Design, synthesis and structure-activity relationship of novel 2-pyrimidinylindole derivatives as orally available anti-obesity agents.

Due to the emerging global epidemic of obesity, developing safe and effective agents for anti-obesity is urgently needed. Our previous study found that 2-pyrimidinylindole derivative Wd3d exhibited potential anti-obesity activity. Herein, to further optimize the potential moiety, structural modifications were proceeded for two rounds in this study. Firstly, we designed, synthesized, and evaluated 36 new derivatives of 2-pyrimidinylindole scaffold with different substituents on the indole ring and pyrimidine ring to investigate their structure-activity relationship (SAR). Then, analogs with potent activity had the aldehyde group replaced with the acylhydrazone group to reduce cytotoxicity and improve metabolic stability. Detailed SAR studies and animal evaluation experiments led to the discovery of the compound 9ga, which significantly reduced TG accumulation with an EC50 value of 0.07 µM and showed relatively low cytotoxicity with an IC50 value of around 24 µM. Oral administration of 9ga effectively prevented the excessive growth of body weight and lessened fat mass as well as liver mass, decreased lipid accumulation in the liver and blood, and improved the heart injury parameter in the diet-induced obesity mouse model significantly better than Wd3d. A mechanism study showed that 9ga regulated the lipid metabolism during early adipogenesis by inhibiting PPARγ pathway. In conclusion, our study further highlights the anti-obesity potential of 2-pyrimidinylindole derivatives in diet-induced obesity.

Utilizing radiomics and dosiomics with AI for precision prediction of radiation dermatitis in breast cancer patients.

PURPOSE: This study explores integrating clinical features with radiomic and dosiomic characteristics into AI models to enhance the prediction accuracy of radiation dermatitis (RD) in breast cancer patients undergoing volumetric modulated arc therapy (VMAT). MATERIALS AND METHODS: This study involved a retrospective analysis of 120 breast cancer patients treated with VMAT at Kaohsiung Veterans General Hospital from 2018 to 2023. Patient data included CT images, radiation doses, Dose-Volume Histogram (DVH) data, and clinical information. Using a Treatment Planning System (TPS), we segmented CT images into Regions of Interest (ROIs) to extract radiomic and dosiomic features, focusing on intensity, shape, texture, and dose distribution characteristics. Features significantly associated with the development of RD were identified using ANOVA and LASSO regression (p-value < 0.05). These features were then employed to train and evaluate Logistic Regression (LR) and Random Forest (RF) models, using tenfold cross-validation to ensure robust assessment of model efficacy. RESULTS: In this study, 102 out of 120 VMAT-treated breast cancer patients were included in the detailed analysis. Thirty-two percent of these patients developed Grade 2+ RD. Age and BMI were identified as significant clinical predictors. Through feature selection, we narrowed down the vast pool of radiomic and dosiomic data to 689 features, distributed across 10 feature subsets for model construction. In the LR model, the J subset, comprising DVH, Radiomics, and Dosiomics features, demonstrated the highest predictive performance with an AUC of 0.82. The RF model showed that subset I, which includes clinical, radiomic, and dosiomic features, achieved the best predictive accuracy with an AUC of 0.83. These results emphasize that integrating radiomic and dosiomic features significantly enhances the prediction of Grade 2+ RD. CONCLUSION: Integrating clinical, radiomic, and dosiomic characteristics into AI models significantly improves the prediction of Grade 2+ RD risk in breast cancer patients post-VMAT. The RF model analysis demonstrates that a comprehensive feature set maximizes predictive efficacy, marking a promising step towards utilizing AI in radiation therapy risk assessment and enhancing patient care outcomes.

Exposure-response modelling of osimertinib in patients with non-small cell lung cancer.

AIMS: Osimertinib is a third-generation, irreversible, central nervous system-active, epidermal growth factor receptor (EGFR) tyrosine kinase inhibitor (TKI) with efficacy in EGFR-mutated non-small cell lung cancer (NSCLC). We assessed the relationship between plasma osimertinib levels and its efficacy and safety events. METHODS: Comprehensive pharmacokinetics exposure-response (E-R) modelling was performed utilizing steady state area under the curve (AUCss) data from first-line, ≥second-line and adjuvant studies from the osimertinib clinical development programme (20-240 mg once-daily dosing; N = 1689 patients). Analyses were conducted for survival using a proportional hazard model; for interstitial lung disease (ILD) and left ventricular ejection fraction (LVEF) events using a penalized logistic regression model and graphical analysis of potential confounding factors; and for rash and diarrhoea events using descriptive analysis. RESULTS: E-R modelling analyses indicated no clear trend of increasing efficacy with increasing osimertinib AUCss; efficacy in all exposure quartiles was significantly better than the control arm (comparator EGFR-TKI, chemotherapy or placebo) irrespective of treatment line. Model-based analysis suggested a potential relationship between increased osimertinib exposure and increased probability of ILD events, predominantly in Japanese patients. Additionally, there were increased probabilities of rash or diarrhoea with increasing osimertinib exposure. The probability of LVEF events showed overlapping confidence intervals for osimertinib ≤80 mg and control. CONCLUSIONS: E-R modelling in patients with EGFR-mutated NSCLC demonstrated that increased osimertinib exposure was unlikely to increase efficacy but may increase occurrence of certain adverse events. Hence, long-term treatment with doses ≥80 mg was not expected to provide additional benefit.

The Black Lives Matter movement mitigates bias against racial minority actors.

Watching movies is among the most popular entertainment and cultural activities. How do viewers react when a movie sequel increases racial minority actors in the main cast ("minority increase")? On the one hand, such sequels may receive better evaluations if viewers appreciate racially inclusive casting for its novel elements (the value-in-diversity perspective) and moral appeal (the fairness perspective on diversity). On the other hand, discrimination research suggests that if viewers harbor biases against racial minorities, sequels with minority increase may receive worse evaluations. To examine these competing possibilities, we analyze a unique panel dataset of movie series released from 1998 to 2021 and conduct text analysis of 312,457 reviews of these movies. Consistent with discrimination research, we find that movies with minority increase receive lower ratings and more toxic reviews. Importantly, these effects weaken after the advent of the Black Lives Matter (BLM) movement, especially when the movement's intensity is high. These results are reliable across various robustness checks (e.g., propensity score matching, random implementation test). We conceptually replicate the bias mitigation effect of BLM in a preregistered experiment: Heightening the salience of BLM increases White individuals' acceptance of racial minority increase in a movie sequel. This research demonstrates the power of social movements in fostering diversity, equality, and inclusion.

Development of Novel N-Acylhydrazone Derivatives with High Anti-obesity Activity and Improved Safety by Exploring the Pharmaceutical Properties of Aldehyde Group.

The discovery of effective and safe antiobesity agents remains a challenging yet promising field. Our previous studies identified Bouchardatine derivatives as potential antiobesity agents. However, the 8a-aldehyde moiety rendered them unsuitable for drug development. In this study, we designed two series of novel derivatives to modify this structural feature. Through a structure-activity relationship study, we elucidated the role of the 8a-aldehyde group in toxicity induction. We identified compound 14d, featuring an 8a-N-acylhydrazone moiety, which exhibited significant lipid-lowering activity and reduced toxicity. Compound 14d shares a similar lipid-lowering mechanism with our lead compound 3, but demonstrates improved pharmacokinetic properties and safety profile. Both oral and injectable administration of 14d significantly reduced body weight gain and ameliorated metabolic syndrome in diet-induced obese mice. Our findings identify 14d as a promising antiobesity agent and highlight the potential of substituting the aldehyde group with an N-acylhydrazone to enhance drug-like properties.

Effectiveness of narrowband ultraviolet B monotherapy versus combination therapy with systemic agents in patients with early-stage mycosis fungoides and the association with plaque lesions.

OBJECTIVE: Narrowband ultraviolet B (NB-UVB) has been recommended as first-line therapy for early-stage mycosis fungoides (MF) in international guidelines. NB-UVB can be used as monotherapy or part of a multimodality treatment regimen. There is limited evidence on the effectiveness and optimal patients of NB-UVB in combination with systemic therapies in MF. We aimed to assess the effectiveness of the combination versus NB-UVB monotherapy in early-stage MF and if plaque lesion status was related to these effects. METHODS: This observational cohort study included 247 early-stage MF patients who had received NB-UVB combined with systemic therapies vs. NB-UVB monotherapy from 2009 to 2021. The primary outcome was partial or complete response. Overall response rate and median time to response were calculated. Hazard ratios (HRs) were estimated using the Cox model. RESULTS: In 139 plaque-stage patients, the response rate for combination therapy group was higher than that of monotherapy group (79.0% vs. 54.3%, p = 0.006). The adjusted HR for combination therapy compared with NB-UVB monotherapy was 3.11 (95% CI 1.72-5.63). The combination therapy group also showed shorter time to response (4 vs. 6 months, p = 0.002). In 108 patch-stage patients, the response rate and time to response in two treatment groups showed no significant difference. There was therefore an observed interaction with patients' plaque lesion status for the effect size of NB-UVB combination therapy. No serious adverse events were observed. CONCLUSIONS: Adding systemic treatments to NB-UVB did not improve the treatment outcome of patch-stage patients, but it surpassed NB-UVB monotherapy for early-stage patients with plaques.

High prevalence of exon-13 variants in USH2A-related retinal dystrophies in Taiwanese population.

BACKGROUND: Biallelic pathogenic variants in USH2A lead to Usher syndrome or non-syndromic retinitis pigmentosa, and shown to have geographical and ethnical distribution in previous studies. This study provided a deeper understanding of the detailed clinical features using multimodal imaging, genetic spectrum, and genotype-phenotype correlations of USH2A-related retinal dystrophies in Taiwan. RESULTS: In our cohort, the mean age at first visit was 47.66 ± 13.54 years, and the mean age at symptom onset, which was referred to the onset of nyctalopia and/or visual field constriction, was 31.21 ± 15.24 years. Among the variants identified, 23 (50%) were missense, 10 (22%) were splicing variants, 8 (17%) were nonsense, and 5 (11%) were frameshift mutations. The most predominant variant was c.2802T>G, which accounted for 21% of patients, and was located in exon 13. Patients with truncated alleles had significantly earlier symptom onset and seemly poorer disease progression regarding visual acuity, ellipsoid zone line length, and hypofluorescent lesions in the macula than those who had the complete gene. However, the clinical presentation revealed similar progression between patients with and without the c.2802T>G variant. During long-term follow-up, the patients had different ellipsoid zone line progression rates and were almost evenly distributed in the fast, moderate, and slow progression subgroups. Although a younger onset age and a smaller baseline intact macular area was observed in the fast progression subgroup, the results showed no significant difference. CONCLUSIONS: This is the first cohort study to provide detailed genetic and longitudinal clinical analyses of patients with USH2A-related retinal dystrophies in Taiwan. The mutated allele frequency in exon 13 was high in Taiwan due to the predominant c.2802T>G variant. Moreover, truncated variants greatly impacted disease progression and determined the length of therapeutic windows. These findings provide insight into the characteristics of candidates for future gene therapies.

Transfusion outcomes and clinical safety of ABO-nonidentical platelets transfusion: A systematic review and meta-analysis.

BACKGROUND: ABO-nonidentical platelets transfusion has been frequently employed to address clinical platelets insufficiencies. The significance of ABO compatibility for platelets transfusion is not clearly defined. This study is aimed to explore the transfusion outcomes and clinical safety of ABO-nonidentical platelets transfusion. STUDY DESIGN AND METHODS: A systematic articles search was performed for eligible studies published up to November 30, 2023 through the PubMed, Embase, Cochrane library, Chinese National Knowledge Infrastructure database, Wanfang database and SinMed. Meta-analysis Of Observational Studies in Epidemiology study guidelines for observational studies and Newcastle Ottawa bias scale were implemented to assess studies. Meta-analysis was performed using Manager 5.3. This study is registered with PROSPERO, number CRD42023417824. RESULTS: A total of 11 retrospective cohort studies and 7 prospective cohort studies with a sample size of 104,359 platelets transfusions were included. There was significant difference in transfusion effectiveness between the ABO-identical and ABO-nonidentical platelets transfusions (RR 1.20, 95 % CI 1.11-1.38, P < 0.00001, I2 = 21 %), also the ABO-identical platelets transfusions showed more platelets increment than ABO-nonidentical ones, but it was not statistically significant (MD 0.34, 95 % CI - 0.01 to 0.70, P = 0.06, I2 = 0 %). Allergy and fever occurred more in ABO-nonidentical platelets transfusions in terms of adverse reactions (RR 0.63, 95 % CI 0.41-0.96, P = 0.03, I2 = 0 %; RR 0.59, 95 % CI 0.37-0.94, P = 0.03, I2 = 31 %). When it comes to the mortality, the ABO-identical platelets transfusions did not statistically improve survival in patients who received multiple platelets transfusions (RR 0.77, 95 % CI 0.72-0.83, P = 0.17, I2 = 38 %) and who only received less than 3 transfusions (RR 0.74, 95 % CI 0.52-1.06, P = 0.10, I2 = 47 %) compared with the ABO-nonidentical platelets transfusions. CONCLUSION: In comparison to ABO-identical platelets transfusions, nonidentical platelets transfusions exhibited lower transfusion efficacy. However, the clinical safety between these two groups was similar, which indicated that ABO-nonidentical transfusions are acceptable, albeit inferior to ABO-identical ones.

Real-Time Dynamic Intelligent Image Recognition and Tracking System for Rockfall Disasters.

Taiwan, frequently affected by extreme weather causing phenomena such as earthquakes and typhoons, faces a high incidence of rockfall disasters due to its largely mountainous terrain. These disasters have led to numerous casualties, government compensation cases, and significant transportation safety impacts. According to the National Science and Technology Center for Disaster Reduction records from 2010 to 2022, 421 out of 866 soil and rock disasters occurred in eastern Taiwan, causing traffic disruptions due to rockfalls. Since traditional sensors of disaster detectors only record changes after a rockfall, there is no system in place to detect rockfalls as they occur. To combat this, a rockfall detection and tracking system using deep learning and image processing technology was developed. This system includes a real-time image tracking and recognition system that integrates YOLO and image processing technology. It was trained on a self-collected dataset of 2490 high-resolution RGB images. The system's performance was evaluated on 30 videos featuring various rockfall scenarios. It achieved a mean Average Precision (mAP50) of 0.845 and mAP50-95 of 0.41, with a processing time of 125 ms. Tested on advanced hardware, the system proves effective in quickly tracking and identifying hazardous rockfalls, offering a significant advancement in disaster management and prevention.

The polymorphism analysis for CD36 among platelet donors.

CD36 may defect on platelets and/or monocytes in healthy individuals, which was defined as CD36 deficiency. However, we did not know the correlation between the molecular and protein levels completely. Here, we aim to determine the polymorphisms of the CD36 gene, RNA level, and CD36 on platelets and in plasma. The individuals were sequenced by Sanger sequencing. Bioinformational analysis was used by the HotMuSiC, CUPSAT, SAAFEC-SEQ, and FoldX. RNA analysis and CD36 protein detection were performed by qPCR, flow cytometry, and ELISA. In this study, we found c.1228_1239delATTGTGCCTATT (allele frequency = 0.0072) with the highest frequency among our cohort, and one mutation (c.1329_1354dupGATAGAAATGATCTTACTCAGTGTTG) was not present in the dbSNP database. 5 mutations located in the extracellular domain sequencing region with confirmation in deficient individuals, of which c.284T>C, c.512A>G, c.572C>T, and c.869T>C were found to have a deleterious impact on CD36 protein stability. Furthermore, the MFI of CD36 expression on platelets in the mutation-carry, deleterious-effect, and deficiency group was significantly lower than the no-mutation group (P < 0.0500). In addition, sCD36 levels in type II individuals were significantly lower compared with positive controls (P = 0.0060). Nevertheless, we found the presence of sCD36 in a type I individual. RNA analysis showed CD36 RNA levels in platelets of type II individuals were significantly lower than the positive individuals (P = 0.0065). However, no significant difference was observed in monocytes (P = 0.7500). We identified the most prevalent mutation (c.1228_1239delATTGTGCCTATT) among Kunming donors. Besides, our results suggested RNA level alterations could potentially underlie type II deficiency. Furthermore, sCD36 may hold promise for assessing immune reaction risk in CD36-deficient individuals, but more studies should be conducted to validate this hypothesis.

Chlorination Design for Highly Stable Electrolyte toward High Mass Loading and Long Cycle Life Sodium-Based Dual-Ion Battery.

Sodium-based dual ion batteries (SDIBs) have garnered significant attention as novel energy storage devices offering the advantages of high-voltage and low-cost. Nonetheless, conventional electrolytes exhibit low resistance to oxidation and poor compatibility with electrode materials, resulting in rapid battery failure. In this study, for the first time, a chlorination design of electrolytes for SDIB, is proposed. Using ethyl methyl carbonate (EMC) as a representative, chlorine (Cl)-substituted EMC not only demonstrates increased oxidative stability ascribed to the electron-withdrawing characteristics of chlorine atom, electrolyte compatibility with both the cathode and anode is also greatly improved by forming Cl-containing interface layers. Consequently, a discharge capacity of 104.6 mAh g-1 within a voltage range of 3.0-5.0 V is achieved for Na||graphite SDIB that employs a high graphite cathode mass loading of 5.0 mg cm-2, along with almost no capacity decay after 900 cycles. Notably, the Na||graphite SDIB can be revived for an additional 900 cycles through the replacement of a fresh Na anode. As the mass loading of graphite cathode increased to 10 mg cm-2, Na||graphite SDIB is still capable of sustaining over 700 times with ≈100% capacity retention. These results mark the best outcome among reported SDIBs. This study corroborates the effectiveness of chlorination design in developing high-voltage electrolytes and attaining enduring cycle stability of Na-based energy storage devices.

Extracorporeal photopheresis reduces inflammation and joint damage in a rheumatoid arthritis murine model.

BACKGROUND: Rheumatoid arthritis (RA) is an autoimmune disease characterized by inflammatory reactions and tissue damage in the joints. Long-term drug use in clinical practice is often accompanied by adverse reactions. Extracorporeal photopheresis (ECP) is an immunomodulatory therapy with few side effects, offering a potential and safe therapeutic alternative for RA through the induction of immune tolerance. This study aimed to investigate the therapeutic effects of ECP on RA using a collagen-induced arthritis (CIA) murine model, as well as to explore its immunomodulatory effects in vivo. Additionally, particular attention was given to the significant role of monocytes during the ECP process. METHODS: A murine model of rheumatoid arthritis was established by administering two injections of bovine type II collagen to DBA/1J mice. ECP, ECP-MD (mononuclear cells were depleted during the ECP), MTX, and PBS treatment were applied to the CIA mice. During the treatment process, clinical scores and body weight changes of CIA mice were closely monitored. After six treatment sessions, micro-CT images of the hind paws from live mice were captured. Ankle joints and paws of the mice were collected and processed for histological evaluation. Spleen samples were collected to measure the Th17/Treg cells ratio, and serum samples were collected to assess cytokine and anti-type II collagen IgG levels. Monocytes and dendritic cells populations before and after ECP in vitro were detected by flow cytometry. RESULT: ECP therapy significantly attenuated the progression of CIA, alleviated the severity of clinical symptoms in CIA mice and effectively suppressed synovial hyperplasia, inflammation, and cartilage damage. There was an expansion in the percentage of CD3 + CD4 + CD25 + FoxP3 + Tregs and a decrease in CD3 + CD4 + IL17A + Th17 cells in vivo. Furthermore, ECP reduced the serum levels of pro-inflammatory cytokines IL-6 (53.47 ± 7.074 pg/mL vs 5.142 ± 1.779 pg/mL, P < 0.05) and IL-17A (3.077 ± 0.401 pg/mL vs 0.238 ± 0.082 pg/mlL, P < 0.0001) compared with PBS. Interestingly, the depletion of monocytes during the ECP process did not lead to any improvement in clinical symptoms or histological scores in CIA mice. Moreover, the imbalance in the Th17/Treg cells ratio became even more pronounced, accompanied by an augmented secretion of pro-inflammatory cytokines IL-6 and IL-17A. In vitro, compared with cells without ECP treatment, the proportion of CD11b + cells were significantly reduced (P < 0.01), the proportion of CD11c + cells were significantly elevated (P < 0.001) 24 h after ECP treatment. Additionally, the expression of MHC II (P < 0.0001), CD80 (P < 0.01), and CD86 (P < 0.001) was downregulated in CD11c + cells 24 h after ECP treatment. CONCLUSION: Our study demonstrates that ECP exhibits a therapeutic effect comparable to conventional therapy in CIA mice, and the protective mechanisms of ECP against RA involve Th17/Treg cells ratio, which result in decreased IL-6 and IL-17A. Notably, monocytes derived from CIA mice are an indispensable part to the efficacy of ECP treatment, and the proportion of monocytes decreased and the proportion of tolerogenic dendritic cells increased after ECP treatment in vitro.

Pediatric oncology drug development and dosage optimization.

Oncology drug discovery and development has always been an area facing many challenges. Phase 1 oncology studies are typically small, open-label, sequential studies enrolling a small sample of adult patients (i.e., 3-6 patients/cohort) in dose escalation. Pediatric evaluations typically lag behind the adult development program. The pediatric starting dose is traditionally referenced on the recommended phase 2 dose in adults with the incorporation of body size scaling. The size of the study is also small and dependent upon the prevalence of the disease in the pediatric population. Similar to adult development, the dose is escalated or de-escalated until reaching the maximum tolerated dose (MTD) that also provides desired biological activities or efficacy. The escalation steps and identification of MTD are often rule-based and do not incorporate all the available information, such as pharmacokinetic (PK), pharmacodynamic (PD), tolerability and efficacy data. Therefore, it is doubtful if the MTD approach is optimal to determine the dosage. Hence, it is important to evaluate whether there is an optimal dosage below the MTD, especially considering the emerging complexity of combination therapies and the long-term tolerability and safety of the treatments. Identification of an optimal dosage is also vital not only for adult patients but for pediatric populations as well. Dosage-finding is much more challenging for pediatric populations due to the limited patient population and differences among the pediatric age range in terms of maturation and ontogeny that could impact PK. Many sponsors defer the pediatric strategy as they are often perplexed by the challenges presented by pediatric oncology drug development (model of action relevancy to pediatric population, budget, timeline and regulatory requirements). This leads to a limited number of approved drugs for pediatric oncology patients. This review article provides the current regulatory landscape, incentives and how they impact pediatric drug discovery and development. We also consider different pediatric cancers and potential clinical trial challenges/opportunities when designing pediatric clinical trials. An outline of how quantitative methods such as pharmacometrics/modelling & simulation can support the dosage-finding and justification is also included. Finally, we provide some reflections that we consider helpful to accelerate pediatric drug discovery and development.