Co-overexpression of SWEET sucrose transporters modulates sucrose synthesis and defence responses to enhance immunity against bacterial blight in rice.

Enhancing carbohydrate export from source to sink tissues is considered to be a realistic approach for improving photosynthetic efficiency and crop yield. The rice sucrose transporters OsSUT1, OsSWEET11a and OsSWEET14 contribute to sucrose phloem loading and seed filling. Crucially, Xanthomonas oryzae pv. oryzae (Xoo) infection in rice enhances the expression of OsSWEET11a and OsSWEET14 genes, and causes leaf blight. Here we show that co-overexpression of OsSUT1, OsSWEET11a and OsSWEET14 in rice reduced sucrose synthesis and transport leading to lower growth and yield but reduced susceptibility to Xoo relative to controls. The immunity-related hypersensitive response (HR) was enhanced in the transformed lines as indicated by the increased expression of defence genes, higher salicylic acid content and presence of HR lesions on the leaves. The results suggest that the increased expression of OsSWEET11a and OsSWEET14 in rice is perceived as a pathogen (Xoo) attack that triggers HR and results in constitutive activation of plant defences that are related to the signalling pathways of pathogen starvation. These findings provide a mechanistic basis for the trade-off between plant growth and immunity because decreased susceptibility against Xoo compromised plant growth and yield.

Repeated Low-Level Blast Exposure Alters Urinary and Serum Metabolites.

Repeated exposure to low-level blast overpressures can produce biological changes and clinical sequelae that resemble mild traumatic brain injury (TBI). While recent efforts have revealed several protein biomarkers for axonal injury during repetitive blast exposure, this study aims to explore potential small molecule biomarkers of brain injury during repeated blast exposure. This study evaluated a panel of ten small molecule metabolites involved in neurotransmission, oxidative stress, and energy metabolism in the urine and serum of military personnel (n = 27) conducting breacher training with repeated exposure to low-level blasts. The metabolites were analyzed using HPLC-tandem mass spectrometry, and the Wilcoxon signed-rank test was used for statistical analysis to compare the levels of pre-blast and post-blast exposures. Urinary levels of homovanillic acid (p < 0.0001), linoleic acid (p = 0.0030), glutamate (p = 0.0027), and serum N-acetylaspartic acid (p = 0.0006) were found to be significantly altered following repeated blast exposure. Homovanillic acid concentration decreased continuously with subsequent repeat exposure. These results suggest that repeated low-level blast exposures can produce measurable changes in urine and serum metabolites that may aid in identifying individuals at increased risk of sustaining a TBI. Larger clinical studies are needed to extend the generalizability of these findings.

Molecular analysis of aroma gene (BADH2) in Biriyanicheera: a tropical aromatic rice genotype from Kerala, India.

BACKGROUND: The aromatic rice cultivars sometimes show variation in aroma when they are grown in regions other than their normal traditional growing regions. An early maturing selection from a Kerala aromatic local landrace with short grains, named 'Biriyanicheera', when grown in normal tropical conditions was sufficiently fragrant. The present study focused on the analysis of aroma in 'Biriyanicheera' rice genotype through molecular methods. METHODS AND RESULTS: The seeds of two aromatic rice varieties viz., Biriyanicheera and Gandhakasala (aromatic check) along with one non-aromatic rice variety Triveni (control) were used for the study. The BADH2 gene was amplified in all the three rice varieties. Upon sequencing the amplified PCR products of genomic DNA, the mutation in BADH2 gene was detected. The sequencing results of aromatic rice varieties revealed the presence of 8 base pair mutation in exon 7 in Biriyanicheera and Gandhakasaala, whereas this mutation was absent in the non-aromatic variety Triveni. CONCLUSIONS: Aroma production in Biriyanicheera variety is observed to be due to the similar mutation in BADH2 gene as that of the popular scented rice Basmati.

First report of cucurbit yellow stunting disorder virus and cucurbit chlorotic yellows virus in melon in the Central Valley of California.

In California, the whitefly-transmitted yellowing viruses, cucurbit yellow stunting disorder virus (CYSDV) and cucurbit chlorotic yellows virus (CCYV), both genus Crinivirus, fam. Closteroviridae, have been limited to the Sonoran Desert production regions of Imperial and Riverside counties since their emergence in 2006 and 2014, respectively (Kuo et al., 2007; Wintermantel et al., 2009, 2019) where losses to these viruses have nearly eliminated fall melon production. CYSDV and CCYV have never been identified in the Central Valley, but the aphid-transmitted cucurbit aphid-borne yellows virus (CABYV; genus Polerovirus, fam. Luteoviridae) which produces symptoms nearly identical to those induced by CYSDV and CCYV (Lemaire et al. 1993) is common. As part of a larger study to monitor for whitefly-transmitted yellowing viruses in the southwestern United States, melon leaves exhibiting foliar mottling and interveinal chlorosis beginning near the crown and spreading outward along vines (e-Xtra 1), typical of symptoms caused by yellowing viruses, were collected from 106 melon plants in four commercial fields and a research plot in Fresno County, California, during October 2020. Whiteflies (B. tabaci) were present in all fields and confirmed as MEAM1 (biotype B) by PCR. Total RNA and DNA were extracted separately from the same leaf from each plant to determine the presence of RNA and DNA viruses. Total RNA was extracted as described in Tamang et al. (2021), and was used in RT-PCR with primer sets designed to amplify a 277 nt portion of the CABYV RNA dependent RNA polymerase (RdRp) gene (CABYV RdRp-F - 5' AAGAGCGGCAGCTACAATAC 3', CABYV RdRp-R - 5' TGCCACATTCCGGTTCATAG 3'), and portions of the CCYV and CYSDV RdRp genes encoded on RNA1 of the latter two viruses (Kavalappara et al., 2021). In addition, each CYSDV and CCYV infection was confirmed using a second set of primers that amplified 394 and 372 nt portions of the coat protein gene of each virus, respectively, encoded on RNA2 (Wintermantel et al., 2009; 2019). The 953 nt CCYV RdRp and 394 nt CYSDV CP amplicons were sequenced and found to share greater than 98% sequence identity to CCYV RNA1 (Accession No. MH477611.1) and CYSDV RNA2 (Accession No. LT992901.1), respectively. The CABYV infections were secondarily confirmed using a second set of primers designed to the CP gene (Kassem et al. 2007). Furthermore, four RNA samples from two separate fields that previously tested positive for CYSDV and CABYV and the only CCYV infection were confirmed using a recently developed multiplex RT-qPCR method (Mondal et al. 2021, submitted). Total DNA was extracted using methods described in Mondal et al. (2016) and was used in PCR to test for the presence of the whitefly-transmitted begomovirus, cucurbit leaf crumple virus (CuLCrV) which also occurs in the Sonoran Desert melon production region (Hagen et al, 2008), and is capable of inducing yellowing and leaf curl symptoms in melon. CABYV was by far the most prevalent virus, infecting 34/106 plants tested (32%) among the five fields. Four plants from three fields were infected singly with CYSDV (4%), and three more CYSDV infected plants from two fields were co-infected with CABYV (3%). Only one plant was found to be infected with CCYV as a single virus infection (1%). No triple infections nor any CuLCrV were detected in any of the plants sampled. This is the first report of CYSDV and CCYV in the Central Valley of California. In this survey, although CABYV was the predominant yellowing virus infecting melons in the Central Valley (32%), detection of CYSDV in fields distant from one another and the presence of CCYV even in a single field warrant more extensive monitoring of cucurbit crops and known alternate hosts of these viruses in the Central Valley.

Real-Time Noninvasive Bioluminescence, Ultrasound and Photoacoustic Imaging in NFκB-RE-Luc Transgenic Mice Reveal Glia Maturation Factor-Mediated Immediate and Sustained Spatio-Temporal Activation of NFκB Signaling Post-Traumatic Brain Injury in a Gender-Specific Manner.

Neurotrauma especially traumatic brain injury (TBI) is the leading cause of death and disability worldwide. To improve upon the early diagnosis and develop precision-targeted therapies for TBI, it is critical to understand the underlying molecular mechanisms and signaling pathways. The transcription factor, nuclear factor kappa B (NFκB), which is ubiquitously expressed, plays a crucial role in the normal cell survival, proliferation, differentiation, function, as well as in disease states like neuroinflammation and neurodegeneration. Here, we hypothesized that real-time noninvasive bioluminescence molecular imaging allows rapid and precise monitoring of TBI-induced immediate and rapid spatio-temporal activation of NFκB signaling pathway in response to Glia maturation factor (GMF) upregulation which in turn leads to neuroinflammation and neurodegeneration post-TBI. To test and validate our hypothesis and to gain novel mechanistic insights, we subjected NFκB-RE-Luc transgenic male and female mice to TBI and performed real-time noninvasive bioluminescence imaging (BLI) as well as photoacoustic and ultrasound imaging (PAI). Our BLI data revealed that TBI leads to an immediate and sustained activation of NFκB signaling. Further, our BLI data suggest that especially in male NFκB-RE-Luc transgenic mice subjected to TBI, in addition to brain, there is widespread activation of NFκB signaling in multiple organs. However, in the case of the female NFκB-RE-Luc transgenic mice, TBI induces a very specific and localized activation of NFκB signaling in the brain. Further, our microRNA data suggest that TBI induces significant upregulation of mir-9-5p, mir-21a-5p, mir-34a-5p, mir-16-3p, as well as mir-155-5p within 24 h and these microRNAs can be successfully used as TBI-specific biomarkers. To the best of our knowledge, this is one of the first and unique study of its kind to report immediate and sustained activation of NFκB signaling post-TBI in a gender-specific manner by utilizing real-time non-invasive BLI and PAI in NFκB-RE-Luc transgenic mice. Our study will prove immensely beneficial to gain novel mechanistic insights underlying TBI, unravel novel therapeutic targets, as well as enable us to monitor in real-time the response to innovative TBI-specific precision-targeted gene and stem cell-based precision medicine.

Acute Traumatic Brain Injury-Induced Neuroinflammatory Response and Neurovascular Disorders in the Brain.

Acute traumatic brain injury (TBI) leads to neuroinflammation, neurodegeneration, cognitive decline, psychological disorders, increased blood-brain barrier (BBB) permeability, and microvascular damage in the brain. Inflammatory mediators secreted from activated glial cells, neurons, and mast cells are implicated in the pathogenesis of TBI through secondary brain damage. Abnormalities or damage to the neurovascular unit is the indication of secondary injuries in the brain after TBI. However, the precise mechanisms of molecular and ultrastructural neurovascular alterations involved in the pathogenesis of acute TBI are not yet clearly understood. Moreover, currently, there are no precision-targeted effective treatment options to prevent the sequelae of TBI. In this study, mice were subjected to closed head weight-drop-induced acute TBI and evaluated neuroinflammatory and neurovascular alterations in the brain by immunofluorescence staining or quantitation by enzyme-linked immunosorbent assay (ELISA) procedure. Mast cell stabilizer drug cromolyn was administered to inhibit the neuroinflammatory response of TBI. Results indicate decreased level of pericyte marker platelet-derived growth factor receptor-beta (PDGFR-ß) and BBB-associated tight junction proteins junctional adhesion molecule-A (JAM-A) and zonula occludens-1 (ZO-1) in the brains 7 days after weight-drop-induced acute TBI as compared with the brains from sham control mice indicating acute TBI-associated BBB/tight junction protein disruption. Further, the administration of cromolyn drug significantly inhibited acute TBI-associated decrease of PDGFR-ß, JAM-A, and ZO-1 in the brain. These findings suggest that acute TBI causes BBB/tight junction damage and that cromolyn administration could protect this acute TBI-induced brain damage as well as its long-time consequences.

Glia Maturation Factor (GMF) Regulates Microglial Expression Phenotypes and the Associated Neurological Deficits in a Mouse Model of Traumatic Brain Injury.

Traumatic brain injury (TBI) induces inflammatory responses through microglial activation and polarization towards a more inflammatory state that contributes to the deleterious secondary brain injury. Glia maturation factor (GMF) is a pro-inflammatory protein that is responsible for neuroinflammation following insult to the brain, such as in TBI. We hypothesized that the absence of GMF in GMF-knockout (GMF-KO) mice would regulate microglial activation state and the M1/M2 phenotypes following TBI. We used the weight drop model of TBI in C57BL/6 mice wild-type (WT) and GMF-KO mice. Immunofluorescence staining, Western blot, and ELISA assays were performed to confirm TBI-induced histopathological and neuroinflammatory changes. Behavioral analysis was done to check motor coordination ability and cognitive function. We demonstrated that the deletion of GMF in GMF-KO mice significantly limited lesion volume, attenuated neuronal loss, inhibited gliosis, and activated microglia adopted predominantly anti-inflammatory (M2) phenotypes. Using an ELISA method, we found a gradual decrease in pro-inflammatory cytokines (TNF-α and IL-6) and upregulation of anti-inflammatory cytokines (IL-4 and IL-10) in GMF-KO mice compared with WT mice, thus, promoting the transition of microglia towards a more predominantly anti-inflammatory (M2) phenotype. GMF-KO mice showed significant improvement in motor ability, memory, and cognition. Overall, our results demonstrate that GMF deficiency regulates microglial polarization, which ameliorates neuronal injury and behavioral impairments following TBI in mice and concludes that GMF is a regulator of neuroinflammation and an ideal therapeutic target for the treatment of TBI.

Mast Cell Activation, Neuroinflammation, and Tight Junction Protein Derangement in Acute Traumatic Brain Injury.

Traumatic brain injury (TBI) is one of the major health problems worldwide that causes death or permanent disability through primary and secondary damages in the brain. TBI causes primary brain damage and activates glial cells and immune and inflammatory cells, including mast cells in the brain associated with neuroinflammatory responses that cause secondary brain damage. Though the survival rate and the neurological deficiencies have shown significant improvement in many TBI patients with newer therapeutic options, the underlying pathophysiology of TBI-mediated neuroinflammation, neurodegeneration, and cognitive dysfunctions is understudied. In this study, we analyzed mast cells and neuroinflammation in weight drop-induced TBI. We analyzed mast cell activation by toluidine blue staining, serum chemokine C-C motif ligand 2 (CCL2) level by enzyme-linked immunosorbent assay (ELISA), and proteinase-activated receptor-2 (PAR-2), a mast cell and inflammation-associated protein, vascular endothelial growth factor receptor 2 (VEGFR2), and blood-brain barrier tight junction-associated claudin 5 and Zonula occludens-1 (ZO-1) protein expression in the brains of TBI mice. Mast cell activation and its numbers increased in the brains of 24 h and 72 h TBI when compared with sham control brains without TBI. Mouse brains after TBI show increased CCL2, PAR-2, and VEGFR2 expression and derangement of claudin 5 and ZO-1 expression as compared with sham control brains. TBI can cause mast cell activation, neuroinflammation, and derangement of tight junction proteins associated with increased BBB permeability. We suggest that inhibition of mast cell activation can suppress neuroimmune responses and glial cell activation-associated neuroinflammation and neurodegeneration in TBI.

Simultaneous Determination of Eight Urinary Metabolites by HPLC-MS/MS for Noninvasive Assessment of Traumatic Brain Injury.

Traumatic brain injury (TBI) is a serious public health concern for which sensitive and objective diagnostic methods remain lacking. While advances in neuroimaging have improved diagnostic capabilities, the complementary use of molecular biomarkers can provide clinicians with additional insight into the nature and severity of TBI. In this study, a panel of eight metabolites involved in distinct pathophysiological processes related to concussion was quantified using high-performance liquid chromatography-tandem mass spectrometry (HPLC-MS/MS). Specifically, the newly developed method can simultaneously determine urinary concentrations of glutamic acid, homovanillic acid, 5-hydroxyindoleacetic acid, methionine sulfoxide, lactic acid, pyruvic acid, N-acetylaspartic acid, and F2α-isoprostane without intensive sample preparation or preconcentration. The method was systematically validated to assess sensitivity (method detection limits: 1-20 µg/L), accuracy (81-124% spike recoveries in urine), and reproducibility (relative standard deviation: 4-12%). The method was ultimately applied to a small cohort of urine specimens obtained from healthy college student volunteers. The method presented here provides a new technique to facilitate future work aiming to assess the clinical efficacy of these putative biomarkers for noninvasive assessment of TBI.

COVID-19, Mast Cells, Cytokine Storm, Psychological Stress, and Neuroinflammation.

Coronavirus disease 2019 (COVID-19) caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is a new pandemic infectious disease that originated in China. COVID-19 is a global public health emergency of international concern. COVID-19 causes mild to severe illness with high morbidity and mortality, especially in preexisting risk groups. Therapeutic options are now limited to COVID-19. The hallmark of COVID-19 pathogenesis is the cytokine storm with elevated levels of interleukin-6 (IL-6), IL-1ß, tumor necrosis factor-alpha (TNF-α), chemokine (C-C-motif) ligand 2 (CCL2), and granulocyte-macrophage colony-stimulating factor (GM-CSF). COVID-19 can cause severe pneumonia, and neurological disorders, including stroke, the damage to the neurovascular unit, blood-brain barrier disruption, high intracranial proinflammatory cytokines, and endothelial cell damage in the brain. Mast cells are innate immune cells and also implicated in adaptive immune response, systemic inflammatory diseases, neuroinflammatory diseases, traumatic brain injury and stroke, and stress disorders. SARS-CoV-2 can activate monocytes/macrophages, dendritic cells, T cells, mast cells, neutrophils, and induce cytokine storm in the lung. COVID-19 can activate mast cells, neurons, glial cells, and endothelial cells. SARS-CoV-2 infection can cause psychological stress and neuroinflammation. In conclusion, COVID-19 can induce mast cell activation, psychological stress, cytokine storm, and neuroinflammation.

Absence of Glia Maturation Factor Protects from Axonal Injury and Motor Behavioral Impairments after Traumatic Brain Injury.

Traumatic brain injury (TBI) causes disability and death, accelerating the progression towards Alzheimer's disease and Parkinson's disease (PD). TBI causes serious motor and cognitive impairments, as seen in PD that arise during the period of the initial insult. However, this has been understudied relative to TBI induced neuroinflammation, motor and cognitive decline that progress towards PD. Neuronal ubiquitin-C-terminal hydrolase- L1 (UCHL1) is a thiol protease that breaks down ubiquitinated proteins and its level represents the severity of TBI. Previously, we demonstrated the molecular action of glia maturation factor (GMF); a proinflammatory protein in mediating neuroinflammation and neuronal loss. Here, we show that the weight drop method induced TBI neuropathology using behavioral tests, western blotting, and immunofluorescence techniques on sections from wild type (WT) and GMF-deficient (GMF-KO) mice. Results reveal a significant improvement in substantia nigral tyrosine hydroxylase and dopamine transporter expression with motor behavioral performance in GMF-KO mice following TBI. In addition, a significant reduction in neuroinflammation was manifested, as shown by activation of nuclear factor-kB, reduced levels of inducible nitric oxide synthase, and cyclooxygenase- 2 expressions. Likewise, neurotrophins including brain-derived neurotrophic factor and glial-derived neurotrophic factor were significantly improved in GMF-KO mice than WT 72 h post-TBI. Consistently, we found that TBI enhances GFAP and UCHL-1 expression and reduces the number of dopaminergic TH-positive neurons in WT compared to GMF-KO mice 72 h post-TBI. Interestingly, we observed a reduction of THpositive tanycytes in the median eminence of WT than GMF-KO mice. Overall, we found that absence of GMF significantly reversed these neuropathological events and improved behavioral outcome. This study provides evidence that PD-associated pathology progression can be initiated upon induction of TBI.

Neuroinflammation Mediated by Glia Maturation Factor Exacerbates Neuronal Injury in an in vitro Model of Traumatic Brain Injury.

Traumatic brain injury (TBI) is the primary cause of death and disability affecting over 10 million people in the industrialized world. TBI causes a wide spectrum of secondary molecular and cellular complications in the brain. However, the pathological events are still not yet fully understood. Previously, we have shown that the glia maturation factor (GMF) is a mediator of neuroinflammation in neurodegenerative diseases. To identify the potential molecular pathways accompanying TBI, we used an in vitro cell culture model of TBI. A standardized injury was induced by scalpel cut through a mixed primary cell culture of astrocytes, microglia and neurons obtained from both wild type (WT) and GMF-deficient (GMF-KO) mice. Cell culture medium and whole-cell lysates were collected at 24, 48, and 72 h after the scalpel cuts injury and probed for oxidative stress using immunofluorescence analysis. Results showed that oxidative stress markers such as glutathione and glutathione peroxidase were significantly reduced, while release of cytosolic enzyme lactate dehydrogenase along with nitric oxide and prostaglandin E2 were significantly increased in injured WT cells compared with injured GMF-KO cells. In addition, injured WT cells showed increased levels of oxidation product 4-hydroxynonenal and 8-oxo-2'-deoxyguanosine compared with injured GMF-KO cells. Further, we found that injured WT cells showed a significantly increased expression of glial fibrillary acidic protein, ionized calcium binding adaptor molecule 1, and phosphorylated ezrin/radixin/moesin proteins, and reduced microtubule associated protein expression compared with injured GMF-KO cells after injury. Collectively, our results demonstrate that GMF exacerbates the oxidative stress-mediated neuroinflammation that could be brought about by TBI-induced astroglial activation.

Psychological Stress-Induced Immune Response and Risk of Alzheimer's Disease in Veterans from Operation Enduring Freedom and Operation Iraqi Freedom.

PURPOSE: Psychological stress is a significant health problem in veterans and their family members. Traumatic brain injury (TBI) and stress lead to the onset, progression, and worsening of several inflammatory and neurodegenerative diseases in veterans and civilians. Alzheimer's disease (AD) is a progressive, irreversible neuroinflammatory disease that causes problems with memory, thinking, and behavior. TBIs and chronic psychological stress cause and accelerate the pathology of neuroinflammatory diseases such as AD. However, the precise molecular and cellular mechanisms governing neuroinflammation and neurodegeneration are currently unknown, especially in veterans. The purpose of this review article was to advance the hypothesis that stress and TBI-mediated immune response substantially contribute and accelerate the pathogenesis of AD in veterans and their close family members and civilians. METHODS: The information in this article was collected and interpreted from published articles in PubMed between 1985 and 2020 using the key words stress, psychological stress, Afghanistan war, Operation Enduring Freedom (OEF), Iraq War, Operation Iraqi Freedom (OIF), Operation New Dawn (OND), traumatic brain injury, mast cell and stress, stress and neuroimmune response, stress and Alzheimer's disease, traumatic brain injury, and Alzheimer's disease. FINDINGS: Chronic psychological stress and brain injury induce the generation and accumulation of beta-amyloid peptide, amyloid plaques, neurofibrillary tangles, and phosphorylation of tau in the brain, thereby contributing to AD pathogenesis. Active military personnel and veterans are under enormous psychological stress due to various war-related activities, including TBIs, disabilities, fear, new environmental conditions, lack of normal life activities, insufficient communications, explosions, military-related noise, and health hazards. Brain injury, stress, mast cell, and other immune cell activation can induce headache, migraine, dementia, and upregulate neuroinflammation and neurodegeneration in veterans of Operation Enduring Freedom, Operation Iraqi Freedom, and Operation New Dawn. TBIs, posttraumatic stress disorder, psychological stress, pain, glial activation, and dementia in active military personnel, veterans, or their family members can cause AD several years later in their lives. We suggest that there are increasing numbers of veterans with TBIs and stress and that these veterans may develop AD late in life if no appropriate therapeutic intervention is available. IMPLICATIONS: Per these published reports, the fact that TBIs and psychological stress can accelerate the pathogenesis of AD should be recognized. Active military personnel, veterans, and their close family members should be evaluated regularly for stress symptoms to prevent the pathogenesis of neurodegenerative diseases, including AD.

Characterization of phoA, a Bacterial Alkaline Phosphatase for Phi Use Efficiency in Rice Plant.

Fertilizers and herbicides are two major components in the agriculture system for achieving crop productivity. Massive use of orthophosphate fertilizers and herbicides poses threats to phosphate reserves and aids the evolution of herbicide tolerant weed biotypes. Phosphite (Phi), a phosphate analog, has been proposed as more beneficial than traditionally used phosphate fertilizers and herbicides in the agriculture. We developed phoA overexpressing transgenic rice that minimizes the phosphate loss and contributes to weed management in the agriculture. The phoA rice lines showed improved root, shoot length and total biomass production under phosphite conditions. Additionally, the complete phenotype and productivity of phoA lines under the phosphite treatment attained was similar to that of plants under phosphate sufficient condition. The Phi metabolizing properties of the phoA overexpressed lines improved under the Phi application and phi treatment enabled controlling of weeds without compromising the yield of transgenic rice plants. Our results indicated that phoA alone or in combination with other Phi metabolizing gene(s) can possibly be used as an effective ameliorating system for improving crop plants for phi-based fertilization and weed management strategy in the agriculture.

Developing dual herbicide tolerant transgenic rice plants for sustainable weed management.

Herbicides are important constituents of modern integrated weed management system. However, the continuous use of a single herbicide leads to the frequent evolution of resistant weeds which further challenges their management. To overcome this situation, alternating use of multiple herbicides along with conventional weed-management practices is suitable and recommended. The development of multiple herbicide-tolerant crops is still in its infancy, and only a few crops with herbicide tolerance traits have been reported and commercialized. In this study, we developed transgenic rice plants that were tolerant to both bensulfuron methyl (BM) and glufosinate herbicides. The herbicide tolerant mutant variant of rice AHAS (Acetohydroxyacid synthase) was overexpressed along with codon optimized bacterial bar gene. The developed transgenic lines showed significant tolerance to both herbicides at various stages of plant development. The selected transgenic lines displayed an increased tolerance against 100 µM BM and 30 mg/L phosphinothricin during seed germination stage. Foliar applications further confirmed the dual tolerance to 300 µM BM and 2% basta herbicides without any significant growth and yield penalties. The development of dual-herbicide-tolerant transgenic plants adds further information to the knowledge of crop herbicide tolerance for sustainable weed management in modern agricultural system.

Concurrent Overexpression of OsGS1;1 and OsGS2 Genes in Transgenic Rice (Oryza sativa L.): Impact on Tolerance to Abiotic Stresses.

Glutamine synthetase (GS) is a key enzyme involved in the nitrogen metabolism of higher plants. Abiotic stresses have adverse effects on crop production and pose a serious threat to global food security. GS activity and expression is known to be significantly modulated by various abiotic stresses. However, very few transgenic overexpression studies of GS have studied its impact on abiotic stress tolerance. GS is also the target enzyme of the broad spectrum herbicide Glufosinate (active ingredient: phosphinothricin). In this study, we investigated the effect of concurrent overexpression of the rice cytosolic GS1 (OsGS1;1) and chloroplastic GS2 (OsGS2) genes in transgenic rice on its tolerance to abiotic stresses and the herbicide Glufosinate. Our results demonstrate that the co-overexpression of OsGS1;1 and OsGS2 isoforms in transgenic rice plants enhanced its tolerance to osmotic and salinity stress at the seedling stage. The transgenic lines maintained significantly higher fresh weight, chlorophyll content, and relative water content than wild type (wt) and null segregant (ns) controls, under both osmotic and salinity stress. The OsGS1;1/OsGS2 co-overexpressing transgenic plants accumulated higher levels of proline but showed lower electrolyte leakage and had lower malondialdehyde (MDA) content under the stress treatments. The transgenic lines showed considerably enhanced photosynthetic and agronomic performance under drought and salinity stress imposed during the reproductive stage, as compared to wt and ns control plants. The grain filling rates of the transgenic rice plants under reproductive stage drought stress (64.6 ± 4.7%) and salinity stress (58.2 ± 4.5%) were significantly higher than control plants, thereby leading to higher yields under these abiotic stress conditions. Preliminary analysis also revealed that the transgenic lines had improved tolerance to methyl viologen induced photo-oxidative stress. Taken together, our results demonstrate that the concurrent overexpression of OsGS1;1 and OsGS2 isoforms in rice enhanced physiological tolerance and agronomic performance under adverse abiotic stress conditions, apparently acting through multiple mechanistic routes. The transgenic rice plants also showed limited tolerance to the herbicide Glufosinate. The advantages and limitations of glutamine synthetase overexpression in crop plants, along with future strategies to overcome these limitations for utilization in crop improvement have also been discussed briefly.

Co-expression of P173S Mutant Rice EPSPS and igrA Genes Results in Higher Glyphosate Tolerance in Transgenic Rice.

Weeds and their devastating effects have been a great threat since the start of agriculture. They compete with crop plants in the field and negatively influence the crop yield quality and quantity along with survival of the plants. Glyphosate is an important broad-spectrum systemic herbicide which has been widely used to combat various weed problems since last two decades. It is very effective even at low concentrations, and possesses low environmental toxicity and soil residual activity. However, the residual concentration of glyphosate inside the plant has been of major concern as it severely affects the important metabolic pathways, and results in poor plant growth and grain yield. In this study, we compared the glyphosate tolerance efficiency of two different transgenic groups over expressing proline/173/serine (P173S) rice EPSPS glyphosate tolerant mutant gene (OsmEPSPS) alone and in combination with the glyphosate detoxifying encoding igrA gene, recently characterized from Pseudomonas. The molecular analysis of all transgenic plant lines showed a stable integration of transgenes and their active expression in foliar tissues. The physiological analysis of glyphosate treated transgenic lines at seed germination and vegetative stages showed a significant difference in glyphosate tolerance between the two transgenic groups. The transgenic plants with OsmEPSPS and igrA genes, representing dual glyphosate tolerance mechanisms, showed an improved root-shoot growth, physiology, overall phenotype and higher level of glyphosate tolerance compared to the OsmEPSPS transgenic plants. This study highlights the advantage of igrA led detoxification mechanism as a crucial component of glyphosate tolerance strategy in combination with glyphosate tolerant OsmEPSPS gene, which offered a better option to tackle in vivo glyphosate accumulation and imparted more robust glyphosate tolerance in rice transgenic plants.

Abiotic Stress Tolerance in Plants: Myriad Roles of Ascorbate Peroxidase.

One of the most significant manifestations of environmental stress in plants is the increased production of Reactive Oxygen Species (ROS). These ROS, if allowed to accumulate unchecked, can lead to cellular toxicity. A battery of antioxidant molecules is present in plants for keeping ROS levels under check and to maintain the cellular homeostasis under stress. Ascorbate peroxidase (APX) is a key antioxidant enzyme of such scavenging systems. It catalyses the conversion of H2O2 into H2O, employing ascorbate as an electron donor. The expression of APX is differentially regulated in response to environmental stresses and during normal plant growth and development as well. Different isoforms of APX show differential response to environmental stresses, depending upon their sub-cellular localization, and the presence of specific regulatory elements in the upstream regions of the respective genes. The present review delineates role of APX isoforms with respect to different types of abiotic stresses and its importance as a key antioxidant enzyme in maintaining cellular homeostasis.

Development and characterization of a high temperature stress responsive subtractive cDNA library in Pearl Millet Pennisetum glaucum (L.) R.Br.

Pearl millet (Pennisetum glaucum L. R. Br.) is an important cereal crop grown mainly in the arid and semi-arid regions of India known to possess the natural ability to withstand thermal stress. To elucidate the molecular basis of high temperature response in pearl millet, 12 days old seedlings of P. glaucum cv. 841A were subjected to heat stress at 46 degrees C for different time durations ( 30 min, 2, 4, 8, 12 and 24 h) and a forward subtractive cDNA library was constructed from pooled RNA of heat stressed seedlings. A total of 331 high quality Expressed Sequence Tags (ESTs) were obtained from randomly selected 1050 clones. Sequences were assembled into 103 unique sequences consisting of 37 contigs and 66 singletons. Of these, 92 unique sequences were submitted to NCBI dbEST database. Gene Ontology through RGAP data base and BLASTx analysis revealed that about 18% of the ESTs showed homology to genes for "response to abiotic and biotic stimulus". About 2% of the ESTs showed no homology with genes in dbEST, indicating the presence of uncharacterized candidate genes involved in heat stress response in P. glaucum. Differential expression of selected genes (hsp101 and CRT) from the SSH library were validated by qRT-PCR analysis. The ESTs thus generated are a rich source of heat stress responsive genes, which can be utilized in improving thermotolerance of other food crops.