Mononuclear copper(II) complexes with polypyridyl ligands: synthesis, characterization, DNA interactions/cleavages and in vitro cytotoxicity towards human cancer cells.

DNA being the necessary element in cell regeneration, controlled cellular apoptosis via DNA binding/cleaving is considered an approach to combat cancer cells. The widely prescribed metallodrug cisplatin has shown interactions with the guanine-N7 center, and a plethora of complexes are continually developed to enhance crosslinking properties as well as covalent and non-covalent interactions. Two pentadentate ligands, L1 (1-(6-(1H-benzo[d]imidazol-2-yl)pyridin-2-yl)-N,N-bis(pyridin-2-ylmethyl)methanamine) and L2 (1-(6-(1-methyl-1H-benzo[d]imidazol-2-yl)pyridin-2-yl)-N,N-bis(pyridin-2-ylmethyl)methanamine), were synthesized together with their respective copper(II) complexes [1](ClO4)2 and [2](ClO4)2, which crystallized in a trigonal bipyramidal fashion. Different analytical and spectroscopic methods confirmed their formation, and their redox behaviour was also examined. The interactions of salmon sperm DNA (ss-DNA) with these two complexes were explored using absorbance spectroscopy, and they both exhibited a binding affinity (Kb) of ∼104 M-1. Fluorescence quenching experiments with ethidium bromide (EB)-bound DNA (EB-DNA) were also performed, and Stern-Volmer constant (KSV) values of 6.93 × 103 and 2.34 × 104 M-1 for [1](ClO4)2 and [2](ClO4)2, respectively, were obtained. Furthermore, DNA conformational changes due to the interactions of both complexes were validated via circular dichroism. We also assessed the DNA cleavage property of these complexes, which resulted in the linearization of circular plasmid DNA. This finding was supported by studying the growth of MDA-MB-231 breast cancer cells upon treatment with both Cu(II) complexes; IC50 values of 5.34 ± 1.02 µM and 0.83 ± 0.18 µM were obtained for [1](ClO4)2 and [2](ClO4)2, respectively. This validates their affinity towards DNA, and these insights can be further utilized for non-platinum based economical metallodrug development based on first row transition metals.

Chromophore appended DPA-based copper(II) complexes with a diimine motif towards DNA binding and fragmentation studies.

Mixed ligand copper(II) complexes [Cu(L1)(bpy)](ClO4)21 and [Cu(L2)(bpy)](ClO4)22 (where L1 = 1-(anthracen-9-yl)-N,N-bis(pyridin-2-ylmethyl)methanamine, L2 = 1-(pyren-1-yl)-N,N-bis(pyridin-2-ylmethyl)methanamine and bpy = 2,2'-bipyridine) were synthesised and characterised thoroughly via different analytical and spectroscopic techniques i.e., UV-vis spectroscopy, fluorescence spectroscopy, FT-IR spectroscopy, HRMS and EPR spectroscopy. The molecular structures of the synthesised complexes were obtained using the single-crystal X-ray diffraction technique. Both complexes exhibited penta-coordinated and acquired distorted square pyramidal geometry. The redox behaviour of complexes 1 and 2 was investigated by employing cyclic voltammetry. The DNA binding study was carried out by UV-vis spectrophotometry using double-stranded salmon sperm DNA (ds-ss-DNA). The binding constant (Kb) values of 1 and 2 were 0.11 × 104 M-1 and 1.05 × 104 M-1, respectively, which indicates that 2 has better binding ability than 1. This might be due to the higher conjugative abilities with the extended surface area of the aromatic pyrene ring compared to the anthracene moiety. The fluorescence quenching experiments were also performed with EB bound DNA (EB-DNA) and Stern-Volmer constant (KSV) values were calculated as 1.23 × 105 M-1 and 1.39 × 105 M-1 for 1 and 2, respectively, suggesting that 2 showed stronger interaction with ss-DNA than 1. The molecular docking data support the DNA-binding studies, with the sites and mode of interactions against B-DNA varying with 1 and 2. Evaluation of the DNA binding properties of the complexes to linearized plasmid DNA indicated that 2 had modest DNA binding properties, which is a pre-requisite for a genotoxic agent. The effect of 1 and 2 on cell survival was analysed using HeLa cells by MTT assay and it was observed that the IC50 values of 1 and 2 were 43.7 µM and 18.6 µM, respectively. Our study paves the way for the designing of bio-inspired novel mixed metal complexes, which shows promising results for further exploration of molecular and mechanistic studies towards the development of non-platinum based economical metallodrugs.

Fabrication and integration of a low-cost 3D printing-based glucose biosensor for bioprinted liver-on-a-chip.

In the last two decades, significant progress has been made in the development of more physiologically relevant organ-on-a-chip (OOC) systems that can mimic tissue microenvironments. Despite the advantages of these microphysiological systems, such as portability, ability to mimic physiological flow conditions, and reduction of the number of reagents required for preparation and detection, they lack real-time analyte detection with high accuracy. To address this limitation, biosensor technologies have been integrated with OOC systems to facilitate simultaneous analysis of different analytes with a single device. However, the integration of biosensors with OOC systems is challenging because of the competing demands of low-cost, simple fabrication processes and speed. In this study, we fabricate a glucose-sensing device and integrate it with a liver-on-a-chip (LOC) platform. A carbon black-polylactic acid-based three-electrode system was printed using fused deposit molding 3D printing technology to simplify the fabrication process. The sensitivity of the fabricated glucose biosensing device was enhanced by coating the electrodes with multi-walled carbon nanotubes. A biosensing integration study performed using a perfusion-based LOC demonstrated the stability, biocompatibility, and sensitivity of the proposed glucose sensing device. Furthermore, drug-toxicity studies conducted using the LOC platform demonstrated the ability of the device to detect a broad range of glucose concentrations and its enhanced sensitivity.

Development of lumen-based perfusable 3D liver in vitro model using single-step bioprinting with composite bioinks.

Hepatic sinusoids are uniquely organized structures that help maintain a spectrum of hepatic functions. Although several in vitro liver models have been developed to replicate liver sinusoids, most of these platforms require complex, multi-step fabrication methods making it difficult to achieve truly three-dimensional (3D) channel geometries. In this study, a single-step bioprinting technique was demonstrated to simultaneously print a chip platform and develop a perfusable vascularized liver sinusoid in vitro model. The integrated system uses a co-axial-based bioprinting approach to develop a liver sinusoid-like model that consists of a sacrificial core compartment containing a perfusable pre-vascular structure and an alginate-collagen-based shell compartment containing hepatocytes. The lumen-based perfusable 3D liver sinusoid-on-a-chip (LSOC-P) demonstrated significantly better hepatocyte viability, proliferation, and liver-specific gene and protein expression compared to a 3D hepatocyte-based core/shell model with static media and the standard hepatocyte-based 2D sandwich culture system. A drug toxicity evaluation of hepatotoxins highlighted the comparatively higher sensitivity of the LSOC system with a close estimation of the therapeutic range of safe drug concentrations for humans. In conclusion, the current findings indicate that the combinatorial single-step co-axial bioprinting technique is a promising fabrication approach for the development of a perfusable LSOC platform for drug screening applications.

Emergent multipath COVID-19 specimen collection problem with green corridor through variable length GA.

The COVID-19 pandemic has spread worldwide exponentially. Typically, for testing, a provincial main government hospital cum testing center collects patients' specimens from remote health centers in the minimum possible time, satisfying the 'false negativity' constraint of the first collected specimen. With infrastructural developments throughout the world, multiple paths are available for transportation between two cities. Currently, the 'green corridor' is used for the transportation of human organs to be implanted, travel of VIPs, etc., in the minimum possible time. Taking these facts in consideration, for the first time, a green corridor system is suggested to provide a transportation pathway from small hospitals and urban/rural health centers to the testing center with COVID-19 specimens such as blood, nasal and throat swabs, and viral RNA, within the first collected specimen's life period. As health centers are located in different places, appropriate routing plans are needed for visiting them in the minimum possible time. A problem arises if this routing time exceeds the 'false negativity' of the first collected specimen. Thus, multipath COVID-19 specimen collection problems (MPC-19SCPs) are mathematically formulated to be collected from all health centers, and optimum routing plans are obtained using fixed and variable length genetic algorithms (VLGAs) developed for this purpose. For the first time, green corridor systems are suggested to incorporate the centers. The objectives of the models are, subject to the 'false-negative" constraint, minimization of the system time (Model A) and the green corridor time without or with mutual cooperation among the minimum number of centers for the transfer of specimens (Models B and C, respectively). The developed algorithms are based on variable length chromosomes, probabilistic selection, comparison crossover and generation-dependent mutation. Some benchmark instances from TSPLIB are solved by VLGA and GA. The competitiveness of VLGA is established through ANOVA. The models are numerically demonstrated, and some conclusions are derived.

Understanding Mutations in Human SARS-CoV-2 Spike Glycoprotein: A Systematic Review & Meta-Analysis.

Genetic variant(s) of concern (VoC) of SARS-CoV-2 have been emerging worldwide due to mutations in the gene encoding spike glycoprotein. We performed comprehensive analyses of spike protein mutations in the significant variant clade of SARS-CoV-2, using the data available on the Nextstrain server. We selected various mutations, namely, A222V, N439K, N501Y, L452R, Y453F, E484K, K417N, T478K, L981F, L212I, N856K, T547K, G496S, and Y369C for this study. These mutations were chosen based on their global entropic score, emergence, spread, transmission, and their location in the spike receptor binding domain (RBD). The relative abundance of these mutations was mapped with global mutation D614G as a reference. Our analyses suggest the rapid emergence of newer global mutations alongside D614G, as reported during the recent waves of COVID-19 in various parts of the world. These mutations could be instrumentally imperative for the transmission, infectivity, virulence, and host immune system's evasion of SARS-CoV-2. The probable impact of these mutations on vaccine effectiveness, antigenic diversity, antibody interactions, protein stability, RBD flexibility, and accessibility to human cell receptor ACE2 was studied in silico. Overall, the present study can help researchers to design the next generation of vaccines and biotherapeutics to combat COVID-19 infection.

Mononuclear cobalt(II) complexes with polypyridyl ligands: Synthesis, characterization, DNA interactions and in vitro cytotoxicity towards human cancer cells.

Mononuclear cobalt(II) complexes [CoII(L1)Cl2]; 1, [CoII(L1)(bpy)Cl]PF6; 2, [CoII(L1)(phen)Cl]PF6; 3 and [CoII(L2)Cl2]; 4 (where L1 = N,N-bis(pyridin-2-ylmethyl)aniline, L2 = (2,4,6-trimethyl-N,N-bis(pyridin-2-ylmethyl)aniline, bpy = 2,2/-bipyridine, phen = 1,10-phenanthroline) were synthesized and characterized by different analytical and spectroscopic methods. All the complexes were structurally identified by single-crystal X-ray crystallography. Penta-coordinated complex 1 adopted distorted trigonal bipyramidal and hexacoordinated complexes 2 and 3 having distorted octahedral geometry whereas tetra-coordinated complex 4 has distorted tetrahedral geometry. The interactions of salmon sperm DNA (ss-DNA) with complexes (1-4) were investigated by absorbance, fluorescence spectroscopy and molecular docking studies. All the complexes are very susceptible to DNA binding and the binding affinity (Kb) follows the order 3 (2.05 × 104 M -1) > 4 (1.40 × 104 M -1) > 2 (1.36 × 104 M -1) > 1 (1.34 × 104 M -1) indicating they have superior DNA binding ability. The Stern-Volmer constant (Ksv) ranges from 1.10 × 104 M -1 to 1.95 × 104 M -1 suggesting weak or moderate binding with DNA. DNA cleavage study in plasmid DNA reveals very efficient DNA cleavage factors even in the absence of any external agents. Using multiple biochemical assays, we have demonstrated that 1-4 induces apoptosis of human cancer cells with IC50 values of 26.48 ± 1.45 µM, 10.89 ± 0.55 µM, 7.63 ± 0.4 µM and 37.67 ± 2.06 µM, respectively in A549 lung adenocarcinoma cells and 14.45 ± 0.73 µM, 1.97 ± 0.1 µM, 0.98 ± 0.05 µM and 24.43 ± 1.22 µM, respectively in MDA-MB-231 breast adenocarcinoma cells.

Mononuclear Co(II) polypyridyl complexes: synthesis, molecular structure, DNA binding/cleavage, radical scavenging, docking studies and anticancer activities.

Mononuclear Co(II) complexes [CoII(L)Cl2]; 1, [CoII(L)(bpy)Cl]PF6; 2, [CoII(L)(phen)Cl]PF6; 3 and [CoII(L)(pic)Cl]; 4, (where L = N,N-bis(pyridin-2-ylmethyl)aniline, bpy = 2,2'-bipyridine, phen = 1,10-phenanthroline, pic = picolinic acid) were systematically synthesized and characterized by different analytical and spectroscopic methods. All the complexes were structurally identified by single-crystal X-ray diffraction analysis. Penta-coordinated complex 1 adopted a distorted trigonal bipyramidal geometry, whereas hexacoordinated complexes 2-4 have distorted octahedral geometry. The interactions of salmon sperm DNA (ss-DNA) with our synthesized complexes 1-4 were investigated by absorbance and fluorescence spectroscopy. All the complexes are very susceptible to DNA binding and exhibited binding affinities (Kb) in the order of ∼104 M-1, indicating their strong interaction with ss-DNA. The Stern-Volmer constant (Ksv) ranged from 0.46 ± 0.01 × 104 to 1.08 ± 0.04 × 104 M-1, suggesting weak or moderate binding with DNA. Agarose gel electrophoresis revealed the DNA cleavage activity in vitro for 2-4, which could efficiently cleave the supercoiled plasmid DNA without any external agents; however, with the addition of H2O2, the cleavage property was enhanced. Live-cell imaging and other biochemical assays demonstrated the ability of Co(II) complexes 1-4 to induce significant cytotoxicity in A549 lung cancer cells with IC50 values of 32.14 ± 1.3 µM, 3.14 ± 0.16 µM, 15.78 ± 0.72 µM and 18.45 ± 0.92 µM, and in MDA-MB-231 breast cancer cells with IC50 values of 20.42 ± 0.92 µM, 0.41 ± 0.02 µM, 2.31 ± 0.12 µM and 9.67 ± 0.35 µM, respectively.

Engineering Hydrogels for the Development of Three-Dimensional In Vitro Models.

The superiority of in vitro 3D cultures over conventional 2D cell cultures is well recognized by the scientific community for its relevance in mimicking the native tissue architecture and functionality. The recent paradigm shift in the field of tissue engineering toward the development of 3D in vitro models can be realized with its myriad of applications, including drug screening, developing alternative diagnostics, and regenerative medicine. Hydrogels are considered the most suitable biomaterial for developing an in vitro model owing to their similarity in features to the extracellular microenvironment of native tissue. In this review article, recent progress in the use of hydrogel-based biomaterial for the development of 3D in vitro biomimetic tissue models is highlighted. Discussions of hydrogel sources and the latest hybrid system with different combinations of biopolymers are also presented. The hydrogel crosslinking mechanism and design consideration are summarized, followed by different types of available hydrogel module systems along with recent microfabrication technologies. We also present the latest developments in engineering hydrogel-based 3D in vitro models targeting specific tissues. Finally, we discuss the challenges surrounding current in vitro platforms and 3D models in the light of future perspectives for an improved biomimetic in vitro organ system.

Design, synthesis, structural, spectral, and redox properties and phenoxazinone synthase activity of tripodal pentacoordinate Mn(II) complexes with impressive turnover numbers.

Catechol oxidase (CO) and phenoxazinone synthase (PHS) are two enzymes of immense significance due to their capability to oxidize catechols and o-aminophenols to o-quinones and phenoxazinones, respectively. In this connection two mononuclear manganese complexes with the molecular framework [MnII(Ln)Cl]Cl {L1: tris((1H-benzo[d]imidazol-2-yl)methyl)amine; n = 1 and L2: tris(N-methylbenzimidazol-2-ylmethyl)amine; n = 2} have been designed to be potential catalysts for OAPH (o-aminophenol) oxidation. Both the ligands and their corresponding metal complexes have been successfully synthesized and thoroughly characterized by different spectroscopic and analytical techniques such as FT-IR, 1H NMR, UV-vis spectroscopy, EPR spectroscopy and ESI mass spectroscopy. The molecular structures of [MnII(L1)Cl]Cl (1) and [MnII(L2)Cl]Cl (2) have been revealed by a single-crystal X-ray diffraction study. The spectral properties and redox behaviour of both the complexes were examined. Under ambient conditions, 1 and 2 show excellent phenoxazinone synthase activity as both are very susceptible to oxidize o-aminophenol to phenoxazinone. The kinetic parameters for both complexes have been determined by analyzing the experimental spectroscopic data. The turnover numbers (kcat value) of these two complexes are extremely high, 440 h-1 and 234 h-1 for 1 and 2, respectively. The present report offers a thorough overview of information involving the role of the metal ions and their extent of phenoxazinone synthase mimicking activity. The oxidation of o-aminophenol to 2-amino-3H-phenoxazine-3-one (APX) by catalytic oxidation of oxygen (O2) by the reaction with transition metal complexes has been an important study for the last few decades. The current study evidently showed better performance of our synthesized Mn(II) complexes than all the predecessors. The plausible mechanism has been reiterated based on the experimental data via ESI-MS spectra and considering the concepts from the previously reported mechanisms involved in the formation of hydrogen peroxide (H2O2) as an intermediate substrate is fairly indicating the involvement of molecular oxygen in the catalytic cycle.

Synthesis, Characterization, and Water Oxidation Activity of Isomeric Ru Complexes.

The synthesis and characterization of the isomeric ruthenium complexes with the general formula cis- and trans-[Ru(trpy)(qc)X]n+ (trpy is 2,2':6',2″-terpyridine, qc is 8-quinolinecarboxylate, cis-1 and trans-1, X = Cl, n = 0; cis-2 and trans-2, X=OH2, n = 1) with respect to the relative disposition of the carboxylate and X ligands are reported. For comparison purposes, another set of ruthenium complexes with general formula cis- and trans-[Ru(trpy)(pic)(OH2)]+ (pic is 2-picolinate (cis-3, trans-3)) have been prepared. The complexes with a qc ligand show a more distorted geometry compared to the complexes with a pic ligand. In all of the cases, the trans isomers show lower potential values for all of the redox couples relative to the cis isomers. Complexes cis-2 and trans-2 with six-member chelate rings show higher catalytic activity than cis-3 and trans-3. Overall, it was shown that the electronic perturbation to the metal center exerted by different orientation and geometry of the ligands significantly influences both redox properties and catalytic performance.

Ground-State Proton-Transfer (GSPT)-Assisted Enhanced Two-Photon Uncaging from a Binol-based AIE-Fluorogenic Phototrigger.

We demonstrated for the first time without any chemical modification the two-photon absorption (TPA) cross-section can be enhanced and red-shifted to the near-infrared (NIR) region by the ground-state proton-transfer (GSPT) process. Using GSPT, we developed a simple binol-based aggregation-induced emission (AIE)-fluorogenic phototrigger having a large two-photon uncaging cross-section in the "phototherapeutic window". As a proof of concept, we showed our phototrigger for the release of two different anticancer drugs in the NIR region.

Near-IR light-induced photorelease of nitric oxide (NO) on ruthenium nitrosyl complexes: formation, reactivity, and biological effects.

Polypyridyl backbone nitrosyl complexes of ruthenium with the molecular framework [RuII(antpy)(bpy)NO+/˙]n+ [4](PF6)3 (n = 3), [4](PF6)2 (n = 2), where antpy = 4'-(anthracene-9-yl)-2,2':6',2''-terpyridine and bpy = 2,2'-bipyridine, were synthesized via a stepwise synthetic route from the chloro precursor [RuII(antpy)(bpy)(Cl)](PF6) [1](PF6) and [RuII(antpy)(bpy)(CH3CN)](PF6)2 [2](PF6)2 and [RuII(antpy)(bpy)(NO2)](PF6) [3](PF6). After column chromatographic purification, all the synthesized complexes were fully characterized using different spectroscopic and analytical techniques including mass spectroscopy, 1H NMR, FT-IR and UV-vis spectrophotometry. The Ru-NO stretching frequency of [4](PF6)3 was observed at 1941 cm-1, which suggests moderately strong Ru-NO bonding. A massive shift in the νNO frequency occurred at Δν = 329 cm-1 (solid) upon reducing [4](PF6)3 to [4](PF6)2. To understand the molecular integrity of the complexes, the structure of [3](PF6) was successfully determined by X-ray crystallography. The redox properties of [4](PF6)3 were thoroughly investigated together with the other precursor complexes. The rate constants for the first-order photo-release of NO from [4](PF6)3 and [4](PF6)2 were determined to be 8.01 × 10-3 min-1 (t1/2 ∼ 86 min) and 3.27 × 10-2 min-1 (t1/2 ∼ 21 min), respectively, when exposed to a 200 W Xenon light. Additionally, the photo-cleavage of Ru-NO occurred within ∼2 h when [4](PF6)3 was irradiated with an IR light source (>700 nm) at room temperature. The first-order rate constant of 9.4 × 10-3 min-1 (t1/2 ∼ 73 min) shows the efficacy of the system and its capability to release NO in the photo-therapeutic window. The released NO triggered by light was trapped by reduced myoglobin, a biologically relevant target protein. The one-electron reduction of [4](PF6)3 to [4](PF6)2 was systematically carried out chemically (hydrazine hydrate), electrochemically and biologically. In the biological reduction, it was found that the reduction is much slower with double-stranded DNA compared to a single-stranded oligonucleotide (CAAGGCCAACCGCGAGAAGATGAC). Moreover, [4](PF6)3 exhibited significant photo-toxicity to the VCaP prostate cancer cell line upon irradiation with a visible light source (IC50 ∼ 8.97 µM).

Nanotailored hyaluronic acid modified methylcellulose as an injectable scaffold with enhanced physico-rheological and biological aspects.

The collaborative endeavor in tissue engineering is to fabricate a bio-mimetic extracellular matrix to assist tissue regeneration. Thus, a novel injectable tissue scaffold was fabricated by exploring nanotailored hyaluronic acid (nHA) and methylcellulose (MC) (nHAMC) along with pristine HA based MC scaffold (HAMC). nHA with particle size ∼22 ±â€¯5.3 nm were obtained and nHAMC displayed a honeycomb-like 3D microporous architecture. Nano-HA bestowed better gel strength, physico-rheological and biological properties than HA. It creditably reduced the high content of salt to reduce the gelation temperature of MC. The properties ameliorated with increased in-corporation of nano-HA. The addition of salt showed more prominent effect on gelation temperature of nHAMC than in HAMC; and salting-out effect was dependent on nHA/HA content. Biocompatible nHAMC assisted adequate cell adherence and proliferation with more extended protrusions with better migration rate than control. Thus, biomodulatory effect of nanotailored glycosaminoglycan could be asserted to design an efficient thermo-responsive scaffold.

Fractal self-assembly and aggregation of human amylin.

Human amylin is an intrinsically disordered protein believed to have a central role in Type-II diabetes mellitus (T2DM). The formation of intermediate oligomers is a seminal event in the eventual self-assembled fibril structures of amylin. However, the recent experimental investigations have shown the presence of different self-assembled (oligomers, protofilaments, and fibrils) and aggregated structures (amorphous aggregates) of amylin formed during its aggregation. Here, we show that amylin under diffusion-limited conditions leads to fractal self-assembly. The pH and solvent sensitive fractal self-assemblies of amylin were observed using an optical microscope. Confocal microscopy and scanning electron microscopy (SEM) with energy dispersion X-ray analysis (EDAX) were used to confirm the fractal self-assembly of amylin in water and PBS buffer, respectively. The fractal characteristics of the self-assemblies and the aggregates formed during the aggregation of amylin under different pH conditions were investigated using laser light scattering. The hydropathy and the docking study indicated the interactions between the anisotropically distributed hydrophobic residues and polar/ionic residues on the solvent-accessible surface of the protein as the crucial interaction hot-spots for driving the self-assembly and aggregation of human amylin. The simultaneous presence of various self-assemblies of human amylin was observed through different microscopy techniques. The present study may help in designing different fractal-like nanomaterials with potential applications in drug delivery, sensing, and tissue engineering.

Quinoline H2S donor decorated fluorescent carbon dots: visible light responsive H2S nanocarriers.

Recent studies have shown that the utility of nanocarriers for the transportation of gaseous signalling molecules to their target site in a biological environment is an effective approach. In this work, we have developed for the first time visible light responsive nanocarriers for the effective release of H2S. Our newly developed nanocarriers for H2S release are constructed using two main ingredients: fluorescent carbon dots and quinoline as an H2S donor. The developed nanocarriers provided interesting properties like good solubility under physiological conditions, excellent fluorescence properties and efficient release ability of H2S with good quantum yield upon visible light irradiation. In vitro studies revealed that our designed nanocarriers exhibited abilities like efficient cellular internalization and good biocompatibility.

A water soluble light activated hydrogen sulfide donor induced by an excited state meta effect.

We have utilized an m-amino benzyl based photoremovable protecting group (PRPG) to develop a new water soluble H2S donor. It efficiently releases H2S on demand in a spatio-temporally controlled fashion by an excited state "meta effect" with good chemical and photochemical quantum yield in an aqueous environment. The efficient photorelease of H2S under physiological conditions was also demonstrated by in vitro studies.

Restricted rotation of an Fe(CO)2(PL3)-subunit in [FeFe]-hydrogenase active site mimics by intramolecular ligation.

A new series of homodinuclear iron complexes as models of the [FeFe]-hydrogenase active site was prepared and characterized. The complexes of the general formula [Fe2(mcbdt)(CO)5PPh2R] (mcbdt = benzene-1,2-dithiol-3-carboxylic acid) feature covalent tethers that link the mcbdt ligand with the phosphine ligands which are terminally coordinated to one of the Fe centres. The synthetic feasability of the concept is demonstrated with the preparation of three novel complexes. A detailed theoretical investigation showes that by introducing a rigid covalent link between the phosphine and the bridging dithiolate ligands, the rotation of the Fe(CO)2P unit is hindered and higher rotation barriers were calculated compared to non-linked reference complexes. The concept of restricting Fe(L)3 rotation is an approach to kinetically stabilize terminal hydrides which are reactive intermediates in catalytic proton reduction cycles of the enzymes.