-resistant soybean line and downregulated in an SCN-susceptible line upon SCN infection. This gene was designated as GmSABP2-1. Here, we report on biochemical and overexpression studies of GmSABP2-1 to examine its possible function in SCN resistance. The protein encoded by GmSABP2-1 is closely related to known methyl salicylate esterases. To determine the biochemical function of GmSABP2-1, a full-length cDNA of GmSABP2-1 was cloned into a protein expression vector and expressed in Escherichia coli. The resulting recombinant GmSABP2-1 was demonstrated to catalyze the demethylation of methyl salicylate. The biochemical properties of GmSABP2-1 were determined. Its apparent Km value was 46.2 ± 2.2 µM for methyl salicylate, comparable to those of the known methyl salicylate esterases. To explore the biological significance of GmSABP2-1 in soybean defense against SCN, we first overexpressed GmSABP2-1 in transgenic hairy roots of an SCN-susceptible soybean line. When infected with SCN, GmSABP2-1-overexpressing hairy roots showed 84.5% reduction in the development of SCN beyond J2 stage. To provide further genetic evidence for the role of GmSABP2-1 in SCN resistance, stable transgenic soybean plants overexpressing GmSABP2-1 were produced. Analysis of the GmSABP2-1-overexpressing lines showed a significant reduction in SCN development compared to non-transgenic plants. In conclusion, we demonstrated that GmSABP2-1 encodes methyl salicylate esterase and functions as a resistance-related gene against SCN.


Assuntos
Glycine max , Doenças das Plantas , Salicilatos , Tylenchoidea , Animais , Hidrolases de Éster Carboxílico/metabolismo , Hidrolases de Éster Carboxílico/genética , Resistência à Doença/genética , Regulação da Expressão Gênica de Plantas , Glycine max/genética , Glycine max/parasitologia , Doenças das Plantas/parasitologia , Doenças das Plantas/genética , Proteínas de Plantas/genética , Proteínas de Plantas/metabolismo , Plantas Geneticamente Modificadas , Salicilatos/metabolismo , Tylenchoidea/fisiologia , Tylenchoidea/patogenicidade
5.
Annu Rev Phytopathol ; 62(1): 173-192, 2024 Sep.
Artigo em Inglês | MEDLINE | ID: mdl-38691872

RESUMO

Alternative splicing (AS) is an evolutionarily conserved cellular process in eukaryotes in which multiple messenger RNA (mRNA) transcripts are produced from a single gene. The concept that AS adds to transcriptome complexity and proteome diversity introduces a new perspective for understanding how phytopathogen-induced alterations in host AS cause diseases. Recently, it has been recognized that AS represents an integral component of the plant immune system during parasitic, commensalistic, and symbiotic interactions. Here, I provide an overview of recent progress detailing the reprogramming of plant AS by phytopathogens and the functional implications on disease phenotypes. Additionally, I discuss the vital function of AS of immune receptors in regulating plant immunity and how phytopathogens use effector proteins to target key components of the splicing machinery and exploit alternatively spliced variants of immune regulators to negate defense responses. Finally, the functional association between AS and nonsense-mediated mRNA decay in the context of plant-pathogen interface is recapitulated.


Assuntos
Processamento Alternativo , Interações Hospedeiro-Patógeno , Doenças das Plantas , Doenças das Plantas/microbiologia , Doenças das Plantas/imunologia , RNA Mensageiro/metabolismo , RNA Mensageiro/genética , Imunidade Vegetal/genética , Plantas/microbiologia , Plantas/imunologia
6.
Methods Mol Biol ; 2756: 327-341, 2024.
Artigo em Inglês | MEDLINE | ID: mdl-38427303

RESUMO

Epigenetic modifications including miRNA regulation, DNA methylation, and histone modifications play fundamental roles in establishing the interactions between host plants and parasitic nematodes. Over the past decade, an increasing number of studies revealed the key functions of various components of the plant epigenome in the regulation of gene expression and shaping plant responses to nematode infection. In this chapter, we provide a conceptual framework for methods used to investigate epigenetic regulation during plant-nematode interactions. We focus specifically on current and emerging methods used to study miRNA regulation and function. We also highlight various methods and analytical tools used to profile DNA methylation patterns and histone modification marks at the genome level. Our intention is simply to explain the advantages of various methods and how to overcome some limitations. With rapid development of single-cell sequencing technology and genome editing, advanced and new methodologies are expected to emerge in the near future to further improve our understanding of epigenetic regulation and function during plant-nematode interactions.


Assuntos
MicroRNAs , Tylenchoidea , Animais , Epigênese Genética , Doenças das Plantas/genética , Plantas/genética , Plantas/parasitologia , Metilação de DNA , MicroRNAs/genética , Tylenchoidea/fisiologia
7.
Front Plant Sci ; 14: 1186292, 2023.
Artigo em Inglês | MEDLINE | ID: mdl-37324708

RESUMO

Soybean (Glycine max) is an important crop in agricultural production where water shortage limits yields in soybean. Root system plays important roles in water-limited environments, but the underlying mechanisms are largely unknown. In our previous study, we produced a RNA-seq dataset generated from roots of soybean at three different growth stages (20-, 30-, and 44-day-old plants). In the present study, we performed a transcriptome analysis of the RNA-seq data to select candidate genes with probable association with root growth and development. Candidate genes were functionally examined in soybean by overexpression of individual genes using intact soybean composite plants with transgenic hairy roots. Root growth and biomass in the transgenic composite plants were significantly increased by overexpression of the GmNAC19 and GmGRAB1 transcriptional factors, showing up to 1.8-fold increase in root length and/or 1.7-fold increase in root fresh/dry weight. Furthermore, greenhouse-grown transgenic composite plants had significantly higher seed yield by about 2-fold than control plants. Expression profiling in different developmental stages and tissues showed that GmNAC19 and GmGRAB1 were most highly expressed in roots, displaying a distinct root-preferential expression. Moreover, we found that under water-deficit conditions, overexpression of GmNAC19 enhanced water stress tolerance in transgenic composite plants. Taken together, these results provide further insights into the agricultural potential of these genes for development of soybean cultivars with improved root growth and enhanced tolerance to water-deficit conditions.

8.
New Phytol ; 239(6): 2335-2352, 2023 09.
Artigo em Inglês | MEDLINE | ID: mdl-37337845

RESUMO

BAK1-INTERACTING RECEPTOR LIKE KINASE1 (BIR1) is a negative regulator of various aspects of disease resistance and immune responses. Here, we investigated the functional role of soybean (Glycine max) BIR1 (GmBIR1) during soybean interaction with soybean cyst nematode (SCN, Heterodera glycines) and the molecular mechanism through which GmBIR1 regulates plant immunity. Overexpression of wild-type variant of GmBIR1 (WT-GmBIR1) using transgenic soybean hairy roots significantly increased soybean susceptibility to SCN, whereas overexpression of kinase-dead variant (KD-GmBIR1) significantly increased plant resistance. Transcriptome analysis revealed that genes oppositely regulated in WT-GmBIR1 and KD-GmBIR1 upon SCN infection were enriched primarily in defense and immunity-related functions. Quantitative phosphoproteomic analysis identified 208 proteins as putative substrates of the GmBIR1 signaling pathway, 114 of which were differentially phosphorylated upon SCN infection. In addition, the phosphoproteomic data pointed to a role of the GmBIR1 signaling pathway in regulating alternative pre-mRNA splicing. Genome-wide analysis of splicing events provided compelling evidence supporting a role of the GmBIR1 signaling pathway in establishing alternative splicing during SCN infection. Our results provide novel mechanistic insights into the function of the GmBIR1 signaling pathway in regulating soybean transcriptome and spliceome via differential phosphorylation of splicing factors and regulation of splicing events of pre-mRNA decay- and spliceosome-related genes.


Assuntos
Infecções por Nematoides , Tylenchoidea , Animais , Transcriptoma/genética , Glycine max/genética , Glycine max/metabolismo , Perfilação da Expressão Gênica , Doenças das Plantas/genética , Tylenchoidea/fisiologia
9.
Mol Plant Pathol ; 24(6): 628-636, 2023 06.
Artigo em Inglês | MEDLINE | ID: mdl-36975024

RESUMO

Gene co-expression network analysis is an efficient systems biology approach for the discovery of novel gene functions and trait-associated gene modules. To identify clusters of functionally related genes involved in soybean nodule formation and development, we performed a weighted gene co-expression network analysis. Two nodule-specific modules (NSM-1 and NSM-2, containing 304 and 203 genes, respectively) were identified. The NSM-1 gene promoters were significantly enriched in cis-binding elements for ERF, MYB, and C2H2-type zinc transcription factors, whereas NSM-2 gene promoters were enriched in cis-binding elements for TCP, bZIP, and bHLH transcription factors, suggesting a role of these regulatory factors in the transcriptional activation of nodule co-expressed genes. The co-expressed gene modules included genes with potential novel roles in nodulation, including those involved in xylem development, transmembrane transport, the ethylene signalling pathway, cytoskeleton organization, cytokinesis and regulation of the cell cycle, regulation of meristem initiation and growth, transcriptional regulation, DNA methylation, and histone modifications. Functional analysis of two co-expressed genes using TILLING mutants provided novel insight into the involvement of unsaturated fatty acid biosynthesis and folate metabolism in nodule formation and development. The identified gene co-expression modules provide valuable resources for further functional genomics studies to dissect the genetic basis of nodule formation and development in soybean.


Assuntos
Redes Reguladoras de Genes , Glycine max , Glycine max/genética , Regulação da Expressão Gênica de Plantas/genética , Perfilação da Expressão Gênica , Fatores de Transcrição/genética
10.
Front Plant Sci ; 14: 1129454, 2023.
Artigo em Inglês | MEDLINE | ID: mdl-36875574

RESUMO

Trypsin inhibitors (TIs) are widely distributed in plants and are known to play a protective role against herbivores. TIs reduce the biological activity of trypsin, an enzyme involved in the breakdown of many different proteins, by inhibiting the activation and catalytic reactions of proteins. Soybean (Glycine max) contains two major TI classes: Kunitz trypsin inhibitor (KTI) and Bowman-Birk inhibitor (BBI). Both genes encoding TI inactivate trypsin and chymotrypsin enzymes, which are the main digestive enzymes in the gut fluids of Lepidopteran larvae feeding on soybean. In this study, the possible role of soybean TIs in plant defense against insects and nematodes was investigated. A total of six TIs were tested, including three known soybean trypsin inhibitors (KTI1, KTI2 and KTI3) and three genes encoding novel inhibitors identified in soybean (KTI5, KTI7, and BBI5). Their functional role was further examined by overexpression of the individual TI genes in soybean and Arabidopsis. The endogenous expression patterns of these TI genes varied among soybean tissues, including leaf, stem, seed, and root. In vitro enzyme inhibitory assays showed significant increase in trypsin and chymotrypsin inhibitory activities in both transgenic soybean and Arabidopsis. Detached leaf-punch feeding bioassays detected significant reduction in corn earworm (Helicoverpa zea) larval weight when larvae fed on transgenic soybean and Arabidopsis lines, with the greatest reduction observed in KTI7 and BBI5 overexpressing lines. Whole soybean plant greenhouse feeding bioassays with H. zea on KTI7 and BBI5 overexpressing lines resulted in significantly reduced leaf defoliation compared to non-transgenic plants. However, bioassays of KTI7 and BBI5 overexpressing lines with soybean cyst nematode (SCN, Heterodera glycines) showed no differences in SCN female index between transgenic and non-transgenic control plants. There were no significant differences in growth and productivity between transgenic and non-transgenic plants grown in the absence of herbivores to full maturity under greenhouse conditions. The present study provides further insight into the potential applications of TI genes for insect resistance improvement in plants.

11.
Nat Commun ; 13(1): 6190, 2022 10 19.
Artigo em Inglês | MEDLINE | ID: mdl-36261416

RESUMO

Plant-parasitic nematodes are a major threat to crop production in all agricultural systems. The scarcity of classical resistance genes highlights a pressing need to find new ways to develop nematode-resistant germplasm. Here, we sequence and assemble a high-quality phased genome of the model cyst nematode Heterodera schachtii to provide a platform for the first system-wide dual analysis of host and parasite gene expression over time, covering all major parasitism stages. Analysis of the hologenome of the plant-nematode infection site identified metabolic pathways that were incomplete in the parasite but complemented by the host. Using a combination of bioinformatic, genetic, and biochemical approaches, we show that a highly atypical completion of vitamin B5 biosynthesis by the parasitic animal, putatively enabled by a horizontal gene transfer from a bacterium, is required for full pathogenicity. Knockout of either plant-encoded or now nematode-encoded steps in the pathway significantly reduces parasitic success. Our experiments establish a reference for cyst nematodes, further our understanding of the evolution of plant-parasitism by nematodes, and show that congruent differential expression of metabolic pathways in the infection hologenome represents a new way to find nematode susceptibility genes. The approach identifies genome-editing-amenable targets for future development of nematode-resistant crops.


Assuntos
Cistos , Parasitos , Tylenchida , Animais , Ácido Pantotênico , Transcriptoma
12.
Mol Plant Pathol ; 23(12): 1765-1782, 2022 12.
Artigo em Inglês | MEDLINE | ID: mdl-36069343

RESUMO

Plant-parasitic cyst nematodes use a stylet to deliver effector proteins produced in oesophageal gland cells into root cells to cause disease in plants. These effectors are deployed to modulate plant defence responses and developmental programmes for the formation of a specialized feeding site called a syncytium. The Hg2D01 effector gene, coding for a novel 185-amino-acid secreted protein, was previously shown to be up-regulated in the dorsal gland of parasitic juveniles of the soybean cyst nematode Heterodera glycines, but its function has remained unknown. Genome analyses revealed that Hg2D01 belongs to a highly diversified effector gene family in the genomes of H. glycines and the sugar beet cyst nematode Heterodera schachtii. For functional studies using the model Arabidopsis thaliana-H. schachtii pathosystem, we cloned the orthologous Hs2D01 sequence from H. schachtii. We demonstrate that Hs2D01 is a cytoplasmic effector that interacts with the intracellular kinase domain of HAESA (HAE), a cell surface-associated leucine-rich repeat (LRR) receptor-like kinase (RLK) involved in signalling the activation of cell wall-remodelling enzymes important for cell separation during abscission and lateral root emergence. Furthermore, we show that AtHAE is expressed in the syncytium and, therefore, could serve as a viable host target for Hs2D01. Infective juveniles effectively penetrated the roots of HAE and HAESA-LIKE2 (HSL2) double mutant plants; however, fewer nematodes developed on the roots, consistent with a role for this receptor family in nematode infection. Taken together, our results suggest that the Hs2D01-AtHAE interaction may play an important role in sugar beet cyst nematode parasitism.


Assuntos
Proteínas de Arabidopsis , Arabidopsis , Beta vulgaris , Cistos , Tylenchoidea , Animais , Arabidopsis/metabolismo , Beta vulgaris/metabolismo , Proteínas de Arabidopsis/genética , Proteínas de Arabidopsis/metabolismo , Tylenchoidea/genética , Tylenchoidea/metabolismo , Açúcares/metabolismo , Raízes de Plantas/parasitologia , Doenças das Plantas/genética , Regulação da Expressão Gênica de Plantas , Proteínas Serina-Treonina Quinases
13.
Front Plant Sci ; 13: 988048, 2022.
Artigo em Inglês | MEDLINE | ID: mdl-36160998

RESUMO

We previously identified cis-regulatory motifs in the soybean (Glycine max) genome during interaction between soybean and soybean cyst nematode (SCN), Heterodera glycines. The regulatory motifs were used to develop synthetic promoters, and their inducibility in response to SCN infection was shown in transgenic soybean hairy roots. Here, we studied the functionality of two SCN-inducible synthetic promoters; 4 × M1.1 (TAAAATAAAGTTCTTTAATT) and 4 × M2.3 (ATATAATTAAGT) each fused to the -46 CaMV35S core sequence in transgenic soybean. Histochemical GUS analyses of transgenic soybean plants containing the individual synthetic promoter::GUS construct revealed that under unstressed condition, no GUS activity is present in leaves and roots. While upon nematode infection, the synthetic promoters direct GUS expression to roots predominantly in the nematode feeding structures induced by the SCN and by the root-knot nematode (RKN), Meloidogyne incognita. There were no differences in GUS activity in leaves between nematode-infected and non-infected plants. Furthermore, we examined the specificity of the synthetic promoters in response to various biotic (insect: fall armyworm, Spodoptera frugiperda; and bacteria: Pseudomonas syringe pv. glycinea, P. syringe pv. tomato, and P. marginalis) stresses. Additionally, we examined the specificity to various abiotic (dehydration, salt, cold, wounding) as well as to the signal molecules salicylic acid (SA), methyl jasmonate (MeJA), and abscisic acid (ABA) in the transgenic plants. Our wide-range analyses provide insights into the potential applications of synthetic promoter engineering for conditional expression of transgenes leading to transgenic crop development for resistance improvement in plant.

14.
Plant Physiol ; 189(4): 2432-2453, 2022 08 01.
Artigo em Inglês | MEDLINE | ID: mdl-35579365

RESUMO

Despite the known critical regulatory functions of microRNAs, histone modifications, and DNA methylation in reprograming plant epigenomes in response to pathogen infection, the molecular mechanisms underlying the tight coordination of these components remain poorly understood. Here, we show how Arabidopsis (Arabidopsis thaliana) miR778 coordinately modulates the root transcriptome, histone methylation, and DNA methylation via post-transcriptional regulation of the H3K9 methyltransferases SU(var)3-9 homolog 5 (SUVH5) and SUVH6 upon infection by the beet cyst nematode Heterodera schachtii. miR778 post-transcriptionally silences SUVH5 and SUVH6 upon nematode infection. Manipulation of the expression of miR778 and its two target genes significantly altered plant susceptibility to H. schachtii. RNA-seq analysis revealed a key role of SUVH5 and SUVH6 in reprograming the transcriptome of Arabidopsis roots upon H. schachtii infection. In addition, chromatin immunoprecipitation (ChIP)-seq analysis established SUVH5 and SUVH6 as the main enzymes mediating H3K9me2 deposition in Arabidopsis roots in response to nematode infection. ChIP-seq analysis also showed that these methyltransferases possess distinct DNA binding preferences in that they are targeting transposable elements under noninfected conditions and protein-coding genes in infected plants. Further analyses indicated that H3K9me2 deposition directed by SUVH5 and SUVH6 contributes to gene expression changes both in roots and in nematode feeding sites and preferentially associates with CG DNA methylation. Together, our results uncovered multi-layered epigenetic regulatory mechanisms coordinated by miR778 during Arabidopsis-H. schachtii interactions.


Assuntos
Proteínas de Arabidopsis , Arabidopsis , Cistos , Tylenchoidea , Animais , Arabidopsis/metabolismo , Proteínas de Arabidopsis/genética , Proteínas de Arabidopsis/metabolismo , Cistos/genética , Cistos/metabolismo , Metilação de DNA/genética , Expressão Gênica , Regulação da Expressão Gênica de Plantas , Código das Histonas , Metiltransferases/metabolismo , Doenças das Plantas/genética , Raízes de Plantas/genética , Raízes de Plantas/metabolismo
15.
Front Plant Sci ; 13: 1111623, 2022.
Artigo em Inglês | MEDLINE | ID: mdl-36704169

RESUMO

A growing body of evidence indicates that epigenetic mechanisms, particularly DNA methylation, play key regulatory roles in plant-nematode interactions. Nevertheless, the transcriptional activity of key genes mediating DNA methylation and active demethylation in the nematode feeding sites remains largely unknown. Here, we profiled the promoter activity of 12 genes involved in maintenance and de novo establishment of DNA methylation and active demethylation in the syncytia and galls induced respectively by the cyst nematode Heterodera schachtii and the root-knot nematode Meloidogyne incognita in Arabidopsis roots. The promoter activity assays revealed that expression of the CG-context methyltransferases is restricted to feeding site formation and development stages. Chromomethylase1 (CMT1), CMT2, and CMT3 and Domains Rearranged Methyltransferase2 (DRM2) and DRM3, which mediate non-CG methylation, showed similar and distinct expression patterns in the syncytia and galls at various time points. Notably, the promoters of various DNA demethylases were more active in galls as compared with the syncytia, particularly during the early stage of infection. Mutants impaired in CG or CHH methylation similarly enhanced plant susceptibility to H. schachtii and M. incognita, whereas mutants impaired in CHG methylation reduced plant susceptibility only to M. incognita. Interestingly, hypermethylated mutants defective in active DNA demethylation exhibited contrasting responses to infection by H. schachtii and M. incognita, a finding most likely associated with differential regulation of defense-related genes in these mutants upon nematode infection. Our results point to methylation-dependent mechanisms regulating plant responses to infection by cyst and root-knot nematodes.

16.
Mol Plant Pathol ; 23(3): 417-430, 2022 03.
Artigo em Inglês | MEDLINE | ID: mdl-34851539

RESUMO

Protein kinases phosphorylate proteins for functional changes and are involved in nearly all cellular processes, thereby regulating almost all aspects of plant growth and development, and responses to biotic and abiotic stresses. We generated two independent co-expression networks of soybean genes using control and stress response gene expression data and identified 392 differentially highly interconnected kinase hub genes among the two networks. Of these 392 kinases, 90 genes were identified as "syncytium highly connected hubs", potentially essential for activating kinase signalling pathways in the nematode feeding site. Overexpression of wild-type coding sequences of five syncytium highly connected kinase hub genes using transgenic soybean hairy roots enhanced plant susceptibility to soybean cyst nematode (SCN; Heterodera glycines) Hg Type 0 (race 3). In contrast, overexpression of kinase-dead variants of these five syncytium kinase hub genes significantly enhanced soybean resistance to SCN. Additionally, three of the five tested kinase hub genes enhanced soybean resistance to SCN Hg Type 1.2.5.7 (race 2), highlighting the potential of the kinase-dead approach to generate effective and durable resistance against a wide range of SCN Hg types. Subcellular localization analysis revealed that kinase-dead mutations do not alter protein cellular localization, confirming the structure-function of the kinase-inactive variants in producing loss-of-function phenotypes causing significant decrease in nematode susceptibility. Because many protein kinases are highly conserved and are involved in plant responses to various biotic and abiotic stresses, our approach of identifying kinase hub genes and their inactivation using kinase-dead mutation could be translated for biotic and abiotic stress tolerance.


Assuntos
Cistos , Mercúrio , Tylenchoidea , Animais , Mercúrio/metabolismo , Mutação/genética , Doenças das Plantas/genética , Proteínas Quinases/genética , Proteínas Quinases/metabolismo , Glycine max/genética , Glycine max/metabolismo , Tylenchoidea/fisiologia
17.
Int J Mol Sci ; 22(18)2021 Sep 07.
Artigo em Inglês | MEDLINE | ID: mdl-34575855

RESUMO

DNA methylation and demethylation precisely and effectively modulate gene expression during plant growth and development and in response to stress. However, expression profiles of genes involved in DNA methylation and demethylation during plant development and their responses to phytohormone treatments remain largely unknown. We characterized the spatiotemporal expression patterns of genes involved in de novo methylation, methyl maintenance, and active demethylation in roots, shoots, and reproductive organs using ß-glucuronidase (GUS) reporter lines. Promoters of DNA demethylases were generally more highly active at the mature root tissues, whereas the promoters of genes involved in DNA methylation were more highly active at fast-growing root tissues. The promoter activity also implies that methylation status in shoot apex, leaf primordia, floral organs, and developing embryos is under tight equilibrium through the activity of genes involved in DNA methylation and demethylation. The promoter activity of DNA methylation and demethylation-related genes in response to various phytohormone treatments revealed that phytohormones can alter DNA methylation status in specific and redundant ways. Overall, our results illustrate that DNA methylation and demethylation pathways act synergistically and antagonistically in various tissues and in response to phytohormone treatments and point to the existence of hormone-linked methylome regulation mechanisms that may contribute to tissue differentiation and development.


Assuntos
Metilação de DNA , Regulação da Expressão Gênica de Plantas , Desenvolvimento Vegetal , Reguladores de Crescimento de Plantas/metabolismo , Genes de Plantas , Genes Reporter , Especificidade de Órgãos/genética , Desenvolvimento Vegetal/efeitos dos fármacos , Reguladores de Crescimento de Plantas/farmacologia , Plantas Geneticamente Modificadas , Regiões Promotoras Genéticas
18.
Cells ; 10(5)2021 05 19.
Artigo em Inglês | MEDLINE | ID: mdl-34069320

RESUMO

Soybean is the second largest source of oil worldwide. Developing soybean varieties with high levels of oleic acid is a primary goal of the soybean breeders and industry. Edible oils containing high level of oleic acid and low level of linoleic acid are considered with higher oxidative stability and can be used as a natural antioxidant in food stability. All developed high oleic acid soybeans carry two alleles; GmFAD2-1A and GmFAD2-1B. However, when planted in cold soil, a possible reduction in seed germination was reported when high seed oleic acid derived from GmFAD2-1 alleles were used. Besides the soybean fatty acid desaturase (GmFAD2-1) subfamily, the GmFAD2-2 subfamily is composed of five members, including GmFAD2-2A, GmFAD2-2B, GmFAD2-2C, GmFAD2-2D, and GmFAD2-2E. Segmental duplication of GmFAD2-1A/GmFAD2-1B, GmFAD2-2A/GmFAD2-2C, GmFAD2-2A/GmFAD2-2D, and GmFAD2-2D/GmFAD2-2C have occurred about 10.65, 27.04, 100.81, and 106.55 Mya, respectively. Using TILLING-by-Sequencing+ technology, we successfully identified 12, 8, 10, 9, and 19 EMS mutants at the GmFAD2-2A, GmFAD2-2B, GmFAD2-2C, GmFAD2-2D, and GmFAD2-2E genes, respectively. Functional analyses of newly identified mutants revealed unprecedented role of the five GmFAD2-2A, GmFAD2-2B, GmFAD2-2C, GmFAD2-2D, and GmFAD2-2E members in controlling the seed oleic acid content. Most importantly, unlike GmFAD2-1 members, subcellular localization revealed that members of the GmFAD2-2 subfamily showed a cytoplasmic localization, which may suggest the presence of an alternative fatty acid desaturase pathway in soybean for converting oleic acid content without substantially altering the traditional plastidial/ER fatty acid production.


Assuntos
Análise Mutacional de DNA , Ácidos Graxos Dessaturases/metabolismo , Glycine max/enzimologia , Mutagênese Sítio-Dirigida , Ácido Oleico/metabolismo , Proteínas de Plantas/metabolismo , Plantas Geneticamente Modificadas/enzimologia , Sementes/enzimologia , Ácidos Graxos Dessaturases/genética , Regulação da Expressão Gênica de Plantas , Genótipo , Sequenciamento de Nucleotídeos em Larga Escala , Mutação , Fenótipo , Filogenia , Proteínas de Plantas/genética , Plantas Geneticamente Modificadas/genética , Sementes/genética , Glycine max/genética
19.
Front Mol Biosci ; 8: 616623, 2021.
Artigo em Inglês | MEDLINE | ID: mdl-33928115

RESUMO

DNA methylation has recently emerged as a powerful regulatory mechanism controlling the expression of key regulators of various developmental processes, including nodulation. However, the functional role of DNA methylation in regulating the expression of microRNA (miRNA) genes during the formation and development of nitrogen-fixing nodules remains largely unknown. In this study, we profiled DNA methylation patterns of miRNA genes during nodule formation, development, and early senescence stages in soybean (Glycine max) through the analysis of methylC-seq data. Absolute DNA methylation levels in the CG, CHH, and CHH sequence contexts over the promoter and primary transcript regions of miRNA genes were significantly higher in the nodules compared with the corresponding root tissues at these three distinct nodule developmental stages. We identified a total of 82 differentially methylated miRNAs in the nodules compared with roots. Differential DNA methylation of these 82 miRNAs was detected only in the promoter (69), primary transcript region (3), and both in the promoter and primary transcript regions (10). The large majority of these differentially methylated miRNAs were hypermethylated in nodules compared with the corresponding root tissues and were found mainly in the CHH context and showed stage-specific methylation patterns. Differentially methylated regions in the promoters of 25 miRNAs overlapped with transposable elements, a finding that may explain the vulnerability of miRNAs to DNA methylation changes during nodule development. Gene expression analysis of a set of promoter-differentially methylated miRNAs pointed to a negative association between DNA methylation and miRNA expression. Gene Ontology and pathways analyses indicate that changes in DNA methylation of miRNA genes are reprogrammed and contribute to nodule development through indirect regulation of genes involved in cellular processes and pathways with well-established roles in nodulation.

20.
Plant Genome ; 14(2): e20083, 2021 07.
Artigo em Inglês | MEDLINE | ID: mdl-33724721

RESUMO

Reniform nematode (RN, Rotylenchulus reniformis Linford & Oliveira) has emerged as one of the most important plant parasitic nematodes of soybean [Glycine max (L.) Merr.]. Planting resistant varieties is the most effective strategy for nematode management. The objective of this study was to identify quantitative trait loci (QTL) for RN resistance in an exotic soybean line, PI 438489B, using two linkage maps constructed from the Universal Soybean Linkage Panel (USLP 1.0) and next-generation whole-genome resequencing (WGRS) technology. Two QTL controlling RN resistance were identified-the soybean cyst nematode (SCN, Heterodera glycines) resistance gene GmSNAP18 at the rhg1 locus and its paralog GmSNAP11. Strong association between resistant phenotype and haplotypes of the GmSNAP11 and GmSNAP18 was observed. The results indicated that GmSNAP11 possibly could have epistatic effect on GmSNAP18, or vice versa, with the presence of a significant correlation in RN resistance of rhg1-a GmSNAP18 vs. rhg1-b GmSNAP18. Most importantly, our preliminary data suggested that GmSNAP18 and GmSNAP11 proteins physically interact in planta, suggesting that they belong to the same pathway for resistance. Unlike GmSNAP18, no indication of GmSNAP11 copy number variation was found. Moreover, gene-based single nucleotide polymorphism (SNP) markers were developed for rapid detection of RN or SCN resistance at these loci. Our analysis substantiates synergic interaction between GmSNAP11 and GmSNAP18 genes and confirms their roles in RN as well as SCN resistance. These results could contribute to a better understanding of evolution and subfunctionalization of genes conferring resistance to multiple nematode species and provide a framework for further investigations.


Assuntos
Cistos , Tylenchoidea , Animais , Variações do Número de Cópias de DNA , Resistência à Doença/genética , Doenças das Plantas/genética , Glycine max/genética
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA