Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 52
Filtrar
1.
Stem Cell Res ; 79: 103474, 2024 Sep.
Artigo em Inglês | MEDLINE | ID: mdl-38909482

RESUMO

Ten-Eleven Translocation methylcytosine dioxygenase 1 (TET1) is known to play a broad tumor suppressor role through demethylating and activating tumor suppressor genes. TET1 missense mutations are previously reported in many types of leukemia. Here, the human induced pluripotent stem cell line MURAi001-A was generated from skin fibroblasts derived from a 56-year-old female patient carrying the TET1 gene mutation c.4404A > G (p.I1468M), who had a history of ovarian germ cell tumor. The MURAi001-A cell line demonstrated embryonic-like characteristics as it expressed specific stemness markers, differentiated into the three germ layers, and retained normal karyotyping.


Assuntos
Fibroblastos , Células-Tronco Pluripotentes Induzidas , Oxigenases de Função Mista , Proteínas Proto-Oncogênicas , Humanos , Células-Tronco Pluripotentes Induzidas/metabolismo , Fibroblastos/metabolismo , Feminino , Proteínas Proto-Oncogênicas/genética , Proteínas Proto-Oncogênicas/metabolismo , Pessoa de Meia-Idade , Oxigenases de Função Mista/genética , Oxigenases de Função Mista/metabolismo , Mutação , Linhagem Celular , Pele/citologia , Pele/patologia , Diferenciação Celular
2.
Lab Invest ; 104(7): 102074, 2024 Jul.
Artigo em Inglês | MEDLINE | ID: mdl-38723854

RESUMO

Intrahepatic cholangiocarcinoma (ICC) is a lethal cancer with poor survival especially when it spreads. The histopathology of its rare intraductal papillary neoplasm of the bile duct type (IPNB) characteristically shows cancer cells originating within the confined bile duct space. These cells eventually invade and infiltrate the nearby liver tissues, making it a good model to study the mechanism of local invasion, which is the earliest step of metastasis. To discover potential suppressor genes of local invasion in ICC, we analyzed the somatic mutation profiles and performed clonal evolution analyses of the 11 pairs of macrodissected locally invasive IPNB tissues (LI-IPNB) and IPNB tissues without local invasion from the same patients. We identified a protein-truncating variant in an E3 ubiquitin ligase, RNF213 (c.6967C>T; p.Gln2323X; chr17: 78,319,102 [hg19], exon 29), as the most common protein-truncating variant event in LI-IPNB samples (4/11 patients). Knockdown of RNF213 in HuCCT1 and YSCCC cells showed increased migration and invasion, and reduced vasculogenic mimicry but maintained normal proliferation. Transcriptomic analysis of the RNF213-knockdown vs control cells was then performed in the HuCCT1, YSCCC, and KKU-100 cells. Gene ontology enrichment analysis of the common differentially expressed genes revealed significantly altered cytokine and oxidoreductase-oxidizing metal ion activities, as confirmed by Western blotting. Gene Set Enrichment Analysis identified the most enriched pathways being oxidative phosphorylation, fatty acid metabolism, reactive oxygen species, adipogenesis, and angiogenesis. In sum, loss-of-function mutation of RNF213 is a common genetic alteration in LI-IPNB tissues. RNF213 knockdown leads to increased migration and invasion of ICC cells, potentially through malfunctions of the pathways related to inflammation and energy metabolisms.


Assuntos
Neoplasias dos Ductos Biliares , Colangiocarcinoma , Invasividade Neoplásica , Ubiquitina-Proteína Ligases , Colangiocarcinoma/genética , Colangiocarcinoma/patologia , Colangiocarcinoma/metabolismo , Humanos , Ubiquitina-Proteína Ligases/genética , Ubiquitina-Proteína Ligases/metabolismo , Neoplasias dos Ductos Biliares/genética , Neoplasias dos Ductos Biliares/patologia , Neoplasias dos Ductos Biliares/metabolismo , Linhagem Celular Tumoral , Masculino , Feminino , Pessoa de Meia-Idade , Adenosina Trifosfatases/metabolismo , Adenosina Trifosfatases/genética , Idoso , Movimento Celular/genética
3.
Heliyon ; 10(9): e30575, 2024 May 15.
Artigo em Inglês | MEDLINE | ID: mdl-38765140

RESUMO

Synaptotagmin 4 (syt4) belongs to the synaptotagmin protein family, which has 17 and 28 family members in human and zebrafish, respectively. In zebrafish and rodents, syt4 is known to express abundantly in the entire central nervous system in the early developmental stages. In adult rodents, the gene expression shifts to be predominant in the cerebellum, mostly in Purkinje cells, a type of GABAergic neurons. However, there is no report of the expression pattern of syt4 in the adult zebrafish brain. Therefore, we hypothesize that the expression of syt4 is conserved in adult zebrafish and is specific to the GABAergic neurons, likely Purkinje cells, in the cerebellum. To examine the hypothesis, we first show that only one copy of syt4 gene remains in the zebrafish genome, and it is orthologous to the gene in other vertebrates. We further observe mammalian SYT4 antibody immunoreactive-like (mSYT4-ir) signals in several structures in the hindbrain including the medial divisions of the valvula cerebelli and the corpus cerebelli. In addition, our observations indicate the presence of mSYT4-ir signals in GABAergic neurons, most notably in the Purkinje cell layer of the molecular layer in the aforementioned structures. Conversely, mSYT4-ir signals are not observed in glutamatergic or cholinergic neurons. Therefore, we deduce that the syt4 gene in zebrafish exhibits a homologous expression pattern to those of previously studied vertebrate species, which is revealed by the positive immunoreactive-like signals of mammalian SYT4 antibodies.

4.
Cancers (Basel) ; 16(9)2024 Apr 26.
Artigo em Inglês | MEDLINE | ID: mdl-38730633

RESUMO

Liquid biopsy involves the utilization of minimally invasive or noninvasive techniques to detect biomarkers in biofluids for disease diagnosis, monitoring, or guiding treatments. This approach is promising for the early diagnosis of childhood cancer, especially for brain tumors, where tissue biopsies are more challenging and cause late detection. Extracellular vesicles offer several characteristics that make them ideal resources for childhood cancer liquid biopsy. Extracellular vesicles are nanosized particles, primarily secreted by all cell types into body fluids such as blood and urine, and contain molecular cargos, i.e., lipids, proteins, and nucleic acids of original cells. Notably, the lipid bilayer-enclosed structure of extracellular vesicles protects their cargos from enzymatic degradation in the extracellular milieu. Proteins and nucleic acids of extracellular vesicles represent genetic alterations and molecular profiles of childhood cancer, thus serving as promising resources for precision medicine in cancer diagnosis, treatment monitoring, and prognosis prediction. This review evaluates the recent progress of extracellular vesicles as a liquid biopsy platform for various types of childhood cancer, discusses the mechanistic roles of molecular cargos in carcinogenesis and metastasis, and provides perspectives on extracellular vesicle-guided therapeutic intervention. Extracellular vesicle-based liquid biopsy for childhood cancer may ultimately contribute to improving patient outcomes.

5.
Lupus Sci Med ; 11(1)2024 Mar 08.
Artigo em Inglês | MEDLINE | ID: mdl-38458775

RESUMO

OBJECTIVES: X chromosome has been considered as a risk factor for SLE, which is a prototype of autoimmune diseases with a significant sex difference (female:male ratio is around 9:1). Our study aimed at exploring the association of genetic variants in X chromosome and investigating the influence of trisomy X in the development of SLE. METHODS: X chromosome-wide association studies were conducted using data from both Thai (835 patients with SLE and 2995 controls) and Chinese populations (1604 patients with SLE and 3324 controls). Association analyses were performed separately in females and males, followed by a meta-analysis of the sex-specific results. In addition, the dosage of X chromosome in females with SLE were also examined. RESULTS: Our analyses replicated the association of TMEM187-IRAK1-MECP2, TLR7, PRPS2 and GPR173 loci with SLE. We also identified two loci suggestively associated with SLE. In addition, making use of the difference in linkage disequilibrium between Thai and Chinese populations, a synonymous variant in TMEM187 was prioritised as a likely causal variant. This variant located in an active enhancer of immune-related cells, with the risk allele associated with decreased expression level of TMEM187. More importantly, we identified trisomy X (47,XXX) in 5 of 2231 (0.22%) females with SLE. The frequency is significantly higher than that found in the female controls (0.08%; two-sided exact binomial test P=0.002). CONCLUSION: Our study confirmed previous SLE associations in X chromosome, and identified two loci suggestively associated with SLE. More importantly, our study indicated a higher risk of SLE for females with trisomy X.


Assuntos
Lúpus Eritematoso Sistêmico , Transtornos do Cromossomo Sexual no Desenvolvimento Sexual , Trissomia , Humanos , Masculino , Feminino , Lúpus Eritematoso Sistêmico/epidemiologia , Lúpus Eritematoso Sistêmico/genética , Predisposição Genética para Doença , Tailândia/epidemiologia , Aberrações dos Cromossomos Sexuais , Cromossomos Humanos X/genética , China , Proteínas de Membrana
6.
Clin Cancer Res ; 30(2): 294-303, 2024 01 17.
Artigo em Inglês | MEDLINE | ID: mdl-37982827

RESUMO

PURPOSE: Palbociclib, a cyclin D kinase 4 (CDK4)/6 inhibitor, has shown radiosensitizing effects in preclinical studies. There is a strong rationale for adding palbociclib to cetuximab and radiotherapy in locally advanced head and neck squamous cell carcinoma (LA-HNSCC), especially in p16-negative HNSCC. PATIENTS AND METHODS: We conducted a phase I dose-escalation study (NCT03024489) using a classical 3+3 design to determine safety, tolerability, and MTD of palbociclib, cetuximab, and intensity-modulated radiotherapy (IMRT) combination. At the recommended phase II dose (RP2D), additional p16-negative patients were enrolled. RESULTS: Twenty-seven patients with LA-HNSCC (13 in dose escalation, 14 in expansion) with oropharyngeal (41%) and hypopharyngeal (30%) cancers were enrolled. The MTD was not reached, and the RP2D of palbociclib was established at the full standard palbociclib dose of 125 mg/day for 21 days per cycle, administered for two cycles during IMRT. The most common grade 3-4 toxicities were mucositis (59%), radiation dermatitis (22%), and neutropenia (22%), with a febrile neutropenia rate of 7%. Common genomic alterations included mutations in TP53 (57%), GNAQ (35%), and PIK3CA (17%), and copy-number gains in CCND1 (22%), CCND2 (9%), and EGFR (9%). Overall, p16 expression was positive in 15% of patients. No correlation was observed between p16 status, genomic alterations, and preliminary efficacy. The objective response rate was 84%. The rates for 2-year locoregional control, event-free survival, and overall survival were 73%, 48%, and 71%, respectively. CONCLUSIONS: The palbociclib, cetuximab, and IMRT combination was well tolerated. The RP2D was established, while no MTD was determined. The regimen demonstrated promising preliminary efficacy, suggesting further investigation is warranted in patients with cisplatin-ineligible p16/human papilloma virus-unrelated LA-HNSCC.


Assuntos
Neoplasias de Cabeça e Pescoço , Piridinas , Humanos , Protocolos de Quimioterapia Combinada Antineoplásica/efeitos adversos , Cetuximab , Quimiorradioterapia , Cisplatino , Quinase 4 Dependente de Ciclina/genética , Neoplasias de Cabeça e Pescoço/tratamento farmacológico , Neoplasias de Cabeça e Pescoço/genética , Piperazinas/uso terapêutico , Carcinoma de Células Escamosas de Cabeça e Pescoço/tratamento farmacológico , Carcinoma de Células Escamosas de Cabeça e Pescoço/genética
7.
PeerJ ; 11: e15350, 2023.
Artigo em Inglês | MEDLINE | ID: mdl-37334114

RESUMO

Background: Triple-negative breast cancer (TNBC) is a rare and aggressive breast cancer subtype. Unlike the estrogen receptor-positive subtype, whose recurrence risk can be predicted by gene expression-based signature, TNBC is more heterogeneous, with diverse drug sensitivity levels to standard regimens. This study explored the benefit of gene expression-based profiling for classifying the molecular subtypes of Thai TNBC patients. Methods: The nCounter-based Breast 360 gene expression was used to classify Thai TNBC retrospective cohort subgroups. Their expression profiles were then compared against the previously established TNBC classification system. The differential characteristics of the tumor microenvironment and DNA damage repair signatures across subgroups were also explored. Results: Thai TNBC cohort could be classified into four main subgroups, corresponding to the LAR, BL-2, and M subtypes based on Lehmann's TNBC classification. The PAM50 gene set classified most samples as basal-like subtypes except for Group 1. Group 1 exhibited similar enrichment of the metabolic and hormone response pathways to the LAR subtype. Group 2 shared pathway activation with the BL-2 subtype. Group 3 showed an increase in the EMT pathway, similar to the M subtype. Group 4 showed no correlation with Lehmann's TNBC. The tumor microenvironment (TME) analysis showed high TME cell abundance with increased expression of immune blockade genes in Group 2. Group 4 exhibited low TME cell abundance and reduced immune blockade gene expressions. We also observed distinct signatures of the DNA double-strand break repair genes in Group 1. Conclusions: Our study reported unique characteristics between the four TNBC subgroups and showed the potential use of immune checkpoint and PARP inhibitors in subsets of Thai TNBC patients. Our findings warrant further clinical investigation to validate TNBC's sensitivity to these regimens.


Assuntos
Inibidores de Checkpoint Imunológico , Inibidores de Poli(ADP-Ribose) Polimerases , Transcriptoma , Neoplasias de Mama Triplo Negativas , Humanos , Inibidores de Poli(ADP-Ribose) Polimerases/uso terapêutico , Estudos Retrospectivos , População do Sudeste Asiático , Neoplasias de Mama Triplo Negativas/tratamento farmacológico , Microambiente Tumoral/genética , Feminino , Inibidores de Checkpoint Imunológico/uso terapêutico
8.
JCO Precis Oncol ; 7: e2300003, 2023 05.
Artigo em Inglês | MEDLINE | ID: mdl-37163716

RESUMO

PURPOSE: MicroRNAs (miRNAs) have been evaluated as biomarkers in cancers. Therefore, we aimed to identify a prognostic miRNA signature from The Cancer Genome Atlas (TCGA) database and validate it in the Ramathibodi (RA) locally advanced head and neck squamous cell carcinoma (LA-HNSCC) cohort. METHODS: The correlation between candidate miRNAs and the survival of patients with LA-HNSCC in TCGA database was analyzed. A prognostic miRNA signature model was generated that classified patients into high-risk and low-risk groups. This candidate miRNA signature was further validated in the independent RA cohort using droplet-digital polymerase chain reaction. RESULTS: In TCGA database, we compared the expression of 277 miRNAs between 519 head and neck squamous cell carcinoma tissues and 44 normal tissues. The expression of hsa-miR-10b, hsa-miR-148b, hsa-miR-99a, hsa-miR-127, hsa-miR-370, and hsa-miR-500a was independently associated with overall survival (OS). Thus, we established the miRNA signature risk score from these six miRNAs and categorized patients into low-risk and high-risk groups. The median OS of TCGA patients was significantly shorter in the low-risk group than in the high-risk group (P < .001). The six-miRNA signature was further validated in the RA cohort (N = 87). The median OS of the low-risk group was significantly shorter compared with the high-risk group (P = .03). In multivariate analysis, the six-miRNA signature was an independent prognostic factor for OS in the RA cohort (HR, 1.958; 95% CI, 1.006 to 3.812; P = .048). CONCLUSION: We identified a prognostic six-miRNA signature for patients with LA-HNSCC from TCGA cohort and validated it in our independent cohort. However, larger studies are warranted to confirm these results.


Assuntos
Neoplasias de Cabeça e Pescoço , MicroRNAs , Carcinoma de Células Escamosas de Cabeça e Pescoço , MicroRNAs/genética , Prognóstico , Carcinoma de Células Escamosas de Cabeça e Pescoço/diagnóstico , Carcinoma de Células Escamosas de Cabeça e Pescoço/genética , Humanos , Biomarcadores Tumorais/genética , Neoplasias de Cabeça e Pescoço/diagnóstico , Neoplasias de Cabeça e Pescoço/genética , Masculino , Feminino , Adulto Jovem , Adulto , Pessoa de Meia-Idade , Idoso , Idoso de 80 Anos ou mais
9.
Front Genet ; 13: 802362, 2022.
Artigo em Inglês | MEDLINE | ID: mdl-36468027

RESUMO

Chimerism is a very rare genetic finding in human. Most reported cases have a chi 46,XX/46,XY karyotype. Only three non-twin cases carrying both trisomy 21 and a normal karyotype have been reported, including two cases with a chi 47,XY,+21/46,XX karyotype and a case with a chi 47,XX,+21/46,XY karyotype. Herein we describe an additional case with a chi 47,XY,+21/46,XX karyotype. For the case, a physical examination at the age of 1 year revealed ambiguous genitalia with no features of Down syndrome or other malformations. Growth and developmental milestones were within normal ranges. We performed short tandem repeat (STR) and single nucleotide polymorphism (SNP) microarray analyses to attempt to identify the mechanism underlying the chimerism in this patient and the origin of the extra chromosome 21. Cytogenetic analyses of the patient's peripheral blood revealed approximately 17% of a 47,XY,+21 lineage by G-banding karyotype analysis, 13%-17% by FISH analyses of uncultured peripheral blood, and 10%-15% by SNP microarray analysis. Four years later, the percentage of trisomy 21 cells had decreased to approximately 6%. SNP microarray and STR analyses revealed a single maternal and double paternal genetic contribution to the patient for the majority of the markers, including the chromosome 21 markers. The extra chromosome 21 was paternally derived and meiosis I nondisjunction likely occurred during spermatogenesis. The mechanisms underlying chimera in our case was likely fertilization two spermatozoa, one with an ovum and the other with the second polar body.

10.
Cancers (Basel) ; 14(11)2022 May 26.
Artigo em Inglês | MEDLINE | ID: mdl-35681607

RESUMO

MYCN amplification is the strongest predictor of high-risk neuroblastoma (NB). The standard procedure to detect MYCN status requires invasive procedures. Extracellular vesicles (EVs) contain molecular signatures of originated cells, present in biofluids, and serve as an invaluable source for cancer liquid biopsies. This study aimed to establish an EV-based method to detect the MYCN status of NB. Two EV subtypes, i.e., microvesicles (MVs) and exosomes, were sequentially isolated from the culture supernatant by step-wise centrifugation, ultrafiltration, and size-exclusion chromatography. Quantitative RT-PCR was performed to detect MYCN mRNA. As a result, MYCN mRNA was detectable in the MVs, but not exosomes, of MYCN-amplified NB cells. MYCN mRNA-containing MVs (MYCN-MV) were successfully detected in three distinct MYCN-amplified NB cell lines but absent in three MYCN non-amplification cells. The simulated samples were prepared by pulsing MVs into human serum. MYCN-MV detection in the simulated samples showed a less interfering effect from the human blood matrix. Validation using clinical specimens (2 mL bone marrow plasma) obtained from patients at various disease stages showed a promising result. Five out of six specimens of MYCN-amplified patients showed positive results, while there were no false positives in four plasma samples of the MYCN non-amplification group. This study communicated a novel EV-based method for detecting the MYCN status of pediatric NB based on MYCN mRNA contents in MVs. Future studies should be pursued in a prospective cohort to determine its true diagnostic performance.

11.
Biosci Rep ; 41(12)2021 12 22.
Artigo em Inglês | MEDLINE | ID: mdl-34708245

RESUMO

Malignant ascites is an abnormal accumulation of fluid within the peritoneal cavity, caused by metastasis of several types of cancers, including colorectal cancer (CRC). Cancer cells in ascites reflect poor prognosis and serve as a good specimen to study tumour heterogeneity, as they represent a collection of multiple metastatic sites in the peritoneum. In the present study, we have employed single-cell RNA-sequencing (scRNA-seq) to explore and characterise ascites-derived cells from a CRC patient. The samples were prepared using mechanical and enzymatic dissociations, and obtained before and after a chemotherapy treatment. Unbiased clustering of 19,653 cells from four samples reveals 14 subclusters with unique transcriptomic patterns in four major cell types: epithelial cells, myeloid cells, fibroblasts, and lymphocytes. Interestingly, the percentages of cells recovered from different cell types appeared to be influenced by the preparation protocols, with more than 90% reduction in the number of myeloid cells recovered by enzymatic preparation. Analysis of epithelial cell subpopulations unveiled only three out of eleven subpopulations with clear contraction after the treatment, suggesting that the majority of the heterogeneous ascites-derived cells were resistant to the treatment, potentially reflecting the poor treatment outcome observed in the patient. Overall, our study showcases highly heterogeneous cancer subpopulations at single-cell resolution, which respond differently to a particular chemotherapy treatment. All in all, this work highlights the potential benefit of single-cell analyses in planning appropriate treatments and real-time monitoring of therapeutic response in cancer patients through routinely discarded ascites samples.


Assuntos
Protocolos de Quimioterapia Combinada Antineoplásica/uso terapêutico , Líquido Ascítico/metabolismo , Biomarcadores Tumorais/genética , Neoplasias Colorretais/tratamento farmacológico , Perfilação da Expressão Gênica , Heterogeneidade Genética , RNA Neoplásico/genética , RNA-Seq , Análise de Célula Única , Transcriptoma , Líquido Ascítico/patologia , Biomarcadores Tumorais/metabolismo , Tomada de Decisão Clínica , Neoplasias Colorretais/genética , Neoplasias Colorretais/metabolismo , Neoplasias Colorretais/patologia , Resistencia a Medicamentos Antineoplásicos , Feminino , Humanos , Pessoa de Meia-Idade , Valor Preditivo dos Testes , RNA Neoplásico/metabolismo , Resultado do Tratamento
12.
Biomedicines ; 9(10)2021 Oct 10.
Artigo em Inglês | MEDLINE | ID: mdl-34680550

RESUMO

Failure to detect early-stage epithelial ovarian cancer (EOC) is a major contributing factor to its low survival rate. Increasing evidence suggests that different subtypes of EOC may behave as distinct diseases due to their different cells of origins, histology and treatment responses. Therefore, the identification of EOC subtype-specific biomarkers that can early detect the disease should be clinically beneficial. Exosomes are extracellular vesicles secreted by different types of cells and carry biological molecules, which play important roles in cell-cell communication and regulation of various biological processes. Multiple studies have proposed that exosomal miRNAs present in the circulation are good biomarkers for non-invasive early detection of cancer. In this review, the potential use of exosomal miRNAs as early detection biomarkers for EOCs and their accuracy are discussed. We also review the differential expression of circulating exosomal miRNAs and cell-free miRNAs between different biofluid sources, i.e., plasma and serum, and touch on the issue of endogenous reference miRNA selection. Additionally, the current clinical trials using miRNAs for detecting EOCs are summarized. In conclusion, circulating exosomal miRNAs as the non-invasive biomarkers have a high potential for early detection of EOC and its subtypes, and are likely to be clinically important in the future.

13.
Genes (Basel) ; 12(10)2021 10 07.
Artigo em Inglês | MEDLINE | ID: mdl-34680978

RESUMO

The OTUD6B and ZMIZ1 genes were recently identified as causes of syndromic intellectual disability (ID) with shared phenotypes of facial dysmorphism, distal limb anomalies, and seizure disorders. OTUD6B- and ZMIZ1-related ID are inherited in autosomal recessive and autosomal dominant patterns, respectively. We report a 5-year-old girl with developmental delay, facial phenotypes resembling Williams syndrome, and cardiac defects. The patient also had terminal broadening of the fingers and polydactyly. Cytogenomic microarray (CMA), whole exome sequencing (WES), and mRNA analysis were performed. The CMA showed a paternally inherited 0.118 Mb deletion of 8q21.3, chr8:92084087-92202189, with OTUD6B involved. The WES identified a hemizygous OTUD6B variant, c.873delA (p.Lys291AsnfsTer3). The mother was heterozygous for this allele. The WES also demonstrated a heterozygous ZMIZ1 variant, c.1491 + 2T > C, in the patient and her father. This ZMIZ1 variant yielded exon 14 skipping, as evidenced by mRNA study. We suggest that Williams syndrome-like phenotypes, namely, periorbital edema, hanging cheek, and long and smooth philtrum represent expanded phenotypes of OTUD6B-related ID. Our data expand the genotypic spectrum of OTUD6B- and ZMIZ1-related disorders. This is the first reported case of a compound heterozygote featuring point mutation, chromosomal microdeletion of OTUD6B, and the unique event of OTUD6B, coupled with ZMIZ1 variants.


Assuntos
Endopeptidases/genética , Predisposição Genética para Doença , Deficiência Intelectual/genética , Fatores de Transcrição/genética , Alelos , Pré-Escolar , Deleção Cromossômica , Exoma/genética , Feminino , Heterozigoto , Humanos , Lactente , Deficiência Intelectual/patologia , Masculino , Linhagem , Fenótipo , Mutação Puntual/genética , Sequenciamento do Exoma
14.
Cancer Sci ; 112(10): 4257-4269, 2021 Oct.
Artigo em Inglês | MEDLINE | ID: mdl-34273216

RESUMO

Poor survival of patients with locally advanced head and neck squamous cell carcinoma (LA-HNSCC) is partly due to early diagnosis difficulties and the lack of reliable biomarkers for predicting treatment outcomes. In the discovery cohort, plasma-derived extracellular vesicles (EVs) from LA-HNSCC patients (n = 48) and healthy volunteers (n = 12) were used for profiling for microRNA (miRNA) expression by NanoString analysis. Ten EV-associated miRNAs were differentially expressed between LA-HNSCC patients and healthy volunteers. Subsequently, the results were validated in the individual discovery and additional cases (HNSCC, n = 73; control, n = 20) by quantitative RT-PCR. Among 10 EV-miRNAs, four (miR-27b-3p, miR-491-5p, miR-1910-5p, and miR-630) were significantly dysregulated in LA-HNSCC patients (n = 73) compared with healthy volunteers (n = 20). The miRNA prediction models were developed to discriminate HNSCC patients from healthy volunteers. The model using miR-491-5p was selected as a diagnostic biomarker for LA-HNSCC with a sensitivity and specificity of 46.6% and 100%, respectively (P < .001). The dynamic changes of miRNA model score (ΔmiRNAs) were determined using scores pre- and postdefinitive treatment to further investigate the prognostic value of miRNA prediction models. The univariate and multivariate analyses indicated that ΔmiR-491-5p was the most powerful and independent prognostic indicator for overall survival (hazard ratio [HR] 5.66, 95% confidence interval, 1.77-18.01; P = .003) and disease-free survival (HR 2.82, 95% CI, 1.13-7.05; P = .027) of HNSCC patients. In summary, the miR-491-5p prediction model could serve as a blood-based diagnostic marker for LA-HNSCC. Moreover, ΔmiR-491-5p could be a potential monitoring prognostic marker to reflect the survival of HNSCC patients.


Assuntos
Vesículas Extracelulares/genética , Neoplasias de Cabeça e Pescoço/genética , MicroRNAs/sangue , Carcinoma de Células Escamosas de Cabeça e Pescoço/genética , Adulto , Idoso , Análise de Variância , Biomarcadores Tumorais/sangue , Biomarcadores Tumorais/genética , Estudos de Casos e Controles , Intervalos de Confiança , Intervalo Livre de Doença , Feminino , Neoplasias de Cabeça e Pescoço/sangue , Neoplasias de Cabeça e Pescoço/mortalidade , Neoplasias de Cabeça e Pescoço/patologia , Humanos , Masculino , Análise em Microsséries , Pessoa de Meia-Idade , Prognóstico , Sensibilidade e Especificidade , Carcinoma de Células Escamosas de Cabeça e Pescoço/sangue , Carcinoma de Células Escamosas de Cabeça e Pescoço/mortalidade , Carcinoma de Células Escamosas de Cabeça e Pescoço/patologia
15.
BMC Cancer ; 21(1): 504, 2021 May 06.
Artigo em Inglês | MEDLINE | ID: mdl-33957888

RESUMO

BACKGROUND: Lower prevalence HPV infection has been previously reported in Thai population when compared with Western countries. p16 expression indicates HPV-associated oropharyngeal squamous cell carcinoma (OPSCC), but not non-OPSCC. We therefore evaluated the characteristic and association of p16 and HPV in Thai patients with HNSCC. METHODS: We used immunohistochemistry and qPCR, respectively, to detect p16 and HPV DNA in archrival formalin-fixed paraffin-embedded HNSCC tissues. Patient characteristics and survival were analyzed. RESULTS: p16 expression was detected in tumors of 72 of 662 (10.9%) patients with HNSCC and was significantly associated with higher-grade histology, advanced nodal stage, and oropharynx. p16 was expressed in 28 and 6.5% of patients with OPSCC or non-OPSCC, respectively, and HPV DNA was detected in 15.6 and 1% of patients, respectively. Using p16 as a surrogate for HPV status, sensitivities were 80 and 25% in OPSCC and non-OPSCC, respectively. Positive and negative predictive rates of OPSCC were 38 and 95%. Discordance rates between HPV and p16 were 23 and 7% in OPSCC and non-OPSCC, respectively. Overall survival (OS) were significantly longer in both p16-positive OPSCC (p = 0.049), and non-OPSCC (p = 0.003). CONCLUSIONS: Low prevalence of p16 and HPV associated OPSCC and non-OPSCC were confirmed in Thai patients. High discordance and low positive predictive rates of p16 were observed in HPV-associated OPSCC. p16 was a significant prognostic factor for OS for patients with OPSCC or non-OPSCC. Therefore, HPV testing should be performed to assess the association of HPV with HNSCC regardless of p16 expression.


Assuntos
Alphapapillomavirus/isolamento & purificação , Inibidor p16 de Quinase Dependente de Ciclina/análise , Neoplasias Orofaríngeas/química , Infecções por Papillomavirus/complicações , Carcinoma de Células Escamosas de Cabeça e Pescoço/química , Adulto , Idoso , Idoso de 80 Anos ou mais , DNA Viral/análise , Feminino , Humanos , Imuno-Histoquímica , Masculino , Pessoa de Meia-Idade , Neoplasias Orofaríngeas/mortalidade , Neoplasias Orofaríngeas/virologia , Carcinoma de Células Escamosas de Cabeça e Pescoço/mortalidade , Carcinoma de Células Escamosas de Cabeça e Pescoço/virologia , Adulto Jovem
16.
Artif Cells Nanomed Biotechnol ; 49(1): 120-135, 2021 Dec.
Artigo em Inglês | MEDLINE | ID: mdl-33491496

RESUMO

This study aimed to examine the pharmacological profiles of multiple chemo drug candidates in systematic circulation to enhance their specific interactions with five human cancer cell lines. ZnO nanoparticles were successfully bound with chemo drugs via physical adsorption. The drug loading capacity was confirmed by FTIR, whereas the loading efficiency was determined via UV-vis spectrometry. The mean hydrodynamic size increased to 69-82 nm after chemo-drug immobilization via non-covalent interaction with ZnO. Among the nine formulated chemo drugs, the carboplatin (CP)-doxorubicin (DOX)-ZnO complex under UV light irradiation exhibited high sensitivity towards human breast adenocarcinoma cells without affecting human keratinocyte immortal cells with an IC50 of 0.137 µg/mL, whereas the loading capacity and efficiency of CP-DOX-ZnO were 77.81% and 99.05%, respectively. Fluorescence images confirmed that CP-DOX-ZnO using DOX served as a fluorescence enhancer specifically bound onto the cell membranes, which became almost saturated after 24 h incubation. Carboplatin-DOX-ZnO was possibly endocytosed by cancer cells and was selectively internalized into the target cells; thus, free chemo drug was released in the cytoplasm, which induced acute apoptosis. This resulted in complete inhabitation of growth signal of target cancer cells.


Assuntos
Antineoplásicos/química , Antineoplásicos/farmacologia , Carboplatina/química , Doxorrubicina/química , Raios Ultravioleta , Óxido de Zinco/química , Apoptose/efeitos dos fármacos , Neoplasias da Mama/patologia , Linhagem Celular Tumoral , Sobrevivência Celular/efeitos dos fármacos , Colo do Útero/patologia , Neoplasias do Colo/patologia , Feminino , Humanos , Neoplasias Hepáticas/patologia , Neoplasias Bucais/patologia
17.
BMC Pediatr ; 21(1): 22, 2021 01 07.
Artigo em Inglês | MEDLINE | ID: mdl-33407268

RESUMO

BACKGROUND: Sandhoff disease (SD) is an autosomal recessive lysosomal storage disorder, resulting in accumulation of GM2 ganglioside, particular in neuronal cells. The disorder is caused by deficiency of ß-hexosaminidase B (HEX-B), due to pathogenic variant of human HEXB gene. METHOD: This study describes clinical features, biochemical, and genetic defects among Thai patients with infantile SD during 2008-2019. RESULTS: Five unrelated Thai patients presenting with developmental regression, axial hypotonia, seizures, exaggerated startle response to noise, and macular cherry red spot were confirmed to have infantile SD based on deficient HEX enzyme activities and biallelic variants of the HEXB gene. In addition, an uncommon presenting feature, cardiac defect, was observed in one patient. All the patients died in their early childhood. Plasma total HEX and HEX-B activities were severely deficient. Sequencing analysis of HEXB gene identified two variants including c.1652G>A (p.Cys551Tyr) and a novel variant of c.761T>C (p.Leu254Ser), in 90 and 10% of the mutant alleles found, respectively. The results from in silico analysis using multiple bioinformatics tools were in agreement that the p.Cys551Tyr and the p.Leu254Ser are likely pathogenic variants. Molecular modelling suggested that the Cys551Tyr disrupt disulfide bond, leading to protein destabilization while the Leu254Ser resulted in change of secondary structure from helix to coil and disturbing conformation of the active site of the enzyme. Genome-wide SNP array analysis showed no significant relatedness between the five affected individuals. These two variants were not present in control individuals. The prevalence of infantile SD in Thai population is estimated 1 in 1,458,521 and carrier frequency at 1 in 604. CONCLUSION: The study suggests that SD likely represents the most common subtype of rare infantile GM2 gangliosidosis identified among Thai patients. We firstly described a potential common variant in HEXB in Thai patients with infantile onset SD. The data can aid a rapid molecular confirmation of infantile SD starting with the hotspot variant and the use of expanded carrier testing.


Assuntos
Doença de Sandhoff , Cadeia beta da beta-Hexosaminidase , Pré-Escolar , Hexosaminidase B/genética , Humanos , Mutação , Doença de Sandhoff/diagnóstico , Doença de Sandhoff/genética , Tailândia
18.
Front Genet ; 11: 589784, 2020.
Artigo em Inglês | MEDLINE | ID: mdl-33362852

RESUMO

Waardenburg syndrome (WS) is a prevalent hearing loss syndrome, concomitant with focal skin pigmentation abnormalities, blue iris, and other abnormalities of neural crest-derived cells, including Hirschsprung's disease. WS is clinically and genetically heterogeneous and it is classified into four major types WS type I, II, III, and IV (WS1, WS2, WS3, and WS4). WS1 and WS3 have the presence of dystopia canthorum, while WS3 also has upper limb anomalies. WS2 and WS4 do not have the dystopia canthorum, but the presence of Hirschsprung's disease indicates WS4. There is a more severe subtype of WS4 with peripheral nerve and/or central nervous system involvement, namely peripheral demyelinating neuropathy, central dysmyelinating leukodystrophy, WS, and Hirschsprung's disease or PCW/PCWH. We characterized the genetic defects underlying WS2, WS4, and the WS4-PCW/PCWH) using Sanger and whole-exome sequencing and cytogenomic microarray in seven patients from six unrelated families, including two with WS2 and five with WS4. We also performed multiple functional studies and analyzed genotype-phenotype correlations. The cohort included a relatively high frequency (80%) of individuals with neurological variants of WS4. Six novel SOX10 mutations were identified, including c.89C > A (p.Ser30∗), c.207_8 delCG (p.Cys71Hisfs∗62), c.479T > C (p.Leu160Pro), c.1379 delA (p.Tyr460Leufs∗42), c.425G > C (p.Trp142Ser), and a 20-nucleotide insertion, c.1155_1174dupGCCCCACTATGGCTCAGCCT (p.Phe392Cysfs∗117). All pathogenic variants were de novo. The results of reporter assays, western blotting, immunofluorescence, and molecular modeling supported the deleterious effects of the identified mutations and their correlations with phenotypic severity. The prediction of genotype-phenotype correlation and functional pathology, and dominant negative effect vs. haploinsufficiency in SOX10-related WS were influenced not only by site (first two vs. last coding exons) and type of mutation (missense vs. truncation/frameshift), but also by the protein expression level, molecular weight, and amino acid content of the altered protein. This in vitro analysis of SOX10 mutations thus provides a deeper understanding of the mechanisms resulting in specific WS subtypes and allows better prediction of the phenotypic manifestations, though it may not be always applicable to in vivo findings without further investigations.

19.
Biomolecules ; 10(8)2020 08 17.
Artigo em Inglês | MEDLINE | ID: mdl-32824461

RESUMO

Although gastric cancer is one of the most common causes of cancer death in the world, mechanisms underlying this type of tumor have not been fully understood. In this study, we found that IQGAP3, a member of the IQGAP gene family, was significantly up-regulated in human gastric cancer starting from the early stages of tumor progression. Overexpression of IQGAP3 in 293T and NIH3T3 cells, which have no endogenous IQGAP3 expression, resulted in morphological change with multiple dendritic-like protrusions and enhanced migration. Overexpression of IQGAP3 also led to reduced cell-cell adhesion in 293T cells, likely as a result of its interactions with e-cadherin or ß-catenin proteins. Additionally, IQGAP3 accumulated along the leading edge of migrating cells and at the cleavage furrow of dividing cells. In contrast, suppression of IQGAP3 by short-interfering RNA (siRNA) markedly reduced invasion and anchorage-independent growth of MKN1 and TMK-1 gastric cancer cells. We further confirmed that IQGAP3 interacted with Rho family GTPases, and had an important role in cytokinesis. Taken together, we demonstrated that IQGAP3 plays critical roles in migration and invasion of human gastric cancer cells, and regulates cytoskeletal remodeling, cell migration and adhesion. These findings may open a new avenue for the diagnosis and treatment of gastric cancer.


Assuntos
Proteínas Ativadoras de GTPase/genética , Proteínas Ativadoras de GTPase/metabolismo , Neoplasias Gástricas/patologia , Regulação para Cima , Animais , Linhagem Celular Tumoral , Movimento Celular , Regulação Neoplásica da Expressão Gênica , Células HEK293 , Humanos , Camundongos , Células NIH 3T3 , Gradação de Tumores , Invasividade Neoplásica , Neoplasias Gástricas/genética , Neoplasias Gástricas/metabolismo
20.
Infect Dis Ther ; 9(4): 807-821, 2020 Dec.
Artigo em Inglês | MEDLINE | ID: mdl-32860206

RESUMO

INTRODUCTION: The association between genetic background and the risk of invasive aspergillosis (IA) has not been addressed in Thailand. We conducted genetic risk surveillance for IA among Thai hematologic patients. METHODS: We conducted a prospective observational cohort study including moderate- to high-risk hematology patients at Ramathibodi Hospital. IA occurrence, relevant clinical data, and genetic analyses were assessed. Odds ratios (ORs) of IA were assessed for the presence of the selected single nucleotide polymorphism genotype using logistic regression. RESULTS: A total of 357 patients were enrolled. The most common hematologic disease was non-Hodgkin lymphoma (45.1%). IA was diagnosed in 36 patients (10.10%). The C allele of IL10rs1800896 was associated with an increased risk of IA (adjusted OR 5.297; 95% confidence interval [CI] 2.032-13.809, p = 0.001). In multivariate Cox regression analysis, prolonged neutropenia and the C allele of IL10rs1800896 were associated with IA (hazard ratio [HR] 12.585; 95% CI 3.866-40.967, p < 0.001 and HR 2.449; 95% CI 1.097-5.468, p = 0.042, respectively). CONCLUSIONS: Carrying the C allele of IL10rs1800896 was associated with an increased risk of IA among moderate- to high-risk Thai patients with hematologic diseases. This finding can potentially lead to a novel risk stratification scheme to further prevent IA in resource-limited settings.

SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA