BRCA1 deficiency enhances the aggressiveness of breast cancer cells expressing HPV16 oncoproteins.

BACKGROUND INFORMATION: The precise etiology of breast cancer is not completely understood, although women with BRCA1 gene mutations have a significantly increased risk of developing the disease. In addition, sporadic breast cancer is frequently associated with decreased BRCA1 gene expression. Growing evidence of Human papillomaviruses (HPVs) infections in breast tumors has raised the possibility of the involvement of HPVs in the pathogenesis of breast cancer. We investigated whether the effects of HPV oncoproteins E6 and E7 were influenced by the expression levels of BRCA1. HPV16E6E7 (prototype or E6D25E/E7N29S Asian variant type) were stably expressed in MDA-MB231 breast cancer cells, wild type for BRCA1, or with BRCA1 knocked down. RESULTS: Expression of HPV16E6E7 oncogenes did not affect BRCA1 levels and the abundance of HPV16E6E7 was not altered by BRCA1 knockdown. BRCA1 levels did not alter HPV16E6E7-dependent degradation of G1-S cell cycle proteins p53 and pRb. However, we found that the expression of G2-M cell cycle protein cyclin B1 enhanced by HPV16E6E7 was impacted by BRCA1 levels. Especially, we found the correlation between BRCA1 and cyclin B1 expression and this was also confirmed in breast cancer samples from a Thai cohort. We further demonstrated that the combination of HPV oncoproteins and low levels of BRCA1 protein appears to enhance proliferation and invasion. Transactivation activities of HPV16E6E7 on genes regulating cell proliferation and invasion (TGF-ß and vimentin) were significantly increased in BRCA1-deficient cells. CONCLUSIONS: Our results indicate that a deficiency of BRCA1 promotes the transactivation activity of HPV16E6E7 leading to increase of cell proliferation and invasion. SIGNIFICANCE: HPV infection appears to have the potential to enhance the aggressiveness of breast cancers, especially those deficient in BRCA1.

Novel LIAS variants in a patient with epilepsy and profound developmental disabilities.

Multiple mitochondrial enzymes employ lipoic acid as a coenzyme. Pathogenic variants in LIAS, encoding lipoic acid synthase (LIAS), are associated with autosomal recessive LIAS-related disorder (OMIM# 614462). This disorder is characterized by infantile-onset hypotonia, profound psychomotor delay, epileptic encephalopathy, nonketotic hyperglycinemia, and lactic acidosis. We present the case of a 20-year-old female who experienced developmental deficits at the age of 6 months and began to have seizures at 3 years of age. Exome sequencing revealed compound heterozygous novel variants in LIAS, designated c.277delC (p.Leu93Ter) and c.542A > T (p.Asp181Val). The p.Leu93Ter variant is predicted to cause loss of function due to the severe truncation of the encoded protein. To examine the p.Asp181Val variant, functional analysis was performed using Baker's yeast (Saccharomyces cerevisiae) lacking LIP5, the homologue of human LIAS. Wild-type LIAS promoted oxidative growth of the lip5∆ yeast strain. In contrast, lip5∆ yeast expressing p.Asp181Val exhibited poor growth, similar to known pathogenic variants, p.Asp215Glu and p.Met310Thr. Our work has expanded the phenotypic and genotypic spectrum of LIAS-related disorder and established the use of the yeast model as a system for functional study of novel missense variants in LIAS.

Mitochondrial dysfunction from malathion and chlorpyrifos exposure is associated with degeneration of GABAergic neurons in Caenorhabditis elegans.

Toxicity resulting from off-target effects, beyond acetylcholine esterase inhibition, for the commonly used organophosphate (OP) insecticides chlorpyrifos (CPS) and malathion (MA) was investigated using Saccharomyces cerevisiae and Caenorhabditis elegans model systems. Mitochondrial damage and dysfunction were observed in yeast following exposure to CPS and MA, suggesting this organelle is a major target. In the C. elegans model, the mitochondrial unfolded protein response pathway showed the most robust induction from CPS and MA treatment among stress responses examined. GABAergic neurodegeneration was observed with CPS and MA exposure. Impaired movement observed in C. elegans exposed to CPS and MA may be the result of motor neuron damage. Our analysis suggests that stress from CPS and MA results in mitochondrial dysfunction, with GABAergic neurons sensitized to these effects. These findings may aid in the understanding of toxicity from CPS and MA from high concentration exposure leading to insecticide poisoning.

Chemical-Genetic Interactions of Bacopa monnieri Constituents in Cells Deficient for the DNA Repair Endonuclease RAD1 Appear Linked to Vacuolar Disruption.

Colorectal cancer is a common cancer worldwide and reduced expression of the DNA repair endonuclease XPF (xeroderma pigmentosum complementation group F) is associated with colorectal cancer. Bacopa monnieri extracts were previously found to exhibit chemical-genetic synthetic lethal effects in a Saccharomyces cerevisiae model of colorectal cancer lacking Rad1p, a structural and functional homologue of human XPF. However, the mechanisms for B. monnieri extracts to limit proliferation and promote an apoptosis-like event in RAD1 deleted yeast was not elucidated. Our current analysis has revealed that B. monnieri extracts have the capacity to promote mutations in rad1∆ cells. In addition, the effects of B. monnieri extracts on rad1∆ yeast is linked to disruption of the vacuole, similar to the mammalian lysosome. The absence of RAD1 in yeast sensitizes cells to the effects of vacuole disruption and the release of proteases. The combined effect of increased DNA mutations and release of vacuolar contents appears to induce an apoptosis-like event that is dependent on the meta-caspase Yca1p. The toxicity of B. monnieri extracts is linked to sterol content, suggesting saponins may be involved in limiting the proliferation of yeast cells. Analysis of major constituents from B. monnieri identified a chemical-genetic interaction between bacopasaponin C and rad1∆ yeast. Bacopasaponin C may have potential as a drug candidate or serve as a model for the development of analogs for the treatment of colorectal cancer.

Novel SOX10 Mutations in Waardenburg Syndrome: Functional Characterization and Genotype-Phenotype Analysis.

Waardenburg syndrome (WS) is a prevalent hearing loss syndrome, concomitant with focal skin pigmentation abnormalities, blue iris, and other abnormalities of neural crest-derived cells, including Hirschsprung's disease. WS is clinically and genetically heterogeneous and it is classified into four major types WS type I, II, III, and IV (WS1, WS2, WS3, and WS4). WS1 and WS3 have the presence of dystopia canthorum, while WS3 also has upper limb anomalies. WS2 and WS4 do not have the dystopia canthorum, but the presence of Hirschsprung's disease indicates WS4. There is a more severe subtype of WS4 with peripheral nerve and/or central nervous system involvement, namely peripheral demyelinating neuropathy, central dysmyelinating leukodystrophy, WS, and Hirschsprung's disease or PCW/PCWH. We characterized the genetic defects underlying WS2, WS4, and the WS4-PCW/PCWH) using Sanger and whole-exome sequencing and cytogenomic microarray in seven patients from six unrelated families, including two with WS2 and five with WS4. We also performed multiple functional studies and analyzed genotype-phenotype correlations. The cohort included a relatively high frequency (80%) of individuals with neurological variants of WS4. Six novel SOX10 mutations were identified, including c.89C > A (p.Ser30∗), c.207_8 delCG (p.Cys71Hisfs∗62), c.479T > C (p.Leu160Pro), c.1379 delA (p.Tyr460Leufs∗42), c.425G > C (p.Trp142Ser), and a 20-nucleotide insertion, c.1155_1174dupGCCCCACTATGGCTCAGCCT (p.Phe392Cysfs∗117). All pathogenic variants were de novo. The results of reporter assays, western blotting, immunofluorescence, and molecular modeling supported the deleterious effects of the identified mutations and their correlations with phenotypic severity. The prediction of genotype-phenotype correlation and functional pathology, and dominant negative effect vs. haploinsufficiency in SOX10-related WS were influenced not only by site (first two vs. last coding exons) and type of mutation (missense vs. truncation/frameshift), but also by the protein expression level, molecular weight, and amino acid content of the altered protein. This in vitro analysis of SOX10 mutations thus provides a deeper understanding of the mechanisms resulting in specific WS subtypes and allows better prediction of the phenotypic manifestations, though it may not be always applicable to in vivo findings without further investigations.

Disruption in iron homeostasis and impaired activity of iron-sulfur cluster containing proteins in the yeast model of Shwachman-Diamond syndrome.

BACKGROUND: Shwachman-Diamond syndrome (SDS) is a congenital disease that affects the bone marrow, skeletal system, and pancreas. The majority of patients with SDS have mutations in the SBDS gene, involved in ribosome biogenesis as well as other processes. A Saccharomyces cerevisiae model of SDS, lacking Sdo1p the yeast orthologue of SBDS, was utilized to better understand the molecular pathogenesis in the development of this disease. RESULTS: Deletion of SDO1 resulted in a three-fold over-accumulation of intracellular iron. Phenotypes associated with impaired iron-sulfur (ISC) assembly, up-regulation of the high affinity iron uptake pathway, and reduced activities of ISC containing enzymes aconitase and succinate dehydrogenase, were observed in sdo1∆ yeast. In cells lacking Sdo1p, elevated levels of reactive oxygen species (ROS) and protein oxidation were reduced with iron chelation, using a cell impermeable iron chelator. In addition, the low activity of manganese superoxide dismutase (Sod2p) seen in sdo1∆ cells was improved with iron chelation, consistent with the presence of reactive iron from the ISC assembly pathway. In yeast lacking Sdo1p, the mitochondrial voltage-dependent anion channel (VDAC) Por1p is over-expressed and its deletion limits iron accumulation and increases activity of aconitase and succinate dehydrogenase. CONCLUSIONS: We propose that oxidative stress from POR1 over-expression, resulting in impaired activity of ISC containing proteins and disruptions in iron homeostasis, may play a role in disease pathogenesis in SDS patients.

MITF variants cause nonsyndromic sensorineural hearing loss with autosomal recessive inheritance.

MITF is a known gene underlying autosomal dominant hearing loss, Waardenburg syndrome (WS). Biallelic MITF mutations have been found associated with a rare hearing loss syndrome consisting eye abnormalities and albinism; and a more severe type of WS whose heterozygous parents were affected with classic WS in both cases. The aims of this study were to identify a new candidate gene causing autosomal recessive nonsyndromic hearing loss (ARNSHL) and confirm its causation by finding additional families affected with the candidate gene and supporting evidences from functional analyses. By using whole exome sequencing, we identified a homozygous c.1022G>A: p.Arg341His variant of MITF, which co-segregated with the hearing loss in five affected children of a consanguineous hearing couple. Targeted exome sequencing in a cohort of 130 NSHL individuals, using our in-house gene panel revealed a second family with c.1021C>T: p.Arg341Cys MITF variant. Functional studies confirmed that the Arg341His and Arg341Cys alleles yielded a normal sized MITF protein, with aberrant cytosolic localization as supported by the molecular model and the reporter assay. In conclusion, we demonstrate MITF as a new cause of ARNSHL, with heterozygous individuals free of symptoms. MITF should be included in clinical testing for NSHL, though it is rare.

Overexpression of Transcription Factor ZNF1 of Glycolysis Improves Bioethanol Productivity under High Glucose Concentration and Enhances Acetic Acid Tolerance of Saccharomyces cerevisiae.

Saccharomyces cerevisiae offers an attractive platform for synthesis of biofuels and biochemical; however, robust strains that can withstand high substrate concentration and fermentation conditions are required. To improve the yield and productivity of bioethanol, modification of glucose metabolism and cellular stress adaptation is investigated. Specifically, the role of Znf1 transcription factor in metabolic regulation of glucose is characterized. Here, Znf1 is first shown to activate key genes in glycolysis, pyruvate metabolism, and alcoholic fermentation when glucose is provided as the sole carbon source. Under conditions of high glucose (20 g L-1 ), overexpression of ZNF1 accelerated glucose consumption with only 0.67-0.80% of glucose remaining after 24 or 36 h of fermentation. Importantly, ZNF1 overexpression increases ethanol concentrations by 14-24% and achieves a maximum ethanol concentration of 76.12-88.60 g L-1 . Ethanol productivity is increased 3.17-3.69 in strains overexpressing ZNF1 compared to 2.42-3.35 and 2.94-3.50 for the znf1Δ and wild-type strains, respectively. Moreover, strains overexpressing ZNF1 also display enhanced tolerance to osmotic and weak-acid stresses, important trait in alcoholic fermentation. Overexpresssion of key transcriptional activators of genes in glycolysis and stress responses appears to be an effective strategy to improve bioethanol productivity and enhance strain robustness.

Genetic Analysis of Peroxisomal Genes Required for Longevity in a Yeast Model of Citrin Deficiency.

Citrin is a liver-specific mitochondrial aspartate-glutamate carrier encoded by SLC25A13. Citrin deficiency caused by SLC25A13 mutation results in carbohydrate toxicity, citrullinemia type II, and fatty liver diseases, the mechanisms of some of which remain unknown. Citrin shows a functional homolog in yeast aspartate-glutamate carrier (Agc1p) and agc1Δ yeasts are used as a model organism of citrin deficiency. Here, we found that agc1Δ yeasts decreased fat utilization, impaired NADH balance in peroxisomes, and decreased chronological lifespan. The activation of GPD1-mediated NAD+ regeneration in peroxisomes by GPD1 over-expression or activation of the malate-oxaloacetate NADH peroxisomal shuttle, by increasing flux in this NADH shuttle and over-expression of MDH3, resulted in lifespan extension of agc1Δ yeasts. In addition, over-expression of PEX34 restored longevity of agc1Δ yeasts as well as wild-type cells. The effect of PEX34-mediated longevity required the presence of the GPD1-mediated NADH peroxisomal shuttle, which was independent of the presence of the peroxisomal malate-oxaloacetate NADH shuttle and PEX34-induced peroxisome proliferation. These data confirm that impaired NAD+ regeneration in peroxisomes is a key defect in the yeast model of citrin deficiency, and enhancing peroxisome function or inducing NAD+ regeneration in peroxisomes is suggested for further study in patients' hepatocytes.

Overexpression of the peroxin Pex34p suppresses impaired acetate utilization in yeast lacking the mitochondrial aspartate/glutamate carrier Agc1p.

PEX34, encoding a peroxisomal protein implicated in regulating peroxisome numbers, was identified as a high copy suppressor, capable of bypassing impaired acetate utilization of agc1∆ yeast. However, improved growth of agc1∆ yeast on acetate is not mediated through peroxisome proliferation. Instead, stress to the endoplasmic reticulum and mitochondria from PEX34 overexpression appears to contribute to enhanced acetate utilization of agc1∆ yeast. The citrate/2-oxoglutarate carrier Yhm2p is required for PEX34 stimulated growth of agc1∆ yeast on acetate medium, suggesting that the suppressor effect is mediated through increased activity of a redox shuttle involving mitochondrial citrate export. Metabolomic analysis also revealed redirection of acetyl-coenzyme A (CoA) from synthetic reactions for amino acids in PEX34 overexpressing yeast. We propose a model in which increased formation of products from the glyoxylate shunt, together with enhanced utilization of acetyl-CoA, promotes the activity of an alternative mitochondrial redox shuttle, partially substituting for loss of yeast AGC1.

Possible Role of the Ca2+/Mn2+ P-Type ATPase Pmr1p on Artemisinin Toxicity through an Induction of Intracellular Oxidative Stress.

Artemisinins are widely used to treat Plasmodium infections due to their high clinical efficacy; however, the antimalarial mechanism of artemisinin remains unresolved. Mutations in P. falciparum ATPase6 (PfATP6), a sarcoplasmic endoplasmic reticulum Ca2+-transporting ATPase, are associated with increased tolerance to artemisinin. We utilized Saccharomyces cerevisiae as a model to examine the involvement of Pmr1p, a functional homolog of PfATP6, on the toxicity of artemisinin. Our analysis demonstrated that cells lacking Pmr1p are less susceptible to growth inhibition from artemisinin and its derivatives. No association between sensitivity to artemisinin and altered trafficking of the drug efflux pump Pdr5p, calcium homeostasis, or protein glycosylation was found in pmr1∆ yeast. Basal ROS levels are elevated in pmr1∆ yeast and artemisinin exposure does not enhance ROS accumulation. This is in contrast to WT cells that exhibit a significant increase in ROS production following treatment with artemisinin. Yeast deleted for PMR1 are known to accumulate excess manganese ions that can function as ROS-scavenging molecules, but no correlation between manganese content and artemisinin resistance was observed. We propose that loss of function mutations in Pmr1p in yeast cells and PfATP6 in P. falciparum are protective against artemisinin toxicity due to reduced intracellular oxidative damage.

Decreased accumulation of superoxide dismutase 2 within mitochondria in the yeast model of Shwachman-Diamond syndrome.

Mutations in the human SBDS gene is the most common cause of Shwachman-Diamond syndrome (SDS). The SBDS protein participates in ribosome biogenesis; however, effects beyond reduced translation efficiency are thought to be involved in SDS progression. Impaired mitochondrial function has been reported for cells lacking either SBDS or Sdo1p, the Saccharomyces cerevisiae SBDS ortholog. To better understand how the loss of SBDS/Sdo1p leads to mitochondria damage, we utilized the S. cerevisiae model of SDS. Yeast deleted for SDO1 show increased oxidative damage to mitochondrial proteins and a marked decrease in protein levels and activity of mitochondrial superoxide dismutase 2 (Sod2p), a key enzyme involved in defense against oxidants. Immature forms of Sod2p are observed in sdo1∆ cells suggesting a defect in proteolysis of the presequence. Yeast deleted for CYM1, encoding a presequence protease, display a similar reduction in Sod2p activity as sdo1∆ cells, as well as elevated oxidative damage, to mitochondrial proteins. Sod2p protein levels and activity are largely restored in a por1∆ sdo1∆ strain, lacking the major mitochondrial voltage-dependent anion channel. Together these results indicate that mitochondrial insufficiency in sdo1∆ cells may be linked to the accumulation of immature presequence containing proteins and this effect is a consequence, at least in part, from loss of counter-regulation of Por1p by Sdo1p.

Interrogation of ethnomedicinal plants for synthetic lethality effects in combination with deficiency in the DNA repair endonuclease RAD1 using a yeast cell-based assay.

ETHNOPHARMACOLOGICAL RELEVANCE: Plant materials used in this study were selected based on the ethnobotanical literature. Plants have either been utilized by Thai practitioners as alternative treatments for cancer or identified to exhibit anti-cancer properties. AIM OF THE STUDY: To screen ethnomedicinal plants using a yeast cell-based assay for synthetic lethal interactions with cells deleted for RAD1, the yeast homologue of human ERCC4 (XPF) MATERIALS AND METHODS: Ethanolic extracts from thirty-two species of medicinal plants utilized in Thai traditional medicine were screened for synthetic lethal/sick interactions using a yeast cell-based assay. Cell growth was compared between the parental strain and rad1∆ yeast following exposure to select for specific toxicity of plant extracts. Candidate extracts were further examined for the mode of action using genetic and biochemical approaches. RESULTS: Screening a library of ethanolic extracts from medicinal plants identified Bacopa monnieri and Colubrina asiatica as having synthetic lethal effects in the rad1∆ cells but not the parental strain. Synthetic lethal effects for B. monneiri extracts were more apparent and this plant was examined further. Genetic analysis indicates that pro-oxidant activities and defective excision repair pathways do not significantly contribute to enhanced sensitivity to B. monneiri extracts. Exposure to B. monneiri extracts resulted in nuclear fragmentation and elevated levels of ethidium bromide staining in rad1∆ yeast suggesting promotion of an apoptosis-like event. Growth inhibition also observed in the human Caco-2 cell line suggesting the effects of B. monnieri extracts on both yeast and human cells may be similar. CONCLUSIONS: B. monneiri extracts may have utility in treatment of colorectal cancers that exhibit deficiency in ERCC4 (XPF).

Fungicide Xylaria sp. BCC 1067 extract induces reactive oxygen species and activates multidrug resistance system in Saccharomyces cerevisiae.

AIM: To investigate antifungal potential of Xylaria sp. BIOTEC culture collection (BCC) 1067 extract against the model yeast Saccharomyces cerevisiae. MATERIALS & METHODS: Antifungal property of extract, reactive oxygen species levels and cell survival were determined, using selected deletion strains. RESULTS: Extract showed promising antifungal effect with minimal inhibitory concentration100 and minimal fungicidal concentration of 500 and 1000 mg/l, respectively. Strong synergy was observed with fractional inhibitory concentration index value of 0.185 for the combination of 60.0 and 0.5 mg/l of extract and ketoconazole, respectively. Extract-induced intracellular reactive oxygen species levels in some oxidant-prone strains and mediated plasma membrane rupture. Antioxidant regulator Yap1, efflux transporter Pdr5 and ascorbate were pivotal to protect S. cerevisiae from extract cytotoxicity. CONCLUSION: Xylaria sp. BCC 1067 extract is a potentially valuable source of novel antifungals.

Zinc cluster protein Znf1, a novel transcription factor of non-fermentative metabolism in Saccharomyces cerevisiae.

The ability to rapidly respond to nutrient changes is a fundamental requirement for cell survival. Here, we show that the zinc cluster regulator Znf1 responds to altered nutrient signals following glucose starvation through the direct control of genes involved in non-fermentative metabolism, including those belonged to the central pathways of gluconeogenesis (PCK1, FBP1 and MDH2), glyoxylate shunt (MLS1 and ICL1) and the tricarboxylic acid cycle (ACO1), which is demonstrated by Znf1-binding enrichment at these promoters during the glucose-ethanol shift. Additionally, reduced Pck1 and Fbp1 enzymatic activities correlate well with the data obtained from gene transcription analysis. Cells deleted for ZNF1 also display defective mitochondrial morphology with unclear structures of the inner membrane cristae when grown in ethanol, in agreement with the substantial reduction in the ATP content, suggesting for roles of Znf1 in maintaining mitochondrial morphology and function. Furthermore, Znf1 also plays a role in tolerance to pH and osmotic stress, especially during the oxidative metabolism. Taken together, our results clearly suggest that Znf1 is a critical transcriptional regulator for stress adaptation during non-fermentative growth with some partial overlapping targets with previously reported regulators in Saccharomyces cerevisiae.

Deletion of Mitochondrial Porin Alleviates Stress Sensitivity in the Yeast Model of Shwachman-Diamond Syndrome.

Shwachman-Diamond syndrome (SDS) is a multi-system disorder characterized by bone marrow failure, pancreatic insufficiency, skeletal abnormalities, and increased risk of leukemic transformation. Most patients with SDS contain mutations in the Shwachman-Bodian-Diamond syndrome gene (SBDS), encoding a highly conserved protein that has been implicated in ribosome biogenesis. Emerging evidence also suggests a distinct role of SBDS beyond protein translation. Using the yeast model of SDS, we examined the underlying mechanisms that cause cells lacking Sdo1p, the yeast SBDS ortholog, to exhibit reduced tolerance to various stress conditions. Our analysis indicates that the environmental stress response (ESR), heat shock response (HSR), and endoplasmic reticulum unfolded protein response (UPR) of sdo1Δ cells are functional and that defects in these pathways do not produce the phenotypes observed in sdo1Δ yeast. Depletion of mitochondrial DNA (mtDNA) was observed in sdo1Δ cells, and this is a probable cause of the mitochondrial insufficiency in SDS. Prior disruption of POR1, encoding the mitochondrial voltage dependent anion channel (VDAC), abrogated the effects of SDO1 deletion and substantially restored resistance to environmental stressors and protected against damage to mtDNA. Conversely, wild-type cells over-expressing POR1 exhibited growth impairment and increased stress sensitivity similar to that seen in sdo1Δ cells. Overall, our results suggest that specific VDAC inhibitors may have therapeutic benefits for SDS patients.

Improper protein trafficking contributes to artemisinin sensitivity in cells lacking the KDAC Rpd3p.

Lysine deacetylases (KDACs) inhibitors may have therapeutic value in anti-malarial combination therapies with artemisinin. To evaluate connections between KDACs and artemisinin, Saccharomyces cerevisiae deletion mutants in KDAC genes were assayed. Deletion of RPD3, but not other KDAC genes, resulted in strong sensitivity to artemisinin, which was also observed in sit4Δ mutants with impaired endoplasmic reticulum (ER) to Golgi protein trafficking. Decreased accumulation of the transporters Pdr5p, Fur4p, and Tat2p was observed in rpd3Δ and sit4Δ cells. The unfolded protein response is induced in rpd3Δ cells consistent with retention of proteins in the ER. Disruption of protein trafficking appears to sensitize cells to artemisinin and targeting these pathways may be useful as part of artemisinin based anti-malarial therapy.

Screening of SLC25A13 mutation in the Thai population.

AIM: To determine the prevalence of SLC25A13 mutations in the Thai population. METHODS: A total of 1537 subjects representing the Thai population were screened for a novel pathologic allele p.Met1? (c.2T > C) and six previously known common SLC25A13 mutations: [I] (c.851_854delGTAT), [II] (g.IVS11 + 1G > A), [III] (c.1638_1660dup), [IV] (p.S225X), [V] (IVS13 + 1G > A), and [XIX] (g.IVS16ins3kb) using a newly developed TaqMan and established HybProbe assay, respectively. Sanger sequencing was employed for specimens showing an aberrant peak to confirm the targeted mutation as well as the unknown aberrant peaks detected. Frequencies of the mutations identified were compared in each region. Carrier frequency and disease prevalence of citrin deficiency caused by SCL25A13 mutations were estimated. RESULTS: p.Met1? was identified in the heterozygous state in 85 individuals, giving a carrier frequency of 1/18, which suggests possible selective advantage of this variant. The question of p.Met1? homozygote lethality remains unanswered which may serve as an explanation as to why this homozygote has yet to be identified in patients/controls even with high allele frequency. The p.Met1? mutation has rarely been studied in populations other than Thai and Chinese; therefore, may have been overlooked. Development of the TaqMan assay in the present study would allow a simple, rapid, and cost-effective method for mass screening. Heterozygous mutations: [XIX] and [I] were identified in 17 individuals, giving a carrier rate of 1/90 and a calculated homozygote rate of 1/33000. Two novel variants, g.IVS11 + 17C > G and c.1311C > T, of unknown clinical significance were identified at low frequency. CONCLUSION: This study highlighted the current underestimation of citrin deficiency and suggests the possible selective advantage of the p.Met1? allele.

Prediction of the functional effect of novel SLC25A13 variants using a S. cerevisiae model of AGC2 deficiency.

AGC2, a member of the mitochondrial carrier protein family, is as an aspartate-glutamate carrier and is important for urea synthesis and the maintenance of the malate-aspartate shuttle. Mutations in SLC25A13, the gene encoding AGC2, result in two age dependent disorders: neonatal intrahepatic cholestasis caused by citrin deficiency (NICCD) and type II citrullinemia (CTLN2). The clinical features of CTLN2 are very similar to those of other urea cycle disorders making a clear diagnosis difficult. Analysis of the SLC25A13 gene sequence can provide a definitive diagnosis, however the predictive value of DNA sequencing requires that the disease association of variants be characterized. We utilized the yeast Saccharomyces cerevisiae lacking AGC1 as a model system to study the effect on the function of AGC2 variants and confirmed that this system is capable of distinguishing between AGC2 variants with normal (p.Pro632Leu) or impaired function (p.Gly437Glu, p.Gly531Asp, p.Thr546Met, p.Leu598Arg and p.Glu601Lys). Three novel AGC2 genetic variants, p.Met1? (c.2T>C), p.Pro502Leu (c.1505C>T), and p.Arg605Gln (c.1814G>A) were investigated and our analysis revealed that p.Pro502Leu and p.Arg605Gln substitutions in the AGC2 protein were without effect and these variants were fully functional. The p.Met1? mutant is capable of expressing a truncated p.Met1_Phe34del AGC2 variant, however this protein is not functional due to disruptions in a calcium binding EF hand as well as incorrect intracellular localization. Our study demonstrates that the characterization of AGC2 expressed in yeast cells is a powerful technique to investigate AGC2 variants, and this analysis should aid in establishing the disease association of novel variants.

The effect of phosphate accumulation on metal ion homeostasis in Saccharomyces cerevisiae.

Much of what is currently understood about the cell biology of metals involves their interactions with proteins. By comparison, little is known about interactions of metals with intracellular inorganic compounds such as phosphate. Here we examined the role of phosphate in metal metabolism in vivo by genetically perturbing the phosphate content of Saccharomyces cerevisiae cells. Yeast pho80 mutants cannot sense phosphate and have lost control of phosphate uptake, storage, and metabolism. We report here that pho80 mutants specifically elevate cytosolic and nonvacuolar levels of phosphate and this in turn causes a wide range of metal homeostasis defects. Intracellular levels of the hard-metal cations sodium and calcium increase dramatically, and cells become susceptible to toxicity from the transition metals manganese, cobalt, zinc, and copper. Disruptions in phosphate control also elicit an iron starvation response, as pho80 mutants were seen to upregulate iron transport genes. The iron-responsive transcription factor Aft1p appears activated in cells with high phosphate content in spite of normal intracellular iron levels. The high phosphate content of pho80 mutants can be lowered by mutating Pho4p, the transcription factor for phosphate uptake and storage genes. Such lowering of phosphate content by pho4 mutations reversed the high calcium and sodium content of pho80 mutants and prevented the iron starvation response. However, pho4 mutations only partially reversed toxicity from heavy metals, representing a novel outcome of phosphate dysregulation. Overall, these studies underscore the importance of maintaining a charge balance in the cell; a disruption in phosphate metabolism can dramatically impact on metal homeostasis.