De novel heterozygous copy number deletion on 7q31.31-7q31.32 involving TSPAN12 gene with familial exudative vitreoretinopathy in a Chinese family.

AIM: To investigate the genetic and clinical characteristics of patients with a large heterozygous copy number deletion on 7q31.31-7q31.32. METHODS: A family with familial exudative vitreoretinopathy (FEVR) phenotype was included in the study. Whole-exome sequencing (WES) was initially used to locate copy number variations (CNVs) on 7q31.31-31.32, but failed to detect the precise breakpoint. The long-read sequencing, Oxford Nanopore sequencing Technology (ONT) was used to get the accurate breakpoint which is verified by quantitative real-time polymerase chain reaction (QPCR) and Sanger Sequencing. RESULTS: The proband, along with her father and younger brother, were found to have a heterozygous 4.5 Mb CNV deletion located on 7q31.31-31.32, which included the FEVR-related gene TSPAN12. The specific deletion was confirmed as del(7)(q31.31q31.32)chr7:g.119451239_123956818del. The proband exhibited a phase 2A FEVR phenotype, characterized by a falciform retinal fold, macular dragging, and peripheral neovascularization with leaking of fluorescence. These symptoms led to a significant decrease in visual acuity in both eyes. On the other hand, the affected father and younger brother showed a milder phenotype. CONCLUSION: The heterozygous CNV deletion located on 7q31.31-7q31.32 is associated with the FEVR phenotype. The use of long-read sequencing techniques is essential for accurate molecular diagnosis of genetic disorders.

BEST1 novel mutation causes Bestrophinopathies in six families with distinct phenotypic diversity.

PURPOSE: To report novel BEST1 variants in six Chinese families with bestrophinopathies of two different inheritance modes and analyze the intrafamilial phenotypic diversity. METHOD: A total of 25 participants including 13 patients and 12 healthy family members from 6 Chinese families with bestrophinopathies were available for genetic and clinical analysis. All of the patients were subjected to comprehensive ophthalmic evaluations and exome sequencing was performed on the probands to detect the causative variants. The pathogenicity of gene variants was predicted using silico analysis and evaluated according to ACMG guidelines. All (likely) pathogenic variants were determined by Sanger sequencing and co-segregation analyses were performed on available family members. The relevant original literature previously reported was retrieved to explore the relationship between BEST1-related gene variants and clinical features. RESULTS: In the 6 families, 3 families (10 patients) were assigned as autosomal dominant bestrophinopathies (VMD) and 3 families (3 patients) were assigned as Autosomal recessive Bestrophinopathies (ARB). A total of 9 variants on the BEST1 gene were identified, containing 7 missense variants, 1 nonsense variant, and 1 frameshift variant, respectively, of which 3 variants c.88A > G (p.Lys30Glu), c.764G > A (p.Arg255Gln) and c.233dupT (p.Ser79Phefs*153) were novel variants. Three families with ARB were detected with heterozygous variants on the BEST1 gene.2 families (8 patients) with BVMD showed markedly irregular dominant inheritance, and the severity of macular lesions varies greatly among individuals of the same family. Among them, the probands showed typical vitelliform lesions in the macula, while the other six patients had no visible signs of the disease by fundus photography (ophthalmoscopy) and minor lesions could be detected on OCT in two patients, the continuity of the ellipsoidal band was interrupted with the chimeric band. The phenotypes of the patients in the three ARB families ranged from typical/atypical vitelliform lesions to extensive extramacular deposits (peripheral spots). CONCLUSION: This study provided evidence that the phenotype of BVMD manifested irregular dominant inheritance, with patients carrying a pathogenic heterozygous variant of BEST1 to develop obvious intrafamilial phenotypic diversity, and the patients who harbor two pathogenic alleles showed recessive inheritance bestrophinopathies with distinct phenotypic diversity. Our study also emphasized the importance of comprehensive genetic analysis in patients with bestrophinopathies, and in such challenging families with distinct intrafamilial phenotypic diversity, it shall provide novel insights into phenotypic assessments of bestrophinopathies, and contribute to better diagnosis, prognosis, and treatment for these patients.

Xp21 DNA microdeletion syndrome in a Chinese family: clinical features show retinitis pigmentosa and chronic granuloma.

Xp21 DNA microdeletion syndrome is a very rare disease characterized by retinitis pigmentosa (RP), chronic granulomatous disease (CGD), and McLeod syndrome (MLS). Due to the complex and diverse clinical manifestations, early diagnosis remains a challenge for many physicians. In this study, for the purpose of determining the pathogenic gene variants and definitive diagnosis in a patient medically backgrounded with RP and CGD from a normal Chinese family, whole-exome sequencing (WES) was performed in this proband and copy number variation (CNV) was further verified in other family members by qPCR. A genetic evaluation revealed that the short arm of the X chromosome in the proband had a deletion CNV Xp21.1p11.4 (37431123-38186681) of approximately 0.755 Mb in size, and contained three contiguous OMIM genes as X-linked Kx blood group antigen (XK), cytochrome b-245 beta chain (CYBB), and RP GTPase regulator (RPGR). The qPCR results confirmed the copy number loss in Xp21.1p11.4 present in the proband and his unaffected mother. According to the American College of Medical Genetics and Genomics (ACMG) guidelines for the CNV interpretation, the deletion of this segment was a pathogenic variant. Our results provided evidence that CNV deletion of Xp21.1p11.4 in the short arm of the X chromosome was a pathogenic variant in such Chinese RP and CGD family, and the McLeod phenotype was not yet available. This study suggests that genetic testing is essential for a definitive diagnosis, which should better assist physicians in prediction, diagnosis, genetic counseling, and guidance for Xp21 DNA microdeletion syndrome.

New pathogenic variants of ALMS1 gene in two Chinese families with Alström Syndrome.

PURPOSE: Alström Syndrome (AS) is an autosomal recessive hereditary disease with the characteristics of multiorgan dysfunction. Due to the heterogeneity of clinical manifestations of AS, genetic testing is crucial for the diagnosis of AS. Herein, we used whole-exome sequencing (WES) to determine the genetic causes and characterize the clinical features of three affected patients in two Chinese families with Alström Syndrome. MATERIALS AND METHODS: Three affected patients (initially diagnosed as achromatopsia). and five asymptomatic members were recruited for both genetic and clinical tests. The complete ophthalmic examinations and systemic examinations were performed on all participants. Whole exome sequencing (WES) was performed for mutation detection. The silico analysis was also applied to predict the pathogenesis of identified pathogenic variants. RESULTS: In family 1, the proband showed low vision, hyperopia, photophobia, nystagmus, and total color blindness. DNA analysis revealed that she carried a compound heterozygote with two novel pathogenic variants in the ALMS1 gene NM_015120.4:c.10379del (NP_055935.4:p.(Asp2252Tyr)) and NM_015120.4:c.11641_11642del (NP_055935.4:p.(Val3881ThrfsTer11)). Further systemic examinations showed short stature, acanthosis nigricans, and sensorineural hearing loss. In family 2, two affected siblings presented the low vision, hyperopia, photophobia, nystagmus, and total color blindness. DNA analysis revealed that they carried a same compound heterozygote with two novel pathogenic variants in the ALMS1 gene NM_015120.4:c.10379del (NP_055935.4:p.(Asn3460IlefsTer49)), NM_015120.4:c.10819C > T (NP_055935.4:p.(Arg3607Trp)). Further systemic examinations showed obesity and mild abnormalities of lipid metabolism. According to the genetic testing results and further systemic analysis, the three affected patients were finally diagnosed as Alström Syndrome (AS). CONCLUSIONS: We found two new compound heterozygous pathogenic variants of the ALMS1 gene and determined the diagnosis as Alström Syndrome in three patients of two Chinese families. Our study extends the genotypic and phenotypic spectrums for ALMS1 -AS and emphasizes the importance of gene testing in assisting the clinical diagnosis for cases with phenotypic diversities, which would help the AS patients with early diagnosis and treatment to reduce future systemic damage.

Evaluating the association between MPDZ-NF1B rs1324183 and keratoconus in an independent northwestern Chinese population.

BACKGROUND: Keratoconus (KC) is a complex, non-inflammatory corneal degenerative disease. Although numerous studies have analyzed the correlation of SNP rs1324183, which located in MPDZ-NF1B gene, and KC in different populations, only few findings were repeated. In this study, to evaluate the association between rs1324183 and KC in a new independent Chinese population, we performed a replication study of the significantly associated rs1324183. METHODS: In total of 114 unrelated KC patients and 88 unrelated controls were recruited from Ningxia, China. We detected the genotypes and alleles of rs1324183 using PCR technology and Sanger sequencing and also analyzed the association between this locus and KC, its clinical parameters by statistical methods. RESULTS: The frequency of genotype AA (11, 9.6%) and genotypes containing allele A (47, 41.2%) of rs1324183 in KC were both higher than those of the control group. And genotype AA of rs1324183 conferred a higher risk of KC (OR > 1). Moreover, corneal parameter Belin/Ambrósio enhanced ectasia display final D value (BAD-D) had significant correlation (p = 0.002) with AA genotype of rs1324183 in KC. CONCLUSIONS: Our replication study indicates that the results of rs1324183 associated with KC in our population is robust and further better illustrates the significance of BAD-D as a diagnostic indicator for KC. rs1324183 should be considered as the first genetic mark of KC risk in its future diagnosis.

A novel stop codon mutation of TSPAN12 gene in Chinese patients with familial exudative vitreoretinopathy.

BACKGROUND: Familial exudative vitreoretinopathy (FEVR) is a group of inherited eye diseases characterized by premature arrest of retinal vessel development. The purpose of our study was to characterize the genetic causes and clinical features in eight Chinese families with FEVR using next-generation sequencing (NGS) technology. MATERIALS AND METHODS: Eight families with FEVR were included in genetic and clinical analyses. We screened the proband and the parents in eight pedigrees with FEVR using targeted NGS approach and in silico analysis to determine the causative mutation for their family's phenotype. RESULTS: Four cases (4/8, 50.0%) were confirmed to harbor mutations in known genes, including 3 novel mutations and one previously reported mutation. Among the detected mutations, TSPAN12 accounted for 75% (3/4). We identified a novel stop codon of TSPAN12, a heterozygous missense mutation NM_012338.4:c.633T>A, NP_036470.1:p.Tyr211Ter involved in highly conserved residues in the proband. Retrospective analysis of its clinical manifestation showed that the mutant carrier presented mild clinical features. CONCLUSIONS: We found the novel stop codon mutation p.Tyr211Ter in the TSPAN12, which creates a milder phenotype. Discovery of this novel mutation expands the mutation spectrum of TSPAN12, and would be valuable for future genetic disease diagnosis.

Identification of a novel FOXL2 mutation in a fourth-generation Chinese family with blepharophimosis-ptosis-epicanthus inversus syndrome.

AIM: To characterize the genetic causes and clinical features in a four-generation Chinese family with blepharophimosis-ptosis-epicanthus inversus syndrome (BPES). METHODS: Thirteen patients with BPES and eight healthy family members were included in this study. All participants received routine ophthalmic examinations. The target next-generation sequencing (NGS) was performed to determine the causative mutation for this family. The silico analysis was also applied to predict the pathogenesis of identified mutations. RESULTS: All patients had severe ptosis, normal intelligence, female patients have normal fertility. Genetic assessments revealed a heterozygous insertion variation in FOXL2 gene, c.672_701insGCGGCTGCCGC CGCAGCTGCTG CAGGCGCT (p.Ala234_Gly235linsAAAAAAAAGA), carried by 13 patient but absent in all unaffected members. In silico analysis supported the pathogenic nature of this highly conserved variant. This mutation resulted in the insertion of 10 amino acids into the encoded polyala nine chain, which increased the number of original polyalanine chains from 14 to 24, resulting in an extended protein. CONCLUSION: A novel FOXL2 mutation c.672_701ins GCGGCTGCCGCCGCAGCTGCTGC AGGCGCT (p.Ala234_Gly235linsAAAAAAAAGA) was identified in a large Chinese family with BPES. This study amplified the genotypic spectrum of FOXL2-BPES and better illustrates its genotype-phenotype correlations, which provided a basis for elucidating the pathogenesis of BPES and genetic counseling.