Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 43
Filtrar
1.
Plant Pathol J ; 40(2): 125-138, 2024 Apr.
Artigo em Inglês | MEDLINE | ID: mdl-38606443

RESUMO

Citrus yellow vein clearing virus (CYVCV) is a member of the Alphaflexiviridae family that causes yellow vein clearing symptoms on citrus leaves. A total of 118 leaf samples from nine regions of six provinces in Korea were collected from various citrus species in 2020 and 2021. Viral diagnosis using next-generation sequencing and reverse transcription polymerase chain reaction (RT-PCR) identified four viruses: citrus tristeza virus, citrus leaf blotch virus, citrus vein enation virus, and CYVCV. A CYVCV incidence of 9.3% was observed in six host plants, including calamansi, kumquat, Persian lime, and Eureka lemon. Among the citrus infected by CYVCV, only three samples showed a single infection; the other showed a mixed infection with other viruses. Eureka lemon and Persian lime exhibited yellow vein clearing, leaf distortion, and water-soak symptom underside of the leaves, while the other hosts showed only yellowing symptoms on the leaves. The complete genome sequences were obtained from five CYVCV isolates. Comparison of the isolates reported from the different geographical regions and hosts revealed the high sequence identity (95.2% to 98.8%). Phylogenetic analysis indicated that all the five isolates from Korea were clustered into same clade but were not distinctly apart from isolates from China, Pakistan, India, and Türkiye. To develop an efficient diagnosis system for the four viruses, a simultaneous detection method was constructed using multiplex RT-PCR. Sensitivity evaluation, simplex RT-PCR, and stability testing were conducted to verify the multiplex RT-PCR system developed in this study. This information will be useful for developing effective disease management strategies for citrus growers in Korea.

2.
Plant Dis ; 2023 Aug 08.
Artigo em Inglês | MEDLINE | ID: mdl-37552167

RESUMO

Spuriopimpinella brachycarpa Nakai (Common name, Chamnamul; family Apiaceae) is a plant whose leaves are consumed as a vegetable and used as a folk medicine in Korea (Kim et al., 2020). In February 2020, seven samples of S. brachycarpa leaf showing virus symptoms including yellowing, vein chlorosis, chlorotic lesions, and severe mottling were collected from a greenhouse in Busan, South Korea, to diagnose the potential disease (Fig. S1a, b). The disease incidence rate in the greenhouse was >10% (2,970 m2). To identify the causal virus, we analyzed leaf dip preparation and thin sections of the symptomatic leaves by transmission electron microscopy. Filamentous virus particles and pinwheel structures were observed, indicating the presence of a potyvirus (Fig. S1c, d). To confirm these results, the symptomatic leaf samples were further analyzed by reverse-transcription polymerase chain reaction (RT-PCR) using potyvirus universal primers (Table S2) and direct sequencing of the PCR products. All samples were positive for konjac mosaic virus (KoMV). To exclude the possibility of infection by multiple viruses, we performed high-throughput sequencing (HTS) on an Illumina NovaSeq 6000 system (Macrogen Inc., Seoul, South Korea). There were two contigs (9,267 and 2,851 nt) mapping to KoMV sequences. A large contig (9,267 nt; 705,967 mapped reads; mean read coverage of 11,351.4x) showed about 80% identity (93% coverage) with KoMV-F (GenBank accession no. NC_007913) isolated from Amorphophallus konjac in Japan (Nishiguchi et al., 2006). To isolate KoMV from S. brachycarpa, we mechanically inoculated leaf extracts from symptomatic samples onto Chenopodium quinoa as an assay host via three single-lesion passages, followed by propagation in Nicotiana benthamiana. In a bioassay of the KoMV isolate (KoMV-BS), we mechanically inoculated sap from infected N. benthamiana onto 31 indicator plants including Cryptotaenia japonica (Apiaceae), which is similar to S. brachycarpa (Table S3). KoMV-BS systemically induced vein chlorosis and/or leaf mottling in four Nicotiana species and C. japonica, and chlorotic local lesions in upper leaves of C. quinoa; no symptoms were observed in 25 other indicator plants. These results were confirmed by RT-PCR. Next, we obtained the complete genome sequence of KoMV-BS using HTS and 5' and 3' rapid amplification of cDNA ends, with newly designed primers (Table S2). The assembled full-length KoMV-BS genome sequence was 9,392 nt in length, excluding the poly(A) tail, and encoded a polyprotein composed of 3,060 amino acids. The sequence was deposited in GenBank (accession no. OR001914). BLAST analysis showed 84~88% and 90~98% identities at CP nucleotide and amino acid levels, respectively with the reported KoMV isolates, confirming the virus to be an isolate of KoMV (synonym; Japanese hornwort mosaic virus, zantedeschia mosaic virus) (Adams et al., 2005; Nishiguchi et al., 2006). KoMV infection was first reported in A. konjac from Japan (Shimoyama et al. 1992) and has been spread worldwide as one of the major causal agents of viral diseases in calla lily (Liao et al., 2020). To the best of our knowledge, this is the first report of KoMV infection in S. brachycarpa. To date, cucumber mosaic virus and tobacco mosaic virus have been reported to infect S. brachycarpa in Korea (Yoon et al., 2016; 2017). Our findings will be helpful for developing virus-management strategies to prevent yield and quality loss in S. brachycarpa.

3.
Plant Dis ; 2023 Jun 09.
Artigo em Inglês | MEDLINE | ID: mdl-37294155

RESUMO

Radish (Raphanus sativus L.) is an important root vegetable widely consumed in kimchi in Korea. In October 2021, radish leaves with virus-like symptoms of mosaic and yellowing were collected in three fields around Naju, Korea (Fig. S1). A pooled sample (n = 24) was screened for causal viruses by high-throughput sequencing (HTS), with detection confirmed by reverse transcription (RT) PCR. Total RNA was extracted from symptomatic leaves using the Plant RNA Prep kit (Biocube System, Korea), and a cDNA library was constructed and sequenced on an Illumina NovaSeq 6000 system (Macrogen, Korea). De novo transcriptome assembly yielded 63,708 contigs, which were analyzed against the viral reference genome database in GenBank by BLASTn and BLASTx searches. Two large contigs were clearly of viral origin. BLASTn analysis showed that a 9,842-bp contig (4,481,600 mapped reads, mean read coverage 68,758.6×) had 99% identity (99% coverage) with isolate CCLB of turnip mosaic virus (TuMV) from radish in China (KR153038). A second contig of 5,711 bp (7,185 mapped reads, mean read coverage 189.9×) had 97% identity (99% coverage) with isolate SDJN16 of beet western yellows virus (BWYV) from Capsicum annuum in China (MK307779). To confirm the presence of these viruses, total RNA extracted from 24 leaf samples was subjected to RT-PCR using primers specific for TuMV (N60_5'-ACATTGAAAAGCGTAACCA-3' and C30_5'-TCCCATAAGCGAGAATACTAACGA-3', amplicon 356 bp) and BWYV (95F_5'-CGAATCTTGAACACAGCAGAG-3' and 784R_5'-TGTGGG ATCTTGAAGGATAGG-3', amplicon 690 bp) for virus detection. Of the 24 samples, 22 were positive for TuMV and 7 were co-infected with BWYV. Single infection of BWYV was not detected. Infection with TuMV, the predominant virus in radish in Korea, was previously reported (Choi and Choi, 1992; Chung et al., 2015). To determine the complete genomic sequence of the BWYV isolate (BWYV-NJ22) from radish, RT-PCR was conducted using eight overlapping primer pairs designed according to the alignment of previously reported BWYV sequences (Table S2). Terminal sequences of the viral genome were analyzed by 5' and 3' rapid amplification of cDNA ends (RACE; Thermo Fisher Scientific Corp.). The assembled complete genome sequence of BWYV-NJ22 was 5,694 nt long and was deposited in GenBank (accession no. OQ625515). The Sanger sequences shared 96% nt identity with the HTS-derived sequence. BLASTn analysis showed that BWYV-NJ22 had high nucleotide identity (98%) at the complete genome level with a BWYV isolate (OL449448) from C. annuum in Korea. BWYV (genus Polerovirus, family Solemoviridae), is an aphid-borne virus with a host range that includes > 150 plant species and is one of the most important viruses causing yellowing and stunting of vegetable crops (Brunt et al., 1996; Duffus 1973). In Korea, BWYV was first reported to infect paprika, followed by pepper, motherwort, and figwort (Jeon et al., 2021; Kwon et al., 2016; 2018; Park et al., 2018). During fall and winter 2021, 675 radish plants with virus-like symptoms of mosaic, yellowing, and chlorosis were collected from 129 farms in major cultivation areas in Korea and analyzed by RT-PCR using the BWYV detection primers. The incidence of BWYV in radish plants was 4.7%, and all infections were mixed infections with TuMV. To our knowledge, this is the first report of BWYV infecting radish in Korea. The symptoms of single BWYV infection are unclear, as radish is a new host plant of BWYV in Korea. Further research on the pathogenicity and impact of this virus in radish is therefore needed.

4.
Sci Rep ; 13(1): 7261, 2023 05 04.
Artigo em Inglês | MEDLINE | ID: mdl-37142679

RESUMO

Cucumber mosaic virus (CMV) is one of the most prevalent plant viruses in the world, and causes severe damage to various crops. CMV has been studied as a model RNA virus to better understand viral replication, gene functions, evolution, virion structure, and pathogenicity. However, CMV infection and movement dynamics remain unexplored due to the lack of a stable recombinant virus tagged with a reporter gene. In this study, we generated a CMV infectious cDNA construct tagged with a variant of the flavin-binding LOV photoreceptor (iLOV). The iLOV gene was stably maintained in the CMV genome after more than four weeks of three serial passages between plants. Using the iLOV-tagged recombinant CMV, we visualized CMV infection and movement dynamics in living plants in a time course manner. We also examined whether CMV infection dynamics is influenced by co-infection with broad bean wilt virus 2 (BBWV2). Our results revealed that no spatial interference occurred between CMV and BBWV2. Specifically, BBWV2 facilitated the cell-to-cell movement of CMV in the upper young leaves. In addition, the BBWV2 accumulation level increased after co-infection with CMV.


Assuntos
Coinfecção , Cucumovirus , Infecções por Citomegalovirus , Vicia faba , Viroses , Plantas/genética , Vicia faba/genética , RNA Viral/genética , Doenças das Plantas
5.
Plant Dis ; 2023 Feb 03.
Artigo em Inglês | MEDLINE | ID: mdl-36734939

RESUMO

Viburnum lentago (family Adoxaceae) is a perennial plant species native to northeastern United States and southern Canada. Globally, V. lentago is a popular garden plant due to its abundant flowers and beautiful autumnal color. V. lentago is also commercially cultivated for medicinal purposes because its roots and fruits can be used in herbal preparations (Jiao et al. 2021). In June 2022, virus-like symptoms of vein chlorosis and yellowing were observed in the leaves of many V. lentago trees planted in a public park in Wonju, South Korea. Leaf samples were collected from five symptomatic V. lentago trees. To identify the causal agent(s) of the virus-like symptoms, total RNA was isolated from one sample using PureLink® RNA Mini Kit (Invitrogen, USA) and subjected to library construction using Illumina TruSeq RNA Sample Preparation Kit v2 (Illumina, Inc., USA). RNA-Seq was performed using an Illumina NovaSeq 6000 system (Macrogen, Korea). De novo assembly of 118,878,556 quality-filtered reads was performed using the Trinity pipeline (Kwon et al. 2018), yielding 296,109 contigs. BLASTn and BLASTx analyses of the contigs against the GenBank viral reference database identified only one large contig (8,816 nt) containing a 26-nt poly(A) tail of viral origin. This contig had a maximum nucleotide identity of 85.53 % (with 99 % coverage) with isolate HZ (accession No. MH427034) of citrus leaf blotch virus (CLBV; genus Citrivirus, family Betaflexiviridae), suggesting that the collected sample was infected with CLBV. All collected V. lentago samples were tested using RT-PCR with CLBV-specific primers (CLBV-Det-Fw 5'-AACGAGGCCAATTCTGCTAT-3' and CLBV-Det-Rv 5'-GACTGCTTGACTAACAC-CCA-3'). All samples were positive for CLBV. For biological indexing, sap from the symptomatic V. lentago leaves was mechanically inoculated to indicator plants, including Nicotiana benthamiana, N. occidentalis, N. tabacum, Datura stramonium, Chenopodium quinoa, Vigna unguiculata, and V. lentago. Three months later, only V. lentago developed the same vein chlorosis symptoms observed in the collected samples, and no other tested plants exhibited obvious symptoms. Further, only V. lentago sample tested positive for CLBV using RT-PCR analysis. To determine the complete genome sequence of the CLBV V. lentago isolate, the contig sequence was confirmed by de novo sequencing of the RT-PCR products amplified using CLBV-specific primers. The 5' terminal sequence of the contig was determined using the 5' rapid amplification of cDNA ends method (Seo et al. 2015). The full-length sequence of CLBV isolated from V. lentago was 8,795 nt in length (excluding poly(A) tail), and deposited in GenBank under the accession number OP751940. Although numerous isolates of CLBV have been identified in various plant species, including citrus, kiwi, and lemon plants (Cao et al. 2017), the V. lentago isolate is likely a distinct variant because its CP gene has a maximum nucleotide identity of 85.53 % with that of a kiwi isolate (MH339916). With little information available on viral diseases infecting V. lentago, this is the first identified and completely sequenced CLBV infecting V. lentago. Significantly, V. lentago plants infected with CLBV did not flower throughout the summer period, reducing their value as an ornamental plant. Furthermore, V. lentago might have acted as an intermediate host to transfer CLBV to other crops such as citrus. To the best of our knowledge, this is the first report of CLBV infecting V. lentago in South Korea and the world.

6.
Front Plant Sci ; 13: 1048074, 2022.
Artigo em Inglês | MEDLINE | ID: mdl-36388582

RESUMO

Pepper mottle virus (PepMoV) infects primarily Capsicum species, including pepper and bell pepper which are important vegetable and spice crops in Korea. We have previously collected 13 PepMoV isolates from nine regions comprising five provinces, causing different symptoms on inoculated indicator host plants in Korea. To further identify the responsible symptom determinant(s) and explore viral protein functions of PepMoV, two out of 13 isolates, including 134 and 205136, were used in this study. Isolate 134 causes necrosis and yellowing, while 205136 causes severe mottle and yellowing symptoms on Nicotiana benthamiana. All chimeric and site-directed mutants contain the PepMoV 134 genome as a backbone with specific regions switched for those from counterparts of PepMoV 205136. Effects of all mutants compared with 134 after inoculation onto N. benthamiana by agroinfiltration. Results from our study provide direct evidence that the helper component-proteinase (HC-Pro) and the nuclear inclusion protein b (NIb)-coat protein (CP) regions are involved in virus accumulation and symptom determinants. In addition, we mapped to amino acid residues tyrosine, glycine, and leucine at position 360, 385, and 527, respectively, in the HC-Pro region participate in faster viral accumulation or movement in the plant. The residue valine at position 2773 of NIb plays an essential role in isolate 134 symptom development. As part of this study, we seek to gain insight into viral factors involved in the PepMoV infection cycle and a better understanding of plant-virus interactions. These findings complement the insufficiency of the gene function study of the PepMoV virus and provide a novel perspective for the protein function study of the Potyvirus.

7.
Plants (Basel) ; 11(8)2022 Apr 10.
Artigo em Inglês | MEDLINE | ID: mdl-35448759

RESUMO

In Myanmar, yellow mosaic and leaf curl diseases caused by whitefly-transmitted begomoviruses are serious problems for vegetables such as tomatoes and peppers. To investigate the incidence of begomoviruses in Myanmar between 2017 and 2019, a field survey of tomato and pepper plants with virus-like symptoms was conducted in the Naypyitaw, Tatkon, and Mohnyin areas of Myanmar. Among the 59 samples subjected to begomovirus detection using polymerase chain reaction, 59.3% were infected with begomoviruses. Complete genome sequences using rolling circle amplification identified five begomovirus species: tomato yellow leaf curl Thailand virus (TYLCTHV), tomato yellow leaf curl Kanchanaburi virus (TYLCKaV), tobacco leaf curl Yunnan virus (TbLCYnV), chili leaf curl Pakistan virus (ChiLCV/PK), and tobacco curly shoot Myanmar virus (TbCSV-[Myanmar]). Excluding the previously reported TYLCTHV, three begomoviruses (ChiLCV/PK, TYLCKaV, and TbLCYnV) were identified in Myanmar for the first time. Based on the 91% demarcation threshold of begomovirus species, TbCSV-[Myanmar] was identified as a new species in this study. Among these, ChiLCV/PK and TbCSV-[Myanmar] were the most predominant in tomato and pepper fields in Myanmar. Identification of begomovirus species may be helpful for predicting the origin of viruses and preventing their spread.

8.
Plant Dis ; 2022 Apr 05.
Artigo em Inglês | MEDLINE | ID: mdl-35380467

RESUMO

Ranunculus (Ranunculus asiaticus L.) is a popular ornamental plant mainly cultivated for cut flowers and flowering potted plants. In January 2021, a leaf sample of R. asiaticus that showed virus-like symptoms including mosaic, yellowing and malformation on leaves was collected from a greenhouse in Jangheung, South Korea for disease diagnosis (Fig. S1). Disease incidence was greater than 30% in the greenhouse (~1,000 m2). Transmission electron microscopy (TEM) of symptomatic leaves identified potyvirus-like filamentous virus particles of about 800 nm. To confirm the TEM results, a symptomatic leaf sample was further analyzed by reverse-transcription polymerase chain reaction (RT-PCR) using species-specific detection primers for six potyviruses that infect R. asiaticus (Sacco et al., 2018). The sample was positive only for ranunculus mild mosaic virus (RanMMV). Additional analysis of nine symptomatic R. asiaticus plants from the infected greenhouse found that all samples were positive for RanMMV. To exclude the presence of the other viruses, next generation sequencing (NGS) was carried out. Total RNA was extracted from symptomatic leaves using the RNeasy Plant Mini Kit (Qiagen, Germany) and a transcriptome library was generated using the TruSeq Stranded Total RNA LT Sample Prep kit (Illumina, San Diego, CA) acccording to the recommended protocol. NGS was performed using an Illumina NovaSeq 6000 system (Macrogen Inc., Korea). A total of 75.58 million reads were obtained, and the reads were de novo assembled to contigs using Trinity software (Grabherr et al., 2011). BLASTn and BLASTx analysis of the contigs against the NCBI viral reference database identified the assembled large contig of 9,539 nt (5,321 mapped reads, mean read coverage of 84.2 times) as RanMMV. This sequence shared 98% nt identity (99% coverage) with the RanMMV NL isolate (acc. no. LC604020) isolated from an anemone plant (A. blanda cv. Charmer) from Netherlands. To obtain the complete genome sequence, the termini sequences were determined by 5' and 3' rapid amplification of cDNA ends (RACE) methods as reported recently (Imamura et al., 2021). The assembled full-length genome sequence of RanMMV-JH is 9,574 nt in length, excluding the poly(A) tail, and encoding a polyprotein of 3,074aa. The sequence was deposited in GenBank under the accession no. OL742438. RanMMV is transmitted by aphids in a nonpersistent manner and has very narrow host range. RanMMV, one of causative agents of ranunculus mosaic disease, has been problematic in ranunculus production area of Japan (Hayahi et al., 2018; Kamikawa et al., 2022). Recently, some perennial weeds from the Ranunculaceae family (e.g. R. japonicus, R. silerifolius and R. tachiroei) are known to may act as a virus reservoir (Kamikawa et al., 2022). As R. asiaticus is cultivated by vegetative propagation, there is need to develop certification system for producing virus-free R. asiaticus. To our knowledge, this is the first report of RanMMV infection in R. asiaticus in Korea.

9.
Plant Dis ; 2022 Mar 31.
Artigo em Inglês | MEDLINE | ID: mdl-35357179

RESUMO

Strawberry (Fragaria x ananassa Duch.) was introduced to Nepal from Japan in the 1990s, and thus, is a relatively new crop in the country. After the initial introduction of cultivar 'Nyoho' in Kakani, Nuwakot, different agencies and growers have introduced a number of cultivars in large numbers from Japan, Europe, America and India to expand the cultivation of strawberry in Nepal. Such practice has increased the risk of introducing new pathogens in the country. During a field visit at Kakani in October 2018, virus-like symptoms were observed in 5-10% of the plants in a polyhouse (~200 m2). Three strawberry leaf samples showing vein banding, vein clearing or tip necrosis with leaf puckering were collected. Total RNA was extracted from leaves using the RNeasy Plant Mini Kit (Qiagen, Germany) and subjected to high-throughput sequencing (HTS). After ribosomal RNA depletion using the Ribo-Zero rRNA kit, a cDNA library was prepared using an Illumina TruSeq Stranded Total RNA Kit and sequenced on an Illumina NovaSeq 6000 system (Macrogen Inc. Korea). De novo transcriptome assembly of the 67,748,658 reads with Trinity software (r20140717) yielded 116,854 contigs of 201-17,773 nucleotides (nt). BLASTn and BLASTx analysis of the contigs against the NCBI viral reference database showed that one contig with the nearly full genome sequence (5,968 nt, deposited under GenBank accssion number MZ355624) was identified as strawberry polerovirus 1 (SPV-1). A total of 10,401 reads was mapped to the reference SPV-1 nucleotide genome (GenBank accession number NC_025435) with a 263.2 sequence depth. The contig shared 99% nt sequence identity with SPV-1 isolate AB5301 (GenBank accession number KM233705) from Canada and 97% identity with the Argentine SPV-1 isolate 15CA (GenBank accession number MK142237). To confirm the presence of SPV-1, reverse transcription-PCR (RT-PCR) was performed using previously reported specific primers, SPV-1F (AGAGATCGCCGGATTCCGCAA) and SPV-1R (TGACACGCTCGGTATTCACAAACAG), amplifying 281 nt of the P1-P2 fusion protein gene (Thekke-Veetil and Tzanetakis 2016). Of the three samples, only one showing vein banding symptoms (Figure S1) was positive for SPV-1. Sanger sequencing of the RT-PCR products showed 100% nt identity with the HTS-derived sequence. SPV-1, a member of the genus Polerovirus in the family Solemoviridae, was first reported in strawberry showing decline symptom in Canada (Xiang et al. 2015), and was subsequently detected in the USA (Thekke-Veetil and Tzanetakis 2016) and in Argentina (Luciani et al. 2016; 2018). To our knowledge, this is the first report of SPV-1 infection in strawberry in Nepal and Asia.

10.
Mol Cell Probes ; 61: 101792, 2022 02.
Artigo em Inglês | MEDLINE | ID: mdl-35041994

RESUMO

Tomato spotted wilt virus (TSWV) is a highly destructive virus for pepper. Introgression of the resistance gene Tsw in pepper is used to manage TSWV worldwide; however, the occurrence of Tsw resistance-breaking (RB) variants threatens the pepper industry. Here, we developed a multiplex reverse-transcription PCR assay for detection of recently emerged Tsw RB variants in South Korea with high specificity and sensitivity.


Assuntos
Tospovirus , Reação em Cadeia da Polimerase Multiplex , Doenças das Plantas/genética , Reação em Cadeia da Polimerase Via Transcriptase Reversa , Transcrição Reversa , Tospovirus/genética
11.
Front Plant Sci ; 12: 746543, 2021.
Artigo em Inglês | MEDLINE | ID: mdl-34721473

RESUMO

Broad bean wilt virus 2 (BBWV2) is an emerging virus in various economically important crops, especially pepper (Capsicum annuum L.), worldwide. Recently, the emergence of various BBWV2 strains that induce severe symptoms has increased damage to pepper crops. While the symptomatic variations among virus strains should be associated with differences in the transcriptomic reprogramming of host plants upon infection, underlying molecular mechanisms and associated genes are largely unknown. In the present study, we employed transcriptome analysis to identify responsible host factors for symptom enhancement in the BBWV2-pepper pathosystem using two distinct BBWV2 strains, PAP1 (a severe strain) and RP1 (a mild strain). Comparative analysis of the differentially expressed genes (DEGs) revealed that various genes associated with pathogen-associated molecular pattern (PAMP)-triggered immunity (PTI) and ethylene signaling were significantly upregulated upon infection with the severe PAP1 strain, but not with the mild RP1 strain. Indeed, hormone analysis revealed that ethylene emission was significantly increased in pepper plants infected with PAP1. These observations imply that the activation of the PTI-associated defense responses reinforce symptom formation during BBWV2 infection in a virus strain-specific manner.

12.
Virus Res ; 304: 198533, 2021 10 15.
Artigo em Inglês | MEDLINE | ID: mdl-34384805

RESUMO

Broad bean wilt virus 2 (BBWV2) is an evolutionarily successful RNA virus with an extensive host range and worldwide distribution that causes severe damage to crops. While numerous BBWV2 isolates from various plant species have been identified and their genome sequences determined, little information is available on the virulence and symptomatic characteristics corresponding to the genomic sequences. In this study, we provide integrated information on the molecular and pathogenic characteristics of three genetically distant BBWV2 isolates: BBWV2-PC, -LS2, and P3 obtained from Gentiana scabra, Leonurus sibiricus, and Pisum sativum, respectively. Phylogenetic and diversity analyses of the BBWV2 population included 42 isolates from various host species and revealed that RNA2 has higher genetic plasticity than RNA1 and may have evolved under host-imposed constraints. In addition, we generated an infectious cDNA clone of BBWV2-PC RNA2 (pBBWV2-PC-R2). Pseudo-recombination analysis of pBBWV2-PC-R2 further demonstrated that RNA2 determines the pathogenic characteristics of the PC isolate.


Assuntos
Fabavirus , Filogenia , RNA Viral/genética
13.
Microorganisms ; 9(6)2021 May 21.
Artigo em Inglês | MEDLINE | ID: mdl-34063757

RESUMO

Apple stem grooving virus (ASGV; genus Capillovirus) is an economically important virus. It has an approx. 6.5 kb, monopartite, linear, positive-sense, single-stranded RNA genome. The present study includes identification of 24 isolates-13 isolates from apple (Pyrus malus L.) and 11 isolates from pear (Pyrus communis L.)-from different agricultural fields in South Korea. The coat protein (CP) gene of the corresponding 23 isolates were amplified, sequenced, and analyzed. The CP sequences showed phylogenetic separation based on their host species, and not on the geography, indicating host adaptation. Further analysis showed that the ASGV isolated in this study followed host adaptation influenced and preferred by the host codon-usage.

14.
Plant Dis ; 2021 Mar 09.
Artigo em Inglês | MEDLINE | ID: mdl-33719543

RESUMO

Brugmansia suaveolens, known as angel's trumpet, is a perennial ornamental shrub in the Solanaceae with large fragrant flowers. In June 2018, a leaf sample of B. suaveolens that showed virus-like symptoms including chlorotic spots, yellowing and mottle on leaves was collected from a greenhouse in Seongnam, South Korea for disease diagnosis (Supplementary Figure S1a, b). Disease incidence in the greenhouse was greater than 80% for about 2,000 B. suaveolens plants. To identify a causal virus, transmission electron microscopy (TEM) was used to analyze symptomatic leaf samples using leaf dips and thin section methods. Filamentous virus particles and pinwheel structures were observed, indicating the presence of a potyvirus (Supplementary Figure S1c, d). To confirm the TEM results, a symptomatic leaf sample was further analyzed by reverse-transcription polymerase chain reaction (RT-PCR) using species-specific detection primers for three potyviruses that infect Brugmansia spp.: Colombian datura virus (CDV), Brugmansia mosaic virus (BruMV), and Brugmansia suaveolens mottle virus (BsMoV) (Lucinda et al, 2008; Park et al., 2014; Verma et al., 2014). The sample was positive only for CDV. CDV is transmitted by aphids in a nonpersistent manner and mechanical inoculation and can infect plants in the Solanaceae family including tomato and tobacco (Kahn and Bartels 1968; Schubert et al. 2006; Verhoeven et al. 1996) and has been designated a quarantine virus in Korea. Additional analysis of 13 symptomatic B. suaveolens plants from the infected greenhouse found that all samples except one were infected with CDV. To isolate CDV from B. suaveolens, leaf extracts from symptomatic samples were mechanically inoculated on an assay host, Nicotiana tabacum cv. BY via three single-lesion passages followed by propagation in N. benthamiana. For the bioassay of the CDV isolate (CDV-AT-Kr), sap from infected N. benthamiana was mechanically inoculated on 31 indicator plants, including B. suaveolens (Supplementary Table S2). CDV-AT-Kr induced chlorotic local lesions, necrotic local lesions, mottle, and/or mosaic systemically in 10 Nicotiana spp., and mottle and yellowing in tomato. On inoculated B. suaveolens, te mild mottle symptom was reproduced. No symptoms were observed in pepper or Datura stramonium. These results were confirmed by RT-PCR. To characterize CDV-AT-Kr genetically, the complete genome sequence of CDV-AT-Kr was obtained by RT-PCR using specific primers (Supplementary Table S3) and deposited in GenBank (accession no. MW075268). The CDV-AT-Kr RNA consists of 9,620 nt, encoding a polyprotein of 3,076 aa. BLASTn analysis showed that CDV-AT had maximum nucleotide identities of 98.9% at the complete genome level with a CDV isolate (accession no. JQ801448) from N. tabacum in the UK. To our knowledge, this is the first report of CDV infection in B. suaveolens in Korea and the second report in the world of the complete genome sequence. As B. suaveolens is cultivated by vegetative propagation, production and maintenance of virus-free, healthy B. suaveolens is needed. In addition, as new CDV hosts have been repeatedly reported (Pacifico et al., 2016; Salamon et al., 2015; Tomitaka et al., 2014; Verma et al., 2014), we are monitoring nationwide occurrence to prevent the spread of the virus to other crops.

15.
Plant Dis ; 2021 Jan 06.
Artigo em Inglês | MEDLINE | ID: mdl-33406858

RESUMO

In October 2018, cucumber plants showing yellowing and chlorotic mottle symptoms were observed in a greenhouse in Chungbuk, South Korea. The observed symptoms were similar to those caused by cucurbit aphid-borne yellows virus (CABYV), which has been detected on cucumber plants in the region since it was reported on melon in Korea in 2015 (Lee et al 2015). To identify the potential agents causing these symptoms, 28 samples from symptomatic leaves and fruit of cucumber plants were subjected to total RNA extraction using the Plant RNA Prep Kit (Biocubesystem, Korea). Reverse transcription polymerase chain (RT-PCR) was performed on total RNA using CABYV specific primers and protocols (Kwak et al. 2018). CABYV was detected in 17 of the 28 samples, while 11 symptomatic samples tested negative. In order to identify the cause of the symptoms, RT-PCR was performed using cucurbit chlorotic yellows virus (CCYV) and cucurbit yellow stunting disorder virus (CYSDV) specific primers (Wintermantel et al. 2019). Eight of the 28 samples were positive using the CCYV specific primers while seven samples were infected with only CCYV and one contained a mixed infection of CABYV with CCYV. None of the samples tested positive for CYSDV. The expected 373 nt amplicons of CCYV were bi-directionally sequenced, and BLASTn analysis showed that the nucleotide sequences shared 98 to 100% identity with CCYV isolates from East Asia, including NC0180174 from Japan. Two pairs of primers for amplification of the complete coat protein and RNA-dependent RNA polymerase (RdRp) genes (Wintermantel et al., 2019) were used to amplify the 753bp coat protein and 1517bp RdRp genes, respectively. Amplicons of the expected sizes were obtained from a CCYV single infection and ligated into the pGEM T- Easy vector (Promega, WI, USA). Three clones from each amplicon were sequenced and aligned using Geneious Prime and found to have identical sequences (Genbank accession nos. MW033300, MW033301). The CP and RdRp sequences demonstrated 99% nucleotide and 100% amino acid identity with the respective genes and proteins of the CCYV isolates from Japan. This study documents the first report of CCYV in Korea. Since CCYV was first detected on melon in Japan, it has been reported in many other countries including those in East Asia, the Middle East, Southern Europe, North Africa, and recently in North America. CCYV has the potential to become a serious threat to production of cucurbit crops in Korea, particularly due to the increasing prevalence of the whitefly, Bemisia tabaci, in greenhouse production systems. It will be important to continue monitoring for CCYV and determine potential alternate hosts in the region to manage and prevent further spread of CCYV in Korea.

16.
Plant Dis ; 2020 Dec 17.
Artigo em Inglês | MEDLINE | ID: mdl-33332164

RESUMO

Butterbur (Petasites japonicus [Siebold & Zucc.] Maxim.) is a perennial herb of the Asteraceae family that is cultivated for medicinal and nutritional purposes. Due to long-term vegetative propagation of virus-infected native species, the yield and quality of butterbur plants have deteriorated. Five viruses have been reported to infect this species: alfalfa mosaic virus (AMV), arabis mosaic virus (ArMV), butterbur mosaic virus (ButMV), broad bean wilt virus 2 (BBWV-2), and cucumber mosaic virus (CMV) (Ham et al. 2016; Tochihara and Tamura 1976). From 2018 to 2019, butterbur plants in four greenhouses in Nonsan, South Korea (Supplementary Figure S1a, b) were found to show virus-like symptoms such as chlorotic and necrotic ring spots, necrosis, and mild mosaic on the leaves. Disease incidence was greater than 80% in one greenhouse (~1,000 m2). To identify the causal virus, we collected 17 symptomatic butterbur leaf samples from these greenhouses and performed reverse-transcription polymerase chain reaction (RT-PCR) analysis using species-specific detection primers for the five reported viruses and tomato spotted wilt virus (TSWV) (Supplementary Table S2). RT-PCR results showed that 12 samples from three greenhouses showing necrotic ring spots and mosaic symptoms were infected with a mixture of TSWV and ButMV, whereas 5 samples from one greenhouse showing mild mosaic symptoms were infected only with ButMV. TSWV (genus Orthotospovirus, family Tospoviridae) is transmitted by thrips and causes serious damage to a wide range of economically important plants (Pappu et al. 2009). ButMV (genus Carlavirus, family Betaflexiviridae) is transmitted by aphids, as well as infected vegetative propagation material (Hashimoto et al. 2009) and is the most predominant virus in butterbur in Korea (Ham et al. 2016). To isolate TSWV from butterbur, leaf extracts from symptomatic samples were mechanically inoculated on an assay host, Chenopodium quinoa, via three single-lesion passages followed by propagation in Nicotiana tabacum cv. Samsun. Thirty different indicator plant species were used for the bioassay of the TSWV isolate (TSWV-NS-BB20) by mechanical inoculation method (Supplementary Table S3). RT-PCR analysis confirmed that TSWV-NS-BB20 induced necrotic local lesions and mosaic on Nicotiana species and ring spots and mosaic on tomatoes and peppers. Notably, TSWV-NS-BB20 reproduced necrotic local lesions and mild mosaic symptoms on butterbur plants which were infected with ButMV with no obvious symptoms. To characterize TSWV-NS-BB20 genetically, the complete genome sequences of L (8914 nt), M (4751 nt), and S (2917 nt) RNA segments were obtained by RT-PCR using specific primers for TSWV as described previously (Kwak et al., 2020). The obtained sequences were deposited in GenBank under accession nos. MT643236, MT842841, and MN854654, respectively. BLASTn analysis showed that sequences of each segment had maximum nucleotide identities of 99.0, 98.9, and 98.6% to TSWV-L, M, and S (KP008128, FM163373, and KP008129) of TSWV-LL-N.05 isolate from tomato in Spain. Since 2018, TSWV outbreaks on butterbur are observed every year and thus may act as a potential source of TSWV infection for other crops of importance to Korea, such as pepper. Owing to the butterbur vegetative propagation, the identification of TSWV infection in butterbur will be helpful for future virus management to generate virus-free materials. To our knowledge, this is the first report of TSWV infection of butterbur.

17.
Virus Evol ; 6(2): veaa070, 2020 Jul.
Artigo em Inglês | MEDLINE | ID: mdl-33240527

RESUMO

Understanding the evolutionary history of a virus and the mechanisms influencing the direction of its evolution is essential for the development of more durable strategies to control the virus in crop fields. While the deployment of host resistance in crops is the most efficient means to control various viruses, host resistance itself can act as strong selective pressure and thus play a critical role in the evolution of virus virulence. Cucumber mosaic virus (CMV), a plant RNA virus with high evolutionary capacity, has caused endemic disease in various crops worldwide, including pepper (Capsicum annuum L.), because of frequent emergence of resistance-breaking variants. In this study, we examined the molecular and evolutionary characteristics of recently emerged, resistance-breaking CMV variants infecting pepper. Our population genetics analysis revealed that the high divergence capacity of CMV RNA1 might have played an essential role in the host-interactive evolution of CMV and in shaping the CMV population structure in pepper. We also demonstrated that nonsynonymous mutations in RNA1 encoding the 1a protein enabled CMV to overcome the deployed resistance in pepper. Our findings suggest that resistance-driven selective pressures on RNA1 might have contributed in shaping the unique evolutionary pattern of CMV in pepper. Therefore, deployment of a single resistance gene may reduce resistance durability against CMV and more integrated approaches are warranted for successful control of CMV in pepper.

18.
Int J Mol Sci ; 21(20)2020 Oct 13.
Artigo em Inglês | MEDLINE | ID: mdl-33066322

RESUMO

Tomato (Lycopersicum esculentum L.) and pepper (Capsicum annuum L.) plants belonging to the family Solanaceae are cultivated worldwide. The rapid development of next-generation sequencing (NGS) technology facilitates the identification of viruses and viroids infecting plants. In this study, we carried out metatranscriptomics using RNA sequencing followed by bioinformatics analyses to identify viruses and viroids infecting tomato and pepper plants in Vietnam. We prepared a total of 16 libraries, including eight tomato and eight pepper libraries derived from different geographical regions in Vietnam. We identified a total of 602 virus-associated contigs, which were assigned to 18 different virus species belonging to nine different viral genera. We identified 13 different viruses and two viroids infecting tomato plants and 12 viruses and two viroids infecting pepper plants with viruses as dominantly observed pathogens. Our results showed that multiple infection of different viral pathogens was common in both plants. Moreover, geographical region and host plant were two major factors to determine viral populations. Taken together, our results provide the comprehensive overview of viral pathogens infecting two important plants in the family Solanaceae grown in Vietnam.


Assuntos
Capsicum/virologia , Metagenômica/métodos , Tipagem Molecular/métodos , Vírus de Plantas/genética , Solanum lycopersicum/virologia , Transcriptoma , Viroides/genética , Vírus de Plantas/patogenicidade , Vietnã , Viroides/patogenicidade
19.
Plant Physiol ; 181(3): 867-880, 2019 11.
Artigo em Inglês | MEDLINE | ID: mdl-31481630

RESUMO

While pepper (Capsicum annuum) is a highly recalcitrant species for genetic transformation studies, plant virus-based vectors can provide alternative and powerful tools for transient regulation and functional analysis of genes of interest in pepper. In this study, we established an effective virus-based vector system applicable for transient gain- and loss-of-function studies in pepper using Broad bean wilt virus2 (BBWV2). We engineered BBWV2 as a dual gene expression vector for simultaneous expression of two recombinant proteins in pepper cells. In addition, we established enhanced and stable expression of recombinant proteins from the BBWV2-based dual vector via coexpression of a heterologous viral suppressor of RNA silencing. We also developed a BBWV2-based virus-induced gene silencing (VIGS) vector, and we successfully silenced the phytoene desaturase gene (PDS) using the BBWV2-based VIGS vector in various pepper cultivars. Additionally, we optimized the BBWV2-based VIGS system in pepper by testing the efficiency of PDS gene silencing under different conditions. This BBWV2-based vector system represents a convenient approach for rapid and simple analysis of gene functions in pepper.


Assuntos
Capsicum/genética , Vetores Genéticos/genética , Vírus de Plantas/genética , Regulação da Expressão Gênica de Plantas/genética , Fenótipo , Nicotiana/genética
20.
Plant Pathol J ; 34(6): 532-543, 2018 Dec.
Artigo em Inglês | MEDLINE | ID: mdl-30588226

RESUMO

Complete genome sequences of 22 isolates of Cucurbit aphid-borne yellows virus (CABYV), collected from melon plants showing yellowing symptom in Korea during the years 2013-2014, were determined and compared with previously reported CABYV genome sequences. The complete genomes were found to be 5,680-5,684 nucleotides in length and to encode six open reading frames (ORFs) that are separated into two regions by a non-coding internal region (IR) of 199 nucleotides. Their genomic organization is typical of the genus Polerovirus. Based on phylogenetic analyses of complete nucleotide (nt) sequences, CABYV isolates were divided into four groups: Asian, Mediterranean, Taiwanese, and R groups. The Korean CABYV isolates clustered with the Asian group with > 94% nt sequence identity. In contrast, the Korean CABYV isolates shared 87-89% sequence identities with the Mediterranean group, 88% with the Taiwanese group, 81-84% with the CABYV-R group, and 72% with another polerovirus, M.. Recombination analyses identified 24 recombination events (12 different recombination types) in the analyzed CABYV population. In the Korean CABYV isolates, four recombination types were detected from eight isolates. Two recombination types were detected in the IR and P3-P5 regions, respectively, which have been reported as hotspots for recombination of CABYV. This result suggests that recombination is an important evolutionary force in the genetic diversification of CABYV populations.

SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA