High-grade B-cell lymphoma, not otherwise specified: a multi-institutional retrospective study.

In this multi-institutional retrospective study, we examined the characteristics and outcomes of 160 patients with high-grade B-cell lymphoma, not otherwise specified (HGBL-NOS)-a rare category defined by high-grade morphologic features and lack of MYC rearrangements with BCL2 and/or BCL6 rearrangements ("double hit"). Our results show that HGBL-NOS tumors are heterogeneous: 83% of patients had a germinal center B-cell immunophenotype, 37% a dual-expressor immunophenotype (MYC and BCL2 expression), 28% MYC rearrangement, 13% BCL2 rearrangement, and 11% BCL6 rearrangement. Most patients presented with stage IV disease, a high serum lactate dehydrogenase, and other high-risk clinical factors. Most frequent first-line regimens included dose-adjusted cyclophosphamide, doxorubicin, vincristine, and etoposide, with rituximab and prednisone (DA-EPOCH-R; 43%); rituximab, cyclophosphamide, doxorubicin, vincristine, and prednisone (R-CHOP; 33%); or other intensive chemotherapy programs. We found no significant differences in the rates of complete response (CR), progression-free survival (PFS), or overall survival (OS) between these chemotherapy regimens. CR was attained by 69% of patients. PFS at 2 years was 55.2% and OS was 68.1%. In a multivariable model, the main prognostic factors for PFS and OS were poor performance status, lactate dehydrogenase >3 × upper limit of normal, and a dual-expressor immunophenotype. Age >60 years or presence of MYC rearrangement were not prognostic, but patients with TP53 alterations had a dismal PFS. Presence of MYC rearrangement was not predictive of better PFS in patients treated with DA-EPOCH-R vs R-CHOP. Improvements in the diagnostic criteria and therapeutic approaches beyond dose-intense chemotherapy are needed to overcome the unfavorable prognosis of patients with HGBL-NOS.

Influence of Different Bacteria Species in Chemical Composition and Sensory Properties of Fermented Spirulina.

Fermented Spirulina (FS) could be a good strategic approach for diversifying algae-derived formulations to a current functional food market. In this study, microbial properties, total and free amino acids, protein hydrolysis, volatile organic compounds (VOCs) and sensory properties of FS and unfermented Spirulina (unFS) products by four different Lactic acid bacteria (LAB) and three different Bacillus strains were examined. The highest proteolytic activity with LAB strains was confirmed by SDS-PAGE. The increase in both total amino acid (TAA) and total essential amino acid (TEAA) concentrations were in the highest level for FS products by Bacillus strains, 70535.5 µM and 22295.4 µM, respectively. The pyrazine content, the most prevalent VOCs in unFS, reduced more remarkably in FS by LAB strains. Furthermore, the most acceptable sensory characteristics were obtained with FS products by LAB strains. These findings will provide insights toward achieving the industrialization of FS products.

CD5 expression in marginal zone lymphoma predicts differential response to rituximab or bendamustine/rituximab.

We examined outcomes of 244 patients with marginal zone lymphoma (MZL) diagnosed in 2010-2020, of which 25 (10%) expressed CD5. CD5 expression was present in 22% of splenic, 8% of nodal, and 5% of extranodal MZL, and showed frequent blood/bone marrow involvement, elevated lactate dehydrogenase, and TP53 deletions. CD5 expression was not associated with progression-free or overall survival, but it conferred a significantly higher risk of histologic transformation (22% versus 4% at 5 years, p = 0.002). Among patients receiving first-line rituximab monotherapy, CD5 expression was associated with lower response rate (30% versus 77%, p = 0.006), PFS (25% versus 45% at 3 years, p = 0.003) and OS (44% versus 77%, p = 0.010), whereas CD5 status did not significantly affect outcomes of patients receiving bendamustine with rituximab (P for interaction = 0.012 for progression-free survival). CD5-positive MZL may have a propensity to leukemic dissemination, histologic transformation, and may derive benefit from first-line bendamustine/rituximab rather than rituximab alone.

Defining and treating high-grade B-cell lymphoma, NOS.

High-grade B-cell lymphoma (HGBL), not otherwise specified (NOS), is a recently introduced diagnostic category for aggressive B-cell lymphomas. It includes tumors with Burkitt-like or blastoid morphology that do not have double-hit cytogenetics and that cannot be classified as other well-defined lymphoma subtypes. HBCLs, NOS, are rare and heterogeneous; most have germinal center B-cell phenotype, and up to 45% carry a single-hit MYC rearrangement, but otherwise, they have no unifying immunophenotypic or cytogenetic characteristics. Recent analyses using gene expression profiling (GEP) revealed that up to 15% of tumors currently classified as diffuse large B-cell lymphoma display an HGBL-like GEP signature, indicating a potential to significantly expand the HGBL category using more objective molecular criteria. Optimal treatment of HGBL, NOS, is poorly defined because of its rarity and inconsistent diagnostic patterns. A minority of patients have early-stage disease, which can be managed with standard R-CHOP-based approaches with or without radiation therapy. For advanced-stage HGBL, NOS, which often presents with aggressive disseminated disease, high lactate dehydrogenase, and involvement of extranodal organs (including the central nervous system [CNS]), intensified Burkitt lymphoma-like regimens with CNS prophylaxis may be appropriate. However, many patients diagnosed at age >60 years are not eligible for intensive immunochemotherapy. An improved GEP- and/or genomic-based pathologic classification that could facilitate HGBL-specific trials is needed to improve outcomes for all patients. In this review, we discuss the current clinicopathologic concept of HGBL, NOS, and existing data on its prognosis and treatment and delineate potential future taxonomy enrichments based on emerging molecular diagnostics.

Detection of clonotypic DNA in the cerebrospinal fluid as a marker of central nervous system invasion in lymphoma.

The diagnosis of parenchymal central nervous system (CNS) invasion and prediction of risk for future CNS recurrence are major challenges in the management of aggressive lymphomas, and accurate biomarkers are needed to supplement clinical risk predictors. For this purpose, we studied the results of a next-generation sequencing (NGS)-based assay that detects tumor-derived DNA for clonotypic immunoglobulin gene rearrangements in the cerebrospinal fluid (CSF) of patients with lymphomas. Used as a diagnostic tool, the NGS-minimal residual disease (NGS-MRD) assay detected clonotypic DNA in 100% of CSF samples from 13 patients with known CNS involvement. They included 7 patients with parenchymal brain disease only, whose CSF tested negative by standard cytology and flow cytometry, and 6 historical DNA aliquots collected from patients at a median of 39 months before accession, which had failed to show clonal rearrangements using standard polymerase chain reaction. For risk prognostication, we prospectively collected CSF from 22 patients with newly diagnosed B-cell lymphomas at high clinical risk of CNS recurrence, of whom 8 (36%) had detectable clonotypic DNA in the CSF. Despite intrathecal prophylaxis, a positive assay of CSF was associated with a 29% cumulative risk of CNS recurrence within 12 months of diagnosis, in contrast with a 0% risk among patients with negative CSF (P = .045). These observations suggest that detection of clonotypic DNA can aid in the diagnosis of suspected parenchymal brain recurrence in aggressive lymphoma. Furthermore, the NGS-MRD assay may enhance clinical risk assessment for CNS recurrence among patients with newly diagnosed lymphomas and help select those who may benefit most from novel approaches to CNS-directed prophylaxis.

Primary Effusion Lymphoma: A Clinicopathological Study of 70 Cases.

Primary effusion lymphoma (PEL) is a rare type of large B-cell lymphoma associated with human herpesvirus 8 (HHV8) infection. Patients with PEL usually present with an effusion, but occasionally with an extracavitary mass. In this study, we reported a cohort of 70 patients with PEL: 67 men and 3 women with a median age of 46 years (range 26-91). Of these, 56 (80%) patients had human immunodeficiency virus (HIV) infection, eight were HIV-negative, and six had unknown HIV status. Nineteen (27%) patients had Kaposi sarcoma. Thirty-five (50%) patients presented with effusion only, 27 (39%) had an extracavitary mass or masses only, and eight (11%) had both effusion and extracavitary disease. The lymphoma cells showed plasmablastic, immunoblastic, or anaplastic morphology. All 70 (100%) cases were positive for HHV8. Compared with effusion-only PEL, patients with extracavitary-only PEL were younger (median age, 42 vs. 52 years, p = 0.001), more likely to be HIV-positive (88.9% vs. 68.6%, p = 0.06) and EBV-positive (76.9% vs. 51.9%, p = 0.06), and less often positive for CD45 (69.2% vs. 96.2%, p = 0.01), EMA (26.7% vs. 100%, p = 0.0005), and CD30 (60% vs. 81.5%, p = 0.09). Of 52 (50%) patients with clinical follow-up, 26 died after a median follow-up time of 40.0 months (range 0-96), and the median overall survival was 42.5 months. The median OS for patients with effusion-only and with extracavitary-only PEL were 30.0 and 37.9 months, respectively (p = 0.34), and patients with extracavitary-only PEL had a lower mortality rate at the time of last follow-up (35% vs. 61.5%, p = 0.07). The median OS for HIV-positive and HIV-negative patients were 42.5 and 6.8 months, respectively (p = 0.57), and they had a similar mortality rate of 50% at last follow-up. In conclusion, patients presenting with effusion-only versus extracavitary-only disease are associated with different clinicopathologic features. PEL is an aggressive lymphoma with a poor prognosis, regardless of extracavitary presentation or HIV status.

Diffuse Large B-Cell Lymphoma During Third-Trimester Pregnancy and Lactation.

BACKGROUND: Diffuse large B-cell lymphoma is the most common type of non-Hodgkin's lymphoma affecting pregnancy. These tumors may be aggressive and rapidly growing in pregnancy. Management is based on the balance of risks and benefits to both the pregnant patient and the fetus. CASE: We present a case of diffuse large B-cell lymphoma diagnosed in the third trimester of pregnancy. The patient underwent labor induction at 34 weeks of gestation, started a standard chemotherapy protocol postpartum, and breastfed following a timed lactation protocol. CONCLUSION: Management of lymphoma during pregnancy highlights the need to consider all aspects of proposed oncologic and obstetric care as well as neonatal risks. Considerations highlighted in this case include staging methods, administration of antenatal steroids, timing of delivery, and lactation during chemotherapy.

Characterization of IDH1 p.R132H Mutant Clones Using Mutation-specific Antibody in Myeloid Neoplasms.

Isocitrate dehydrogenase 1 (IDH1) and IDH2 mutations occur in a variety of myeloid neoplasms. Immunohistochemistry (IHC)-based direct visualization of mutant clones of hematopoietic cells can be useful for rapid diagnostic screening and for monitoring treatment response. In this study, we first evaluated the sensitivity and specificity of the IDH1 p.R132H mutation-specific antibody by IHC. All IDH1 wild type cases (n=11) and IDH1 mutant cases with a non-p.R132H mutation (n=30) were negative by IHC, demonstrating 100% antibody specificity. All the initial diagnostic specimens with IDH1 p.R132H mutation including acute myeloid leukemia (n=30), myelodysplastic syndromes (MDS) (n=10), MDS/myeloproliferative neoplasms (MPN) (n=4), and MPN (n=5) were positive by IHC, demonstrating 100% antibody sensitivity. Both immature and mature myeloid cells showed immunoreactivity. Erythroid precursors, lymphoid cells, endothelial cells, and osteoblasts were consistently negative by IHC. We then evaluated the follow-up specimens with a known IDH1 mutation status including acute myeloid leukemia (n=23), MDS (n=2), MDS/MPN (n=2), and MPN (n=2). Thirty-three IDH1 p.R132H mutant cases were positive by IHC and 12 IDH1 mutation negative cases were negative by IHC. However, IHC reactivity in up to 25% of bone marrow cells was noted in 8 of 20 polymerase chain reaction-negative cases, all from patients with a known history of IDH1 p.R132H mutation indicating sampling error or a sensitivity issue with molecular tests. These data indicate that IHC is a highly specific and sensitive tool to detect IDH1 p.R132H mutation in bone marrow involved by myeloid neoplasms. In addition, IDH1 p.R132H IHC also allows localization and assessment of the maturation stage of the clones carrying the mutation.

Secondary Philadelphia chromosome acquired during therapy of acute leukemia and myelodysplastic syndrome.

The Philadelphia chromosome resulting from t(9;22)(q34;q11.2) or its variants is a defining event in chronic myeloid leukemia. It is also observed in several types of de novo acute leukemia, commonly in B lymphoblastic leukemia, and rarely in acute myeloid leukemia, acute leukemia of ambiguous lineage, and T lymphoblastic leukemia. Acquisition of the Philadelphia chromosome during therapy of acute leukemia and myelodysplastic syndrome is rare. We reported 19 patients, including 11 men and 8 women with a median age of 53 years at initial diagnosis. The diagnoses at initial presentation were acute myeloid leukemia (n = 11), myelodysplastic syndrome (n = 5), B lymphoblastic leukemia (n = 2), and T lymphoblastic leukemia (n = 1); no cases carried the Philadelphia chromosome. The Philadelphia chromosome was detected subsequently at relapse, or at refractory stage of acute leukemia or myelodysplastic syndrome. Of 14 patients evaluated for the BCR-ABL1 transcript subtype, 12 had the e1a2 transcript. In 11 of 14 patients, the diseases before and after emergence of the Philadelphia chromosome were clonally related by karyotype or shared gene mutations. Of 15 patients with treatment information available, 7 received chemotherapy alone, 5 received chemotherapy plus tyrosine kinase inhibitors, 2 received tyrosine kinase inhibitors only, and 1 patient was not treated. Twelve patients had follow-up after acquisition of the Philadelphia chromosome; all had persistent/refractory acute leukemia. Thirteen of 15 patients died a median of 3 months after the emergence of the Philadelphia chromosome. In summary, secondary Philadelphia chromosome acquired during therapy is rare, and is associated with the e1a2 transcript subtype, terminal disease stage, and poor outcome.

Chronic lymphoproliferative disorder of NK-cells: A single-institution review with emphasis on relative utility of multimodality diagnostic tools.

BACKGROUND: Chronic lymphoproliferative disorder of NK-cells (CLPD-NK) manifests as a persistent increase (≥2 × 109 /L, for > 6 months) of mature NK-cells in peripheral blood with an indolent clinical course. The disease is rare, and only limited case series have been published. METHODS: We retrospectively studied 11 patients with CLPD-NK diagnosed at our institution between 2005 and 2017. RESULTS: Patients included 7 men and 4 women with a median age of 60 years (range, 25-89 years). Ten patients (91%) had cytopenias. Bone marrow involvement by CLPD-NK ranged from 5-15%. The most commonly detected antigenic aberrancies by  low cytometry immunophenotyping were as follows: CD7decreased/dim (30%), CD8uniform+ (36%), CD56-/partial (73%), CD94bright (55%), and KIR restriction (100%). JAK/STAT pathway mutations were detected in 8 of 10 (80%) patients and involved STAT3 (n = 7) and JAK3 (n = 1). The presence of mutations tended to correlate with the occurrence of other cytopenias (anemia/thrombocytopenia) and requirement for treatment. Seven patients received single-agent therapy, with amelioration of symptoms; 4 patients were observed. There were no disease-associated deaths or progression to more aggressive disease during the follow-up interval (median, 17 months). CONCLUSIONS: Patients with CLPD-NK have an indolent clinical course and frequent hematologic manifestations that are responsive to single-agent therapy. Mutations in STAT3 are common and portend more pronounced clinical manifestations.

Human Cytomegalovirus is Present in Alveolar Soft Part Sarcoma.

Alveolar soft part sarcoma (ASPS) is an exquisitely rare sarcoma of unknown histogenesis, with a predilection for adolescents and young adults, characterized by slow progressive clinical course and high frequency of metastases. They are traditionally chemoresistant with very limited treatment options in the metastatic setting. Human cytomegalovirus (HCMV) is a DNA ß-herpes virus and it is characterized by persistent lifelong and latent infection. There is growing evidence to indicate the presence of HCMV proteins and nucleic acids in glioblastoma, medulloblastoma, rhabdomyosarcoma, and a variety of solid organ malignancies of the breast, prostate, lung, and colon at very high prevalence. Immunotherapy-based clinical trials targeting specific cytomegalovirus proteins are currently in progress in the treatment of glioblastoma. Herein, we evaluated for the presence of HCMV proteins (IE1 and pp65), genes (US28 and UL96), and RNA in a cohort of ASPS. Six confirmed cases of ASPS were retrieved and full thickness sections of formalin-fixed paraffin-embedded material were stained for anti-HMCV-IE1 and anti-HCMV-pp65. Any nuclear and/or cytoplasmic staining was considered positive. DNA was purified from 50 µm of formalin-fixed paraffin-embedded material. One hundred nanogram of DNA was amplified using polymerase chain reaction for primers specific to HCMV-US28 (forward: AGCGTGCCGTGTACGTTAC and reverse: ATAAAGACAAGCACGACC) and HCMV-UL96 (forward: ACAGCTCTTAAAGGACGTGATGCG and reverse: ACCGTGTCCTTCAGCTCGGTTAAA) using Promega Taq polymerase. HCMV in situ hybridization was performed. All 6 cases of ASPS were positive for both HCMV-IE1 and HCMV-pp65. Usable DNA was available in 4 of the 6 cases. HCMV-US28 gene was found in 75% (3/4) of cases and HCMV-UL96 gene was detected in 50% (2/4) of cases. Importantly, all cases tested positive for at least 1 gene. HCMV-encoded RNA was identified in 80% (4/5) of cases. The presence of HCMV DNA, RNA along with HCMV protein indicates that HCMV is present in ASPS and may contribute to its pathogenesis.

Massive localized lymphedema: a clinicopathologic study of 46 patients with an enrichment for multiplicity.

Massive localized lymphedema is a monstrous tumefactive pseudosarcoma seen in middle-aged morbidly obese adults. Since its initial description in 1998, the etiology remains unknown, although associations with trauma, surgeries, and hypothyroidism have been reported. Herein, we report the largest study of massive localized lymphedema and expand upon its clinicopathologic features. Fifty-four cases from 46 patients were retrospectively identified from the institutional archives of The Ohio State University Wexner Medical Center between 2002 and 2015. Forty-six patients (21 males and 25 females, mean age 50 years) presented with large masses developing over a 5-60-month period. The majority of patients were Caucasian (n=39). All patients were obese with a mean weight of 384.7 lb and a mean body mass index of 59.6 kg/m(2). Thirty-six patients had a history of atherosclerotic cardiovascular disease and diabetes mellitus type 2 was present in 22 patients. Eight patients had multifocal massive localized lymphedema. The sites included thigh (n=33), abdomen (n=17), suprapubic region (n=1), mons pubis (n=6), scrotum (n=2), perianal region (n=1), and right flank (n=1). Mostly, the clinical impression was benign processes, including pannus or lymphedema pseudotumor. Grossly, the mean weight was 8237 g and the mean size was 53.2 cm. Histologically, eight cases showed a unique pattern of dystrophic calcifications mimicking hyperchromatic, atypical nuclei that might lead to misdiagnosis of liposarcoma, four cases showed focal metaplastic ossification, and three cases showed multinucleated cells in addition to prototypic features of massive localized lymphedema. We report that this is the largest series of massive localized lymphedema. This is a lesion mostly seen in morbidly obese patients and the thigh is the most common site of involvement. We note a marked racial predilection for Caucasians and a tendency towards multiplicity. We suggest that obesity itself and the related metabolic syndrome have an important role in its pathogenesis.