Periodontal inflammatory and microbial profiles in healthy young African Americans and Caucasians.

AIM: This study aimed to compare microbial and inflammatory profiles in periodontally/systemically healthy African American (AA) and Caucasian (C) individuals. MATERIALS AND METHODS: Thirty-seven C and 46 AA aged from 5 to 25 years were evaluated regarding periodontal disease, caries, microbial subgingival profile via 16-s sequencing, as well as salivary and gingival crevicular fluid (GCF) inflammatory profile via multiplex assay. RESULTS: Greater probing depth percentage was detected in AA (p = .0075), while a higher percentage of caries index (p = .0069) and decayed, missing, filled teeth (DMFT) index (p = .0089) was observed in C, after adjusting for number of teeth, sex and age. Salivary levels of IL-6, IL-8 and TNFα were higher for C, whereas GCF levels of eotaxin, IL-12p40, IL-12p70, IL-2 and MIP-1α were higher in AA (p < .05). Different microbial profiles were observed between the races (p = .02). AA presented higher abundance of periodontopathogens (such as Tanerella forsythia, Treponema denticola, Filifactor alocis, among others), and C presented more caries-associated bacteria (such as Streptococcus mutans and Prevotella species). Bacillaceae and Lactobacillus species were associated with higher DMFT index, whereas Fusobacterium and Tanerella species with periodontal disease parameters. CONCLUSIONS: A different inflammatory and bacterial profile was observed between healthy AA and C, which may predispose these races to higher susceptibility to specific oral diseases.

Transcriptomic features of programmed and inflammatory cell death in gingival tissues.

The local gingival tissue environment with homeostasis and tissue-destructive events of periodontitis demonstrates major changes in histological features and biology of the oral/sulcular epithelium, fibroblasts, vascular cells, inflammatory cell infiltration, and alveolar bone. OBJECTIVE: This study used an experimental periodontitis model to detail the gingival transcriptome related to cell death processes of pyroptosis, necroptosis, ferroptosis, and cuproptosis. MATERIALS AND METHODS: Healthy Macaca mulatta primates stratified by age, ≤3 years (young), 7-12 years (adolescent), 12-15 years (adult), and 17-23 years (aged), provided gingival tissue biopsies for microarray analysis focused on 257 genes representative of the four cell death processes and bacterial plaque samples for 16S rRNA gene analysis. RESULTS: Age differences in the profiles of gene expression in healthy tissues were noted for cuproptosis, ferroptosis, necroptosis, and pyroptosis. Major differences were then observed with disease initiation, progression, and resolution also related to the age of the animals. Distinct bacterial families/consortia of species were significantly related to the gene expression differences for the cell death pathways. CONCLUSIONS: These results emphasized age-associated differences in the gingival tissue molecular response to changes in the quality and quantity of bacteria accumulating with the disease process reflected in regulated cell death pathways that are both physiological and pathophysiological.

Sex effects on gingival transcriptomic patterns during initiation, progression, and resolution of periodontitis.

BACKGROUND: The prevalence and severity of periodontitis demonstrates altered population distribution with age, sex, and race and ethnicity. While males exhibit greater frequency of disease, particularly with aging, the underlying basis for this observation remains obscure. OBJECTIVE: This study used a nonhuman primate (Macaca mulatta) model of experimental ligature-induced periodontitis in adult animals to evaluate gingival transcriptomic differences stratified based upon sex of the animal. METHODS: The 18 animals represented humans ages 40-80 years, with gingival tissue samples obtained at baseline, 0.5 months (initiation), 1 and 3 months (progression), and at 5 months that were 60 days after ligature removal for clinical disease resolution. Microarray analysis was used to quantify gene expression profiles in the gingival tissues. RESULTS: The results demonstrated clear gene expression differences in healthy (baseline) tissues between the sexes, with elevations in females associated with immune responses and elevation in males related to tissue structural genes. With disease initiation, fewer genes differed between the sexes, while these differences were significantly increased in progressing disease and resolution, particularly in male animals. Overexpressed biological processes showed tissue structural/functional genes at initiation, with host response pathways altered during disease progression. Resolution samples generally demonstrated biological processes of cellular metabolism that differed from baseline healthy samples. CONCLUSION: The transcriptomic findings support sex as a biological variable in periodontitis using a nonhuman primate model of experimental periodontitis.

Gingival transcriptomic patterns of macrophage polarization during initiation, progression, and resolution of periodontitis.

Phenotypic and functional heterogeneity of macrophages is clearly a critical component of their effective functions in innate and adaptive immunity. This investigation hypothesized that altered profiles of gene expression in gingival tissues in health, disease, and resolution would reflect changes in macrophage phenotypes occurring in these tissues. The study used a nonhuman primate model to evaluate gene expression profiles as footprints of macrophage variation using a longitudinal experimental model of ligature-induced periodontitis in animals from 3 to 23 years of age to identify aging effects on the gingival environment. Significant differences were observed in distribution of expressed gene levels for M0, M1, and M2 macrophages in healthy tissues with the younger animals showing the least expression. M0 gene expression increased with disease in all but the aged group, while M1 was increased in adult and young animals, and M2 in all age groups, as early as disease initiation (within 0.5 months). Numerous histocompatibility genes were increased with disease, except in the aged samples. An array of cytokines/chemokines representing both M1 and M2 cells were increased with disease showing substantial increases with disease initiation (e.g. IL1A, CXCL8, CCL19, CCL2, CCL18), although the aged tissues showed a more limited magnitude of change across these macrophage genes. The analytics of macrophage genes at sites of gingival health, disease, and resolution demonstrated distinct profiles of host response interactions that may help model the disease mechanisms occurring with the formation of a periodontal lesion.

Differential oral microbiome in nonhuman primates from periodontitis-susceptible and periodontitis-resistant matrilines.

Rhesus monkeys (n = 36) exhibiting a healthy periodontium at baseline were used to induce progressing periodontitis through ligature placement around premolar/molar teeth. Bacterial samples were collected at baseline, 0.5, 1, and 3 months of disease and at 5 months for disease resolution. The animals were distributed into two groups (18/group): 3-7 years (young) and 12-23 years (adult) and stratified based upon matriline susceptibility to periodontitis (PDS, susceptible; PDR, resistant). A total of 444 operational taxonomic units (OTUs) with 100 microbes representing a core microbiome present in ≥75% of the samples were identified. Only 48% of the major phylotypes overlapped in the PDS and PDR samples. Different OTU abundance patterns were seen in young animals from the PDS and PDR matrilines, with qualitative similarities during disease and the relative abundance of phylotypes becoming less diverse. In adults, 23 OTUs were increased during disease in PDS samples and 24 in PDR samples; however, only five were common between these groups. Greater diversity of OTU relative abundance at baseline was observed with adult compared to young oral samples from both the PDS and PDR groups. With disease initiation (2 weeks), less diversity of relative abundance and some distinctive increases in specific OTUs were noted. By 1 month, there was considerable qualitative homogeneity in the major OTUs in both groups; however, by 3 months, there was an exacerbation of both qualitative and quantitative differences in the dominant OTUs between the PDS and PDR samples. These results support that some differences in disease expression related to matriline (familial) periodontitis risk may be explained by microbiome features.

Immunoglobulin gene expression profiles and microbiome characteristics in periodontitis in nonhuman primates.

Colonization of mucosal tissues throughout the body occurs by a wide array of bacteria in the microbiome that stimulate the cells and tissues, as well as respond to changes in the local milieu. A feature of periodontitis is the detection of adaptive immune responses to members of the oral microbiome that show specificity and changes with disease and treatment. Thus, variations in antibody responses are noted across the population and affected by aging, albeit, data are still unclear as to how these differences relate to disease risk and expression. This study used a nonhuman primate model of experimental periodontitis to track local microbiome changes as they related to the use and expression of a repertoire of immunoglobulin genes in gingival tissues. Gingival tissue biopsies from healthy tissues and following ligature-placement for disease initiation and progression provided gene expression analysis. Additionally, following removal of the ligatures, clinical healing occurs with gene expression in disease resolved tissues. Groups of 9 animals (young: <3 yrs., adolescent: 3-7 yrs., adult -12 to 15 yrs.; aged: 17-22 yrs) were used in the investigation. In healthy tissues, young and adolescent animals showed levels of expression of 78 Ig genes that were uniformly less than adults. In contrast, ⅔ of the Ig genes were elevated by > 2-fold in the aged samples. Specific increases in an array of the Ig gene transcripts were detected in adults at disease initiation and throughout progression, while increases in young and adolescent animals were observed only with disease progression, and in aged samples primarily late in disease progression. Resolved lesions continued to demonstrate elevated levels of Ig gene expression in only young, adolescent and adult animals. The array of Ig genes significantly correlated with inflammatory, tissue biology and hypoxia genes in the gingival tissues, with variations associated with age. In the young group of animals, specific members of the oral microbiome positively correlated with Ig gene expression, while in the older animals, many of these correlations were negative. Significant correlations were observed with a select assortment of bacterial OTUs and multiple Ig genes in both younger and older animal samples, albeit the genera/species showed little overlap. Incorporating this array of microbes and host responses clearly discriminated the various time points in transition from health to disease and resolution in both the young and adult animals. The results support a major importance of adaptive immune responses in the kinetics of periodontal lesion formation, and support aging effects on the repertoire of Ig genes that may relate to the increased prevalence and severity of periodontitis with age.

Comparative Analysis of Gene Expression Patterns for Oral Epithelial Cell Functions in Periodontitis.

The structure and function of epithelial cells are critical for the construction and maintenance of intact epithelial surfaces throughout the body. Beyond the mechanical barrier functions, epithelial cells have been identified as active participants in providing warning signals to the host immune and inflammatory cells and in communicating various detailed information on the noxious challenge to help drive specificity in the characteristics of the host response related to health or pathologic inflammation. Rhesus monkeys were used in these studies to evaluate the gingival transcriptome for naturally occurring disease samples (GeneChip® Rhesus Macaque Genome Array) or for ligature-induced disease (GeneChip® Rhesus Gene 1.0 ST Array) to explore up to 452 annotated genes related to epithelial cell structure and functions. Animals were distributed by age into four groups: ≤ 3 years (young), 3-7 years (adolescent), 12-16 years (adult), and 18-23 years (aged). For naturally occurring disease, adult and aged periodontitis animals were used, which comprised 34 animals (14 females and 20 males). Groups of nine animals in similar age groups were included in a ligature-induced periodontitis experiment. A buccal gingival sample from either healthy or periodontitis-affected tissues were collected, and microarray analysis performed. The overall results of this investigation suggested a substantial alteration in epithelial cell functions that occurs rapidly with disease initiation. Many of these changes were prolonged throughout disease progression and generally reflect a disruption of normal cellular functions that would presage the resulting tissue destruction and clinical disease measures. Finally, clinical resolution may not signify biological resolution and represent a continued risk for disease that may require considerations for additional biologically specific interventions to best manage further disease.

Gingival Transcriptome of Innate Antimicrobial Factors and the Oral Microbiome With Aging and Periodontitis.

The epithelial barrier at mucosal sites comprises an important mechanical protective feature of innate immunity, and is intimately involved in communicating signals of infection/tissue damage to inflammatory and immune cells in these local environments. A wide array of antimicrobial factors (AMF) exist at mucosal sites and in secretions that contribute to this innate immunity. A non-human primate model of ligature-induced periodontitis was used to explore characteristics of the antimicrobial factor transcriptome (n = 114 genes) of gingival biopsies in health, initiation and progression of periodontal lesions, and in samples with clinical resolution. Age effects and relationship of AMF to the dominant members of the oral microbiome were also evaluated. AMF could be stratified into 4 groups with high (n = 22), intermediate (n = 29), low (n = 18) and very low (n = 45) expression in healthy adult tissues. A subset of AMF were altered in healthy young, adolescent and aged samples compared with adults (e.g., APP, CCL28, DEFB113, DEFB126, FLG2, PRH1) and were affected across multiple age groups. With disease, a greater number of the AMF genes were affected in the adult and aged samples with skewing toward decreased expression, for example WDC12, PGLYRP3, FLG2, DEFB128, and DEF4A/B, with multiple age groups. Few of the AMF genes showed a >2-fold increase with disease in any age group. Selected AMF exhibited significant positive correlations across the array of AMF that varied in health and disease. In contrast, a rather limited number of the AMF significantly correlated with members of the microbiome; most prominent in healthy samples. These correlated microbes were different in younger and older samples and differed in health, disease and resolution samples. The findings supported effects of age on the expression of AMF genes in healthy gingival tissues showing a relationship to members of the oral microbiome. Furthermore, a dynamic expression of AMF genes was related to the disease process and showed similarities across the age groups, except for low/very low expressed genes that were unaffected in young samples. Targeted assessment of AMF members from this large array may provide insight into differences in disease risk and biomolecules that provide some discernment of early transition to disease.

Streptococcus gordonii-Induced miRNAs Regulate CCL20 Responses in Human Oral Epithelial Cells.

The mechanisms through which oral commensal bacteria mitigates uncontrolled inflammatory responses of the oral mucosa remain unknown. Here, we show that representative oral bacterial species normally associated with oral health [S. gordonii (Sg), V. parvula (Vp), A. naeslundii (An), C. sputigena (Cs), and N. mucosa (Nm)] enhanced differential chemokine responses in oral epithelial cells (OECs), with some bacteria (An, Vp, and Nm) inducing higher chemokine levels (CXCL1, CXCL8) than others (Sg, Cs). Although all bacterial species (except Cs) increased CCL20 mRNA levels consistent with protein elevations in cell lysates, only An, Vp, and Nm induced higher CCL20 secretion, similar to the effect of the oral pathogen F. nucleatum (Fn). In contrast, most CCL20 remained associated with OECs exposed to Sg and negligible amounts released into the cell supernatants. Consistently, Sg attenuated An-induced CCL20. MiR-4516 and miR-663a were identified as Sg-specifically induced miRNAs modulating validated targets of chemokine-associated pathways. Cell transfection with miR-4516 and miR-663a decreased An- and Fn-induced CCL20. MiRNA upregulation and attenuation of An-induced CCL20 by Sg were reversed by catalase. Up-regulation of both miRNAs was specifically enhanced by oral streptococci H2O2-producers. These findings suggest that CCL20 levels produced by OECs in response to bacterial challenge are regulated by Sg-induced miR-4516 and miR-663a in a mechanism that involves hydrogen peroxide. This type of molecular mechanism could partly explain the central role of specific oral streptococcal species in balancing inflammatory and antimicrobial responses given the critical role of CCL20 in innate (antimicrobial) and adaptive immunity (modulates Th17 responses).

Transcriptomic phases of periodontitis lesions using the nonhuman primate model.

We used a nonhuman primate model of ligature-induced periodontitis to identify patterns of gingival transcriptomic after changes demarcating phases of periodontitis lesions (initiation, progression, resolution). A total of 18 adult Macaca mulatta (12-22 years) had ligatures placed (premolar, 1st molar teeth) in all 4 quadrants. Gingival tissue samples were obtained (baseline, 2 weeks, 1 and 3 months during periodontitis and at 5 months resolution). Gene expression was analyzed by microarray [Rhesus Gene 1.0 ST Array (Affymetrix)]. Compared to baseline, a large array of genes were significantly altered at initiation (n = 6049), early progression (n = 4893), and late progression (n = 5078) of disease, with the preponderance being up-regulated. Additionally, 1918 genes were altered in expression with disease resolution, skewed towards down-regulation. Assessment of the genes demonstrated specific profiles of epithelial, bone/connective tissue, apoptosis/autophagy, metabolism, regulatory, immune, and inflammatory responses that were related to health, stages of disease, and tissues with resolved lesions. Unique transcriptomic profiles occured during the kinetics of the periodontitis lesion exacerbation and remission. We delineated phase specific gene expression profiles of the disease lesion. Detection of these gene products in gingival crevicular fluid samples from human disease may contribute to a better understanding of the biological dynamics of the disease to improve patient management.

Oral Microbiome and Gingival Gene Expression of Inflammatory Biomolecules With Aging and Periodontitis.

Although data describe the presence and increase of inflammatory mediators in the local environment in periodontitis vs. health in humans, details regarding how these responses evolve in the transition from health to disease, changes during disease progression, and features of a resolved lesion remain unknown. This study used a nonhuman primate model of ligature-induced periodontitis in young, adolescent, adult, and aged animals to document features of inflammatory response affected by age. Rhesus monkeys had ligatures tied and provided gingival tissue biopsy specimens at baseline, 0.5, 1, and 3 months of disease and at 5 months of the study, which was 2 months post-ligature removal for clinically resolved tissues. The transcriptome was assessed using microarrays for chemokine (n = 41), cytokine (n = 45), chemokine receptor (n = 21), cytokine receptor (n = 37), and lipid mediator (n = 31) genes. Limited differences were noted in healthy tissues for chemokine expression with age; however, chemokine receptor genes were decreased in young but elevated in aged samples. IL1A, IL36A, and IL36G cytokines were decreased in the younger groups, with IL36A elevated in aged animals. IL10RA/IL10RB cytokine receptors were altered with age. Striking variation in the lipid mediator genes in health was observed with nearly 60% of these genes altered with age. A specific repertoire of chemokine and chemokine receptor genes was affected by the disease process, predominated by changes during disease initiation. Cytokine/cytokine receptor genes were also elevated with disease initiation, albeit IL36B, IL36G, and IL36RN were all significantly decreased throughout disease and resolution. Significant changes were observed in similar lipid mediator genes with disease and resolution across the age groups. Examination of the microbiome links to the inflammatory genes demonstrated that specific microbes, including Fusobacterium, P. gingivalis, F. alocis, Pasteurellaceae, and Prevotella are most frequently significantly correlated. These correlations were generally positive in older animals and negative in younger specimens. Gene expression and microbiome patterns from baseline were distinctly different from disease and resolution. These results demonstrate patterns of inflammatory gene expression throughout the phases of the induction of a periodontal disease lesion. The patterns show a very different relationship to specific members of the oral microbiome in younger compared with older animals.

Gingival tissue autophagy pathway gene expression profiles in periodontitis and aging.

OBJECTIVE: We hypothesized that autophagy-related genes will be differentially expressed in periodontitis, suggesting an impaired gingival autophagic response associated with disease. BACKGROUND: Autophagy is a cellular physiologic mechanism to maintain tissue homeostasis, while deficient autophagic responses increase inflammation and susceptibility to infection. METHODS: Rhesus monkeys [<3 years to 23 years of age (n = 34)] were examined for periodontal health and naturally occurring periodontitis. Gingival tissues samples were obtained from healthy or diseased sites, total RNA was isolated, and the Rhesus Gene Chip 1.0 ST (Affymetrix) was used for gene expression analysis of 150 autophagy-related genes. RESULTS: Comparison of expression levels with adult healthy tissues demonstrated a rather limited number of individual genes that were significantly different across the age-groups. In contrast, with periodontitis in the adults and aged animals, about 15% of the genes were significantly increased or decreased. The differences were reflected in the mTOR complex (5/12), ULK1/ATG1 complex (5/9), PI3K complex (5/21), ATG9 complex (2/7), ATG12 conjugation/LC3 lipidation (7/22), and lysosome fusion/vesicle degradation [LF/VD (5/10)] activities within the broader autophagic pathway. The genes most greatly altered in gingival tissues of naturally occurring periodontitis were identified in the ATG12 and LF/VD pathways that approximated 50% of the genes in each of those categories. While healthy gingival aging did not appear to reflect altered autophagy gene expression, substantial differences were noted with periodontitis irrespective of the age of the animals. Future studies into the role of autophagy in periodontitis and could offer potential new therapeutic strategies to prevent and/or treat periodontal disease.

Oral microbiome interactions with gingival gene expression patterns for apoptosis, autophagy and hypoxia pathways in progressing periodontitis.

Oral mucosal tissues must react with and respond to microbes comprising the oral microbiome ecology. This study examined the interaction of the microbiome with transcriptomic footprints of apoptosis, autophagy and hypoxia pathways during periodontitis. Adult Macaca mulatta (n = 18; 12-23 years of age) exhibiting a healthy periodontium at baseline were used to induce progressing periodontitis through ligature placement around premolar/molar teeth. Gingival tissue samples collected at baseline, 0·5, 1 and 3 months of disease and at 5 months for disease resolution were analysed via microarray. Bacterial samples were collected at identical sites to the host tissues and analysed using MiSeq. Significant changes in apoptosis and hypoxia gene expression occurred with initiation of disease, while autophagy gene changes generally emerged later in disease progression samples. These interlinked pathways contributing to cellular homeostasis showed significant correlations between altered gene expression profiles in apoptosis, autophagy and hypoxia with groups of genes correlated in different directions across health and disease samples. Bacterial complexes were identified that correlated significantly with profiles of host genes in health, disease and resolution for each pathway. These relationships were more robust in health and resolution samples, with less bacterial complex diversity during disease. Using these pathways as cellular responses to stress in the local periodontal environment, the data are consistent with the concept of dysbiosis at the functional genomics level. It appears that the same bacteria in a healthy microbiome may be interfacing with host cells differently than in a disease lesion site and contributing to the tissue destructive processes.

Oral Microbiome and Gingival Tissue Apoptosis and Autophagy Transcriptomics.

Objective: This study focused on documenting characteristics of the gingival transcriptome during various stages of periodontitis targeting genes associated with apoptotic and autophagic pathways and changes that specifically associate with features of the oral microbiome. Methods:Macaca mulatta (n = 18; 12-23 years) were examined at baseline and 0.5, 1, and 3 months of disease progression, as well as 5 months with clinical disease resolution. 16S sequencing and microarray analyses examined changes in the microbiome and gingival transcriptome, respectively, at each time point from every animal. Results: Specific patterns of apoptotic and autophagic genes were identified related to the initiation and progression of disease. The analysis also provided insights on the principal bacteria within the complex microbiome whose abundance was significantly correlated with differences in apoptotic and autophagic gene expression. Bacteria were identified that formed associated complexes with similar effects on the host gene expression profiles. A complex of Leptotrichia_unclassifed, Capnocytophaga_unclassified, Prevotella sp. 317, and Veillonellaceae_[G-1] sp. 155 were significantly negatively correlated with both apoptosis and autophagy. Whereas, Veillonellaceae_[G-1], Porphyromonadaceae, and F. alocis 539 were significantly positively correlated with both pathways, albeit this relationship was primarily associated with pro-apoptotic genes. Conclusions: The findings provide evidence for specific bacteria/bacterial complexes within the oral microbiome that appear to have a more substantive effect on regulating apoptotic and autophagic pathways in the gingival tissues with periodontitis.

Microbiome Profiles of Ligature-Induced Periodontitis in Nonhuman Primates across the Life Span.

This investigation compared the microbiomes colonizing teeth during the initiation, progression, and resolution of periodontitis in nonhuman primates (Macaca mulatta) at different ages. Subgingival plaque samples were collected at baseline; 0.5, 1, and 3 months following ligature-induced periodontitis; and following naturally occurring disease resolution at 5 months. Samples were analyzed using 16S amplicon sequencing to identify bacterial profiles across age groups: young (<3 years of age), adolescent (3 to 7 years), adult (12 to 15 years), and aged (17 to 23 years). α-Diversity of the microbiomes was greater in the adult/aged samples than in the young/adolescent samples. ß-Diversity of the samples demonstrated clear age group differences, albeit individual variation in microbiomes between animals within the age categories was noted. Phylum distributions differed between the young/adolescent animals and the adult/aged animals at each of the time points, showing an enrichment of the phyla Spirochetes, Fusobacteria, and Bacteroidetes associated with periodontitis. Major differences in the top 50 operational taxonomic units (OTUs) were noted in the young and adolescent microbiomes during initiation and progression postligation compared to the adult and aged animals. The proportions of a large number of species in the top 50 OTUs were lower at baseline and in resolved disease microbiomes in the young samples, while profiles in adolescent animals were more consistent with the disease microbiomes. Microbiome profiles for resolution for adults and aged animals appeared more resilient and generally maintained a pattern similar to that of disease. Use of the model can expand our understanding of the crucial interactions of the oral microbiome and host responses in periodontitis.

Correction: Activation of Notch-1 in oral epithelial cells by P. gingivalis triggers the expression of the antimicrobial protein PLA2-IIA.

The sequence for the Reverse primer used to amplify the human gene PLA2G2A presented in table 1 is incorrect. The following, is the correct sequence: Reverse 5' - GCTCCCTCTGCAGTGTTTATT -3.

Gene expression analysis of neuropeptides in oral mucosa during periodontal disease in non-human primates.

BACKGROUND: Neuropeptides (NPs) are innate pivotal regulators of the immunoinflammatory response. Nevertheless, their role in the pathogenesis of periodontal disease remains unknown. Changes in gene expression of 10 NPs and 16 NP receptors (NPRs) coincident with the initiation, progression, and resolution of periodontitis were determined. METHODS: The ligature-induced periodontitis model was used in rhesus monkeys (n = 18). Gingival tissue samples were taken at baseline (preligatures), at 2 weeks and at 1 month (initiation), and at 3 months (progression) postligation. Ligatures were removed and samples taken 2 months later (resolution). Total RNA was isolated from tissues and NP/NPR gene expression microarray analysis was performed. Gene expression changes were validated by quantitative polymerase chain reaction and immunohistochemistry. RESULTS: Unexpectedly, the expression of pro-inflammatory NPs/NPRs did not change during periodontitis or with resolution. However, increased expression of the anti-inflammatory NPs adrenomedullin (ADM) and galanin (GAL), and the NPRs calcitonin receptor-like (CALCRL) and receptor activity-modifying protein-2 and -3 (RAMP2 and RAMP3) were observed during initiation and progression of disease. The expression of the same NPs/NPRs exhibited a significant positive correlation with both molecular (interleukin-1ß, matrix mettaloproteinase-9, and receptor activator of nuclear factor-kappa B ligand) and clinical measures of gingival inflammation and tissue destruction. CONCLUSION: Initiation and progression of periodontitis involve significant overexpression of ADM, GAL, CALCRL, RAMP2, and RAMP3. These anti-inflammatory NPs/NPRs could play a role in the unresolved infection and inflammation that normally drives tissue destruction in periodontitis. Both ADM and GAL potentially are new candidates to consider as biomolecules associated with periodontal disease activity.

Activation of Notch-1 in oral epithelial cells by P. gingivalis triggers the expression of the antimicrobial protein PLA2-IIA.

P. gingivalis (Pg) is an oral pathogen with the ability to induce oral dysbiosis and periodontal disease. Nevertheless, the mechanisms by which mucosal responses to the oral microbiota in the presence of specific pathogens such as Pg could abrogate the host-microbe symbiotic relationship leading to periodontitis remain unclear. Herein, we identified the Notch-1/PLA2-IIA axis as a new molecular pathway through which Pg could be specifically modulating oral epithelial antimicrobial and inflammatory responses. Pg activated Notch-1, and inhibition or silencing of Notch-1 completely abrogated Pg-induced PLA2-IIA in oral epithelial cells (OECs). Activation of Notch-1 and PLA2-IIA production were associated with Pg-produced gingipains. Other oral Gram-positive and Gram-negative species failed to induce similar responses. Pg enhanced OEC antimicrobial activity through PLA2-IIA. Increased Notch-1 activation correlated with higher PLA2-IIA gingival expression and changes in the abundance of specific oral bacteria phyla during periodontal disease. Oral bacterial species exhibited differential antimicrobial susceptibility to PLA2-IIA. These findings support previous evidence suggesting an important role for epithelial Notch-1 activation and PLA2-IIA production during health and disease at mucosal surfaces, and provide new mechanistic information concerning the regulation of epithelial antimicrobial and pro-inflammatory responses modulated by oral pathogenic bacteria associated with periodontal disease.

Hypoxia-inducible transcription factors, HIF1A and HIF2A, increase in aging mucosal tissues.

Hypoxia (i.e. oxygen deprivation) activates the hypoxia-signalling pathway, primarily via hypoxia-inducible transcription factors (HIF) for numerous target genes, which mediate angiogenesis, metabolism and coagulation, among other processes to try to replenish tissues with blood and oxygen. Hypoxia signalling dysregulation also commonly occurs during chronic inflammation. We sampled gingival tissues from rhesus monkeys (Macaca mulatta; 3-25 years old) and total RNA was isolated for microarray analysis. HIF1A, HIF1B and HIF2A were significantly different in healthy aged tissues, and both HIF1A and HIF3A were positively correlated with aging. Beyond these transcription factor alterations, analysis of patterns of gene expression involved in hypoxic changes in tissues showed specific increases in metabolic pathway hypoxia-inducible genes, whereas angiogenesis pathway gene changes were more variable in healthy aging tissues across the animals. With periodontitis, aging tissues showed decreases in metabolic gene expression related to carbohydrate/lipid utilization (GBE1, PGAP1, TPI1), energy metabolism and cell cycle regulation (IER3, CCNG2, PER1), with up-regulation of transcription genes and cellular proliferation genes (FOS, EGR1, MET, JMJD6) that are hypoxia-inducible. The potential clinical implications of these results are related to the epidemiological findings of increased susceptibility and expression of periodontitis with aging. More specifically the findings describe that hypoxic stress may exist in aging gingival tissues before documentation of clinical changes of periodontitis and, so, may provide an explanatory molecular risk factor for an elevated capacity of the tissues to express destructive processes in response to changes in the microbial biofilms characteristic of a more pathogenic microbial challenge.

The periodontal war: microbes and immunity.

Maintenance of periodontal health or transition to a periodontal lesion reflects the continuous and ongoing battle between the vast microbial ecology in the oral cavity and the array of resident and emigrating inflammatory/immune cells in the periodontium. This war clearly signifies many 'battlefronts' representing the interface of the mucosal-surface cells with the dynamic biofilms composed of commensal and potential pathogenic species, as well as more recent knowledge demonstrating active invasion of cells and tissues of the periodontium leading to skirmishes in connective tissue, the locality of bone and even in the local vasculature. Research in the discipline has uncovered a concerted effort of the microbiome, using an array of survival strategies, to interact with other bacteria and host cells. These strategies aid in colonization by 'ambushing, infiltrating and outflanking' host cells and molecules, responding to local environmental changes (including booby traps for host biomolecules), communicating within and between genera and species that provide MASINT (Measurement and Signature Intelligence) to enhance sustained survival, sabotage the host inflammatory and immune responses and by potentially adopting a 'Fabian strategy' with a war of attrition and resulting disease manifestations. Additionally, much has been learned regarding the ever-increasing complexity of the host-response armamentarium at both cellular and molecular levels that is addressed in this review. Knowledge regarding how these systems fully interact requires both new laboratory and clinical tools, as well as sophisticated modeling of the networks that help maintain homeostasis and are dysregulated in disease. Finally, the triggers resulting in a 'coup de main' by the microbiome (exacerbation of disease) and the characteristics of susceptible hosts that can result in 'pyrrhic victories' with collateral damage to host tissues, the hallmark of periodontitis, remains unclear. While much has been learned, substantial gaps in our understanding of the 'parameters of this war' remain elusive toward fulfilling the Sun Tzu adage: 'If you know the enemy and know yourself, you need not fear the result of a hundred battles.'