Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 67
Filtrar
1.
Ecohealth ; 17(4): 461-468, 2020 12.
Artigo em Inglês | MEDLINE | ID: mdl-33993387

RESUMO

We recently investigated the presence of enteroviruses (EVs) in non-human primates (NHPs) in Northern Nigeria and documented the presence of EV-A76 of South-East Asian ancestry in an NHP. In this study, we go further to ask if we could also find EVs in NHPs indigenous to the forested South-south Nigeria. Fresh faecal samples were collected from the floor of 10 cages housing NHPs in Cross River Nigeria, re-suspended in PBS and subjected to RNA extraction, cDNA synthesis, PanEnt 5'-UTR and PanEnt VP1 PCR assays. None of the samples was positive for the PanEnt VP1 assay, but one sample was positive for PanEnt 5'-UTR PCR. This sample was subsequently inoculated into RD cell line, produced CPE and the isolate analysed by PCR assays, next-generation whole genome sequencing and passage in four different cell lines showing replication in two of them. Analysis of the complete genome of the isolate identified it as an Echovirus 11 (E11) and revealed a recombinant genomic structure. Phylogenetic analysis showed that the E11 NHP strain was related to human clinical isolates suggesting a zoonotic behaviour. We describe the first isolation and complete genome characterization of an E11 obtained from an NHP in Nigeria having zoonotic potential.


Assuntos
Enterovirus Humano B , Primatas , Animais , Fezes , Genômica , Nigéria , Filogenia
2.
J Med Virol ; 92(8): 1065-1074, 2020 08.
Artigo em Inglês | MEDLINE | ID: mdl-31883139

RESUMO

Polymerase chain reaction (PCR) detection has become the gold standard for diagnosis and typing of enterovirus (EV) and human parechovirus (HPeV) infections. Its effectiveness depends critically on using the appropriate sample types and high assay sensitivity as viral loads in cerebrospinal fluid samples from meningitis and sepsis clinical presentation can be extremely low. This study evaluated the sensitivity and specificity of currently used commercial and in-house diagnostic and typing assays. Accurately quantified RNA transcript controls were distributed to 27 diagnostic and 12 reference laboratories in 17 European countries for blinded testing. Transcripts represented the four human EV species (EV-A71, echovirus 30, coxsackie A virus 21, and EV-D68), HPeV3, and specificity controls. Reported results from 48 in-house and 15 commercial assays showed 98% detection frequencies of high copy (1000 RNA copies/5 µL) transcripts. In-house assays showed significantly greater detection frequencies of the low copy (10 copies/5 µL) EV and HPeV transcripts (81% and 86%, respectively) compared with commercial assays (56%, 50%; P = 7 × 10-5 ). EV-specific PCRs showed low cross-reactivity with human rhinovirus C (3 of 42 tests) and infrequent positivity in the negative control (2 of 63 tests). Most or all high copy EV and HPeV controls were successfully typed (88%, 100%) by reference laboratories, but showed reduced effectiveness for low copy controls (41%, 67%). Stabilized RNA transcripts provide an effective, logistically simple and inexpensive reagent for evaluation of diagnostic assay performance. The study provides reassurance of the performance of the many in-house assay formats used across Europe. However, it identified often substantially reduced sensitivities of commercial assays often used as point-of-care tests.


Assuntos
Infecções por Enterovirus/diagnóstico , Enterovirus/classificação , Parechovirus/classificação , Infecções por Picornaviridae/diagnóstico , RNA Viral/genética , Infecções por Enterovirus/virologia , Europa (Continente) , Dosagem de Genes , Humanos , Meningite Viral/diagnóstico , Tipagem Molecular , Infecções por Picornaviridae/virologia , Kit de Reagentes para Diagnóstico , Reação em Cadeia da Polimerase em Tempo Real , Reprodutibilidade dos Testes , Sensibilidade e Especificidade
3.
Microbiol Resour Announc ; 8(43)2019 Oct 24.
Artigo em Inglês | MEDLINE | ID: mdl-31649074

RESUMO

Here, we describe nearly complete genome sequences (7,361 nucleotides [nt] and 6,893 nt) of two echovirus 20 (E20) isolates from Nigeria that were simultaneously typed as CVB and E20 (dual serotype) by neutralization assay. Both include two overlapping open reading frames (ORFs) of 67 and 2,183 amino acids that encoded a recently described gut infection-facilitating protein and the classic enterovirus proteins, respectively.

4.
Indian J Med Microbiol ; 34(3): 328-34, 2016.
Artigo em Inglês | MEDLINE | ID: mdl-27514955

RESUMO

PURPOSE: Cervical cancer is the most common cancer among women in developing nations. Nearly 90% of the cases have been linked to the presence of high-risk human papillomavirus (hrHPV) types 16 and 18. The risk of cervical cancer may be high in female sex workers (FSWs) due to multiple sexual partners. This study aimed to determine the prevalence of cytological abnormalities and hrHPV types 16 and 18 in FSWs in Chandigarh, North India using the liquid-based cytology (LBC) approach. MATERIALS AND METHODS: The cervical brush samples were collected from 120 FSW and 98 age-matched healthy controls (HCs). These were subjected to pap smear using conventional method, LBC and the detection of hrHPV types 16 and 18 was carried out using polymerase chain reaction. RESULTS: The LBC samples showed better cytological details and also reduced the number of unsatisfactory smears from 11% in Pap to 1.5% in the LBC. A significantly higher number of inflammatory smears were reported in FSWs (51.7% vs. 34.7%, P = 0.01). The hrHPV types 16/18 were detected in 33/120 (27.5%) FSW versus 23/98 (23.5%) HCs. The risk of acquiring hrHPV was higher in FSWs, who had age at first sex ≤25 years, higher income and the habit of smoking. CONCLUSION: The high prevalence of hrHPV among FSWs and HCs suggests the need for the implementation of effective National Screening Programme for early detection of hrHPV types to decrease the burden of cervical cancer, especially in high-risk population.


Assuntos
Genótipo , Papillomaviridae/classificação , Papillomaviridae/isolamento & purificação , Infecções por Papillomavirus/complicações , Infecções por Papillomavirus/virologia , Profissionais do Sexo , Neoplasias do Colo do Útero/virologia , Adolescente , Adulto , Feminino , Humanos , Índia/epidemiologia , Pessoa de Meia-Idade , Papillomaviridae/genética , Infecções por Papillomavirus/epidemiologia , Reação em Cadeia da Polimerase , Prevalência , Neoplasias do Colo do Útero/epidemiologia , Esfregaço Vaginal , Adulto Jovem
5.
Cancer Gene Ther ; 22(11): 509-17, 2015 Nov.
Artigo em Inglês | MEDLINE | ID: mdl-26494554

RESUMO

Although varied drugs and therapies have been developed for lung cancer treatment, in the past 5 years overall survival rates have not improved much. It has also been reported that lung cancer is diagnosed in most of the patients when it is already in the advanced stages with heterogeneous tumors where single therapy is mostly ineffective. A combination of therapies are being administered and specific genes in specific tissues are targeted while protecting normal cell, but most of the therapies face drawbacks for the development of resistance against them and tumor progression. Therefore, therapeutic implications for various therapies need to be complemented by divergent strategies. This review frames utilization of CRISPR/Cas9 for molecular targeted gene therapy leading to long-term repression and activation or inhibition of molecular targets linked to lung cancer, avoiding the cycles of therapy.


Assuntos
Sistemas CRISPR-Cas , Terapia Genética , Neoplasias Pulmonares/genética , Neoplasias Pulmonares/terapia , Animais , Proteínas Associadas a CRISPR/genética , Proteínas Associadas a CRISPR/metabolismo , Sistemas CRISPR-Cas/genética , Repetições Palindrômicas Curtas Agrupadas e Regularmente Espaçadas/genética , Epigenômica/métodos , Marcação de Genes/métodos , Engenharia Genética/métodos , Terapia Genética/métodos , Genoma , Genômica/métodos , Humanos , Edição de RNA
6.
Oncogene ; 34(24): 3152-63, 2015 Jun 11.
Artigo em Inglês | MEDLINE | ID: mdl-25132260

RESUMO

The matricellular protein CCN5/WISP-2 represents a promising target in triple-negative breast cancer (TNBC) because treatment or induced activation of CCN5 in TNBC cells promotes cell growth arrest at the G0/G1 phase, reduces cell proliferation and delays tumor growth in the xenograft model. Our studies found that the p27(Kip1) tumor suppressor protein is upregulated and relocalized to the nucleus from cytoplasm by CCN5 in these cells and that these two events (upregulation and relocalization of p27(Kip1)) are critical for CCN5-induced growth inhibition of TNBC cells. In the absence of CCN5, p27(Kip1) resides mostly in the cytoplasm, which is associated with the aggressive nature of cancer cells. Mechanistically, CCN5 inhibits Skp2 expression, which seems to stabilize the p27(Kip1) protein in these cells. On the other hand, CCN5 also recruits FOXO3a to mediate the transcriptional regulation of p27(Kip1). The recruitment of FOXO3a is achieved by the induction of its expression and activity through shifting from cytoplasm to the nucleus. Our data indicate that CCN5 blocks PI3K/AKT signaling to dephosphorylate at S318, S253 and Thr32 in FOXO3a for nuclear relocalization and activation of FOXO3a. Moreover, inhibition of α6ß1 receptors diminishes CCN5 action on p27(Kip1) in TNBC cells. Collectively, these data suggest that CCN5 effectively inhibits TNBC growth through the accumulation and trafficking of p27(Kip1) via Skp2 and FOXO3a regulation, and thus, activation of CCN5 may have the therapeutic potential to kill TNBC.


Assuntos
Proteínas de Sinalização Intercelular CCN/fisiologia , Proliferação de Células/genética , Inibidor de Quinase Dependente de Ciclina p27 , Fatores de Transcrição Forkhead/fisiologia , Proteínas Repressoras/fisiologia , Proteínas Quinases Associadas a Fase S/fisiologia , Neoplasias de Mama Triplo Negativas/patologia , Animais , Pontos de Checagem do Ciclo Celular/efeitos dos fármacos , Pontos de Checagem do Ciclo Celular/genética , Proliferação de Células/efeitos dos fármacos , Inibidor de Quinase Dependente de Ciclina p27/antagonistas & inibidores , Inibidor de Quinase Dependente de Ciclina p27/genética , Inibidor de Quinase Dependente de Ciclina p27/metabolismo , Feminino , Proteína Forkhead Box O3 , Regulação Neoplásica da Expressão Gênica/efeitos dos fármacos , Humanos , Células MCF-7 , Camundongos , Camundongos Nus , Estabilidade Proteica , Transporte Proteico/efeitos dos fármacos , RNA Interferente Pequeno/genética , Transdução de Sinais/efeitos dos fármacos , Neoplasias de Mama Triplo Negativas/genética , Células Tumorais Cultivadas
7.
Eye (Lond) ; 29(3): 363-70, 2015 Mar.
Artigo em Inglês | MEDLINE | ID: mdl-25502867

RESUMO

PURPOSE: To determine the efficacy of safe surgery system trabeculectomy combined with manual small incision cataract surgery/phacoemulsification in primary glaucoma coexistent with cataract. METHODS: This is a retrospective analysis of 105 cases who underwent single-site combined surgery between January 2008 and December 2009. Safe surgery system trabeculectomy with diffuse and posterior application of mitomycin C was performed in all cases. Cataract extraction was done either by Manual Small Incision Cataract Surgery (MSICS) or phacoemulsification. Main outcome measures were success rate of trabeculectomy, as determined by four different IOP goals and incidence of postoperative complications. Analysis was performed using R-2.15, and the significance was tested at 5% level. RESULTS: The minimum follow-up period was 12 months. The overall success rates (with or without medication) when safe surgery system trabeculectomy was combined with MSICS were 91, 70, and 51% for IOP ≤18, ≤15, and ≤12 mm Hg, respectively, and target IOP was achieved in 72% cases. The mean IOP reduction was 43.8% with MSICS and 42.08% with phacoemulsification. The surgical outcome was not significantly different for both techniques. Postoperative complications were infrequent and comparable. CONCLUSION: The Safe Surgery System Trabeculectomy combined with cataract surgery offers excellent IOP control with minimal postoperative complications. It offers an effective and improved solution for primary glaucoma coexistent with cataract found in developing countries.


Assuntos
Extração de Catarata/métodos , Catarata/terapia , Glaucoma de Ângulo Fechado/cirurgia , Glaucoma de Ângulo Aberto/cirurgia , Trabeculectomia/métodos , Alquilantes/administração & dosagem , Catarata/complicações , Feminino , Glaucoma de Ângulo Fechado/complicações , Glaucoma de Ângulo Aberto/complicações , Humanos , Pressão Intraocular/fisiologia , Complicações Intraoperatórias , Masculino , Pessoa de Meia-Idade , Mitomicina/administração & dosagem , Facoemulsificação , Complicações Pós-Operatórias , Estudos Retrospectivos , Resultado do Tratamento , Acuidade Visual/fisiologia
8.
Indian J Med Microbiol ; 32(2): 164-8, 2014.
Artigo em Inglês | MEDLINE | ID: mdl-24713904

RESUMO

The conventional method of transfection of suspension cells by chemical has proven to be very difficult. We present a new transfection protocol, wherein, low-speed centrifugation of cell culture plates immediately after adding the lipid: DNA complex significantly enhances the transfection efficiency. Peripheral blood mononuclear cells (PBMCs) were transfected with BLOCK-iT™ Fluorescent Oligo (scrambled siRNA) and lipofectamine complex using conventional and low-speed centrifugation modified transfection protocols. The efficiency of transfection was determined using flowcytometer and cell viability was checked using MTT assay. Incorporation of low-speed centrifugation significantly enhances the transfection efficiency of BLOCK-iT™ in the suspension culture of PBMCs as compared to conventional transfection method (99.8% vs 28.3%; P < 0.0001), even at a low concentration of 40 picomoles without affecting the cell viability. Centrifugation enhanced transfection (CET) technique is simple, time-saving and novel application without compromising the cell viability in the context of recently popular RNA interference in suspension cultures of PBMCs. This undemanding modification might be applicable to a wide variety of cell lines and solve crucial problem of researchers working with RNA interference in suspension cultures.


Assuntos
Centrifugação/métodos , Leucócitos Mononucleares/metabolismo , Transfecção/métodos , Sobrevivência Celular/fisiologia , Humanos , Leucócitos Mononucleares/citologia , Interferência de RNA/fisiologia , RNA Interferente Pequeno/genética
9.
Indian J Med Microbiol ; 31(1): 64-8, 2013.
Artigo em Inglês | MEDLINE | ID: mdl-23508432

RESUMO

Hepatitis E virus (HEV) is an important cause of hepatitis in developing nations. Disease spans from asymptomatic infection to acute viral hepatitis (AVH) and acute liver failure (ALF). Cell-mediated immunity (CMI) is less studied. Studies document CMI in HEV patients using [3 H]-thymidine incorporation (radioactive in nature). The aim of this study was to evaluate the antigenicity of recombinant HEV ORF 2 peptide (452-617 a.a) (pORF2) by non-radioactive MTT assay and detecting the proliferation indices of primary PBMC culture. A total of 27 laboratory confirmed HEV patients (16 AVH and 11 ALF) and 20 apparently healthy individuals (HC) were included. PBMCs were isolated, plated and stimulated with pORF2. After an incubation of 4 days, cells were looked for blastogenic transformation and subjected to MTT assay. PI of AVH, ALF and healthy controls were found to be 3.249 ± 0.219, 1.748 ± 0.076 and 0.226 ± 0.017, respectively. PI of AVH Vs HC, ALF Vs HC and AVH Vs ALF were found to be significantly higher ( P < 0.0001). This study demonstrates MTT to be an adaptable technique to evaluate CMI in HEV patients. Recombinant pORF2 was found to be antigenic in nature and PBMCs from AVH patients were immunologically more reactive than ALF patients.


Assuntos
Antígenos Virais/imunologia , Proliferação de Células , Técnicas Citológicas/métodos , Vírus da Hepatite E/imunologia , Hepatite E/imunologia , Leucócitos Mononucleares/imunologia , Proteínas Virais/imunologia , Adulto , Feminino , Humanos , Masculino , Pessoa de Meia-Idade , Proteínas Recombinantes/imunologia , Coloração e Rotulagem/métodos , Sais de Tetrazólio/metabolismo , Tiazóis/metabolismo
10.
Indian J Med Microbiol ; 30(1): 103-6, 2012.
Artigo em Inglês | MEDLINE | ID: mdl-22361773

RESUMO

India is endemic for both Leptospira and hepatitis E virus (HEV). The clinical presentations of these diseases have overlapping features. We report a case of superinfection of HEV in a patient with resolving leptospirosis with underlying Hodgkin lymphoma. The diagnosis of HEV in our case was established by HEV-RNA PCR as our patient was immunosuppressed. The present study highlights the need for molecular diagnosis in the case of HEV infection with strong clinical suspicion and negative serological results.


Assuntos
Hepatite E/diagnóstico , Hepatite E/patologia , Icterícia/diagnóstico , Icterícia/etiologia , Leptospirose/complicações , Leptospirose/patologia , Superinfecção/diagnóstico , Adulto , Feminino , Vírus da Hepatite E/genética , Vírus da Hepatite E/isolamento & purificação , Doença de Hodgkin/complicações , Humanos , Índia , Reação em Cadeia da Polimerase , RNA Viral/genética , RNA Viral/isolamento & purificação
11.
J Environ Biol ; 33(5): 837-42, 2012 Sep.
Artigo em Inglês | MEDLINE | ID: mdl-23734447

RESUMO

Esterase isozymic variations were documented in the haemolymph of developed multivoltine and bivoltine silkworm breeds during unfavorable seed crop seasons of May - September using á- and â- napthylacetate separately to identify specific and nonspecific esterase having thermotolerant potentiality. Variations existed in the isozyme pattern with three bands (Est-2, 3 and 4) in pure Nistari race and other developed multivoltine and bivoltine breeds. Est-2 and Est-3 were non-specific esterases as they were observed when both á- and â-napthylacetate was used as substrates separately. Est-4 band was observed only with á-napthylacetate as substrate and was therefore confirmed to be specific á-esterase band in the haemolymph of silkworm, Bombyx mori L. Zymograms showed that the non-specific esterase band (Est-3) with R1 of 0.43 and specific á-esterase band (Est-4) with R(f) of 0.32 predominately withstood a temperature of 70 +/- 2 degrees C for a duration of 10 min and were confirmed as thermostable esterases in haemolymph of silkworm, Bombyx mori L. This also categorized the presence of thermostable esterases in developed multivoltine and bivoltine breeds of silkworm, even though the qualitative activity was more in the former than the latter. The qualitative presence of thermostable esterases and their activity could be adopted as an indicative biochemical marker in relation to thermotolerance in silkworm.


Assuntos
Bombyx/enzimologia , Carboxilesterase/química , Carboxilesterase/metabolismo , Animais , Bombyx/genética , Estabilidade Enzimática , Esterases/química , Esterases/metabolismo , Hemolinfa/enzimologia , Proteínas de Insetos/química , Proteínas de Insetos/metabolismo , Isoenzimas , Naftóis/metabolismo
12.
Phys Rev E Stat Nonlin Soft Matter Phys ; 83(3 Pt 1): 031701, 2011 Mar.
Artigo em Inglês | MEDLINE | ID: mdl-21517512

RESUMO

Using a combination of dynamic light scattering and Freedericksz transitions induced in applied magnetic and electric fields, we have determined the absolute magnitudes of the Frank elastic constants and effective orientational viscosities of the bent-core nematic liquid crystal, 4-chloro-1,3-phenylene bis 4-[4'-(9-decenyloxy)benzoyloxy] benzoate. At a fixed temperature 2 °C below the isotropic-nematic transition, we find K11 = 3.1 x 10⁻¹² N, K22 = 0.31 x 10⁻¹² N, K33 = 0.88 x 10⁻¹² N, η{splay}=1.1 Pa s, η{twist}=0.37 Pa s, and η{bend}=1.2 Pa s. The unusual anisotropies of these parameters are discussed in terms of short-range, smectic-C-like correlations among molecules in the nematic phase.

13.
Osteoarthritis Cartilage ; 17(7): 832-42, 2009 Jul.
Artigo em Inglês | MEDLINE | ID: mdl-19217805

RESUMO

OBJECTIVE: Compare the expression and regulation of nuclear receptors (NRs) in osteoarthritic and normal human articular cartilage. METHOD: The transcriptional levels of 48 NRs and additional related proteins were measured in mRNA from human articular cartilage from subjects with osteoarthritis (OA) and compared to samples from subjects without OA, using microarrays, individual quantitative reverse transcriptase polymerase chain reaction assays, and a custom human NR TaqMan Low Density Array (TLDA). The functional effect of liver X receptor (LXR) activity in cartilage was studied by measuring proteoglycan (PG) synthesis and degradation in articular cartilage explant cultures following treatment with the synthetic LXR agonist T0901317. RESULTS: Thirty-one of 48 NRs analyzed by TLDA were found to be measurably expressed in human articular cartilage; 23 of these 31 NRs showed significantly altered expression in OA vs unaffected cartilage. Among these, LXRalpha and LXRbeta, and their heterodimeric partners retinoid X receptor (RXR)alpha and RXRbeta were all expressed at significantly lower levels in OA cartilage, as were LXR target genes ABCG1 and apolipoproteins D and E. Addition of LXR agonist to human OA articular chondrocytes and to cartilage explant cultures resulted in activation of LXR-mediated transcription and significant reduction of both basal and interleukin (IL)-1-mediated PG degradation. CONCLUSIONS: Articular cartilage expresses a substantial number of NRs, and a large proportion of the expressed NRs are dysregulated in OA. In particular, LXR signaling in OA articular cartilage is impaired, and stimulation of LXR transcriptional activity can counteract the catabolic effects of IL-1. We conclude that LXR agonism may be a possible therapeutic option for OA.


Assuntos
Cartilagem Articular/metabolismo , Proteínas de Ligação a DNA/metabolismo , Osteoartrite/metabolismo , Receptores Citoplasmáticos e Nucleares/metabolismo , Adulto , Idoso , Citocinas/farmacologia , DNA Complementar/metabolismo , Proteínas de Ligação a DNA/agonistas , Humanos , Hidrocarbonetos Fluorados/farmacologia , Receptores X do Fígado , Pessoa de Meia-Idade , Receptores Nucleares Órfãos , Proteoglicanas/metabolismo , Receptores Citoplasmáticos e Nucleares/agonistas , Receptores X de Retinoides/metabolismo , Reação em Cadeia da Polimerase Via Transcriptase Reversa , Sulfonamidas/farmacologia , Transcrição Gênica/efeitos dos fármacos
14.
Phys Rev Lett ; 100(24): 242301, 2008 Jun 20.
Artigo em Inglês | MEDLINE | ID: mdl-18643578

RESUMO

Neutral pion transverse momentum spectra were measured in p+C and p+Pb collisions at sqrt[S{NN}]=17.4 GeV at midrapidity (2.3 less than or approximately equal eta{lab} less than or approximately equal 3.0) over the range 0.7 less than or approximately equal p{T} less than or approximately equal 3.5 GeV/c. The spectra are compared to pi{0} spectra measured in Pb+Pb collisions at sqrt[S{NN}]=17.3 GeV in the same experiment. For a wide range of Pb+Pb centralities (N{part} less than or approximately equal 300), the yield of pi{0}'s with p{T} greater than or approximately equal 2 GeV/c is larger than or consistent with the p+C or p+Pb yields scaled with the number of nucleon-nucleon collisions (N{coll}), while for central Pb+Pb collisions with N{part}greater than or approximately equal 350, the pi{0} yield is suppressed.

16.
J Postgrad Med ; 49(4): 322-4, 2003.
Artigo em Inglês | MEDLINE | ID: mdl-14699230

RESUMO

An 18-year-old woman from rural West Bengal was affected with mycetoma involving her neck, back, and chest. After an interval of eight years, her younger brother developed mycetoma on his left arm. No history of trauma or immune deficiency was present in either case. By microscopic examination of sinus-discharged materials from both the cases, identical rusty red, hard grains were demonstrated. Soluble red pigment-producing colonies grew in Sabouraud dextrose-agar medium. Isolates were positive for casein hydrolysis and negative for hydrolysis test of xanthine, hypoxanthine, tyrosine, and nitrate reduction. Thus it differed from the only known red grain mycetoma agent, Actinomadura pelletieri and was provisionally identified as Actinomadura vinacea. Familial affection in mycetoma, that too caused by a new agent, is reported here for its uniqueness.


Assuntos
Micetoma/genética , Micetoma/microbiologia , Adolescente , Adulto , Cor , Humanos , Masculino , Pigmentos Biológicos
17.
DNA Cell Biol ; 21(10): 727-35, 2002 Oct.
Artigo em Inglês | MEDLINE | ID: mdl-12443542

RESUMO

The gene encoding hyaluronan-binding protein 1 (HABP1) is expressed ubiquitously in different rat tissues, and is present in eukaryotic species from yeast to humans. Fluorescence in situ hybridization indicates that this is localized in human chromosome 17p13.3. Here, we report the presence of homologous sequences of HABP1 cDNA, termed processed HABP1 pseudogene in humans. This is concluded from an additional PCR product of ~0.5 kb, along with the expected band at approximately 5 kb as observed by PCR amplification of human genomic DNA with HABP1-specific primers. Partial sequencing of the 5-kb PCR product and comparison of the HABP1 cDNA with the sequence obtained from Genbank accession number AC004148 indicated that the HABP1 gene is comprised of six exons and five introns. The 0.5-kb additional PCR product was confirmed to be homologous to HABP1 cDNA by southern hybridization, sequencing, and by a sequence homology search. Search analysis with HABP1 cDNA sequence further revealed the presence of similar sequence in chromosomes 21 and 11, which could generate ~0.5 kb with the primers used. In this report, we describe the presence of several copies of the pseudogene of HABP1 spread over different chromosomes that vary in length and similarity to the HABP1 cDNA sequence. These are 1013 bp in chromosome 21 with 85.4% similarity, 1071 bp in chromosome 11 with 87.2% similarity, 818 bp in chromosome 15 with 82.3% similarity, and 323 bp in chromosome 4 with 84% similarity to HABP1 cDNA. We have also identified similar HABP1 pseudogenes in the rat and mouse genome. The human pseudogene sequence of HABP1 possesses a 10 base pair direct repeat of "AGAAAAATAA" in chromosome 21, a 12-bp direct repeat of "AG/CAAATTA/CAA/TTA" in chromosome 4, a 8-bp direct repeat of "ACAAAG/TCT" in chromosome 15. In the case of chromosome 11, there is an inverted repeat of "AGCCTGGGCGACAGAGCGAGA" ~50 bp upstream of the HABP1 pseudogene sequence. All of the HABP1 pseudogene sequences lack 5' promoter sequence and possess multiple mutations leading to the insertion of premature stop codons in all three reading frames. Rat and mouse homologs of the HABP1 pseudogene also contain multiple mutations, leading to the insertion of premature stop codons confirming the identity of a processed pseudogene.


Assuntos
Receptores de Hialuronatos/genética , Pseudogenes , Animais , Sequência de Bases , Proteínas de Transporte , Mapeamento Cromossômico , Cromossomos Humanos/genética , DNA Complementar/genética , Éxons , Genoma Humano , Células HeLa , Humanos , Íntrons , Camundongos , Proteínas Mitocondriais , Dados de Sequência Molecular , Filogenia , Ratos , Ratos Sprague-Dawley , Homologia de Sequência do Ácido Nucleico , Especificidade da Espécie
18.
Biochem Biophys Res Commun ; 291(4): 829-37, 2002 Mar 08.
Artigo em Inglês | MEDLINE | ID: mdl-11866440

RESUMO

The role of hyaluronan binding protein 1 (HABP1) in cell signaling was investigated and in vitro kinase assay demonstrated that it is a substrate for MAP kinase. Phosphorylation of endogenous HABP1 was also observed following treatment of J774 cells with PMA. HABP1 was coimmunoprecipitated with activated ERK, confirming their physical interaction in the cellular context. Upon PMA stimulation of normal rat fibroblast (F111) and transformed (HeLa) cells, the HABP1 level in the cytoplasm gradually decreased with a parallel increase in the nucleus. In HeLa cells, within 6 h of PMA treatment, HABP1 was completely translocated to the nucleus, which was prevented by PD98059, a selective inhibitor of ERK. We also observed that the nuclear translocation of HABP1 is concurrent with that of ERK, suggesting that ERK activation is a requirement for the translocation of HABP1. It is thus established for the first time that HABP1 is a substrate for ERK and an integral part of the MAP kinase cascade.


Assuntos
Núcleo Celular/metabolismo , Receptores de Hialuronatos/metabolismo , Proteínas Quinases Ativadas por Mitógeno/metabolismo , Transporte Ativo do Núcleo Celular/efeitos dos fármacos , Proteínas de Transporte , Linhagem Celular , Células HeLa , Humanos , Microscopia de Fluorescência , Proteínas Mitocondriais , Proteína Quinase 1 Ativada por Mitógeno/metabolismo , Proteína Quinase 3 Ativada por Mitógeno , Mitógenos/farmacologia , Fosforilação , Acetato de Tetradecanoilforbol/farmacologia
19.
Ann Agric Environ Med ; 8(2): 123-30, 2001.
Artigo em Inglês | MEDLINE | ID: mdl-11748868

RESUMO

The aim of the study was to assess the vertical profile of the major airborne pollen and spore concentration in the lower heights (up to six meters) and to check their allergenic potential causing respiratory allergy in agricultural workers. The study was conducted using rotorod samplers mounted at different heights at weekly intervals for two consecutive years (November 1997-October 1999). The major pollen grains and fungal spores (from mass culture) were collected in bulk and studied by skin-prick tests to detect allergenicity. Of the recorded pollen, 10 major and perennial types (e.g., Poaceae, Cheno-Amaranthaceae, Cyperaceae, Areca, etc.) were considered for comparative analyses. The tree pollen count showed more or less good correlation with increasing heights, whereas herb/shrub members are dominant at lower heights during all the three seasons (winter, summer and rains). The 10 major and perennial fungal spore types included Aspergilli group, Cladosporium, Nigrospora, etc. The smaller spores were dominant at greater heights and larger spores and conidia were more prevalent at lower levels. The total spore count was higher just after the rainy season during winter. In terms of allergenicity, Saccharum officinarum (sugar cane) of Poaceae, showed highest reactivity (70.58%) in skin test carried out in 189 adult agricultural field workers with respiratory disorders living inside the study area. Among fungal spores, Aspergillus japonicus was the strongest allergen, evoking 74.07% positive reactions. Drechslera oryzae, the pathogen causing brown spot of rice was also found to be a potent allergen.


Assuntos
Doenças dos Trabalhadores Agrícolas/etiologia , Alérgenos/análise , Hipersensibilidade/etiologia , Pólen/imunologia , Esporos Fúngicos/imunologia , Adolescente , Adulto , Idoso , Doenças dos Trabalhadores Agrícolas/imunologia , Microbiologia do Ar , Poluentes Atmosféricos , Alérgenos/imunologia , Feminino , Inquéritos Epidemiológicos , Humanos , Hipersensibilidade/diagnóstico , Índia , Masculino , Pessoa de Meia-Idade , Estações do Ano , Testes Cutâneos
20.
J Cell Physiol ; 189(3): 275-84, 2001 Dec.
Artigo em Inglês | MEDLINE | ID: mdl-11748585

RESUMO

Bone morphogenetic proteins play important roles in connective tissue morphogenesis. In this study, we used human multipotential mesenchymal cells as a target to analyze the effect of bone morphogenetic proteins on chondrogenesis. We also analyzed the effect of proinflammatory cytokine interleukin-1 on chondrogenic-differentiated cells and the interaction of IL-1beta with bone morphogenetic proteins. Cells placed in a 3-dimensional matrix of alginate beads and cultured in a serum-free media with bone morphogenetic protein-2 and -9 induced expression of type II collagen (Col2A1) mRNA and increased expression of aggrecan and cartilage oligomeric matrix protein suggesting chondrogenic differentiation of the cells. The transcription factor Sox-9 that regulates both Col2A1 and aggrecan gene expression showed increased expression with BMP treatment. Chondrogenic differentiated cells treated with interleukin-1 decreased Sox-9, Col2A1 and aggrecan gene expression. Removal of interleukin-1 and further addition of bone morphogenetic proteins resulted in returned expression of chondrogenic markers. Chondrogenic differentiated cells cultured in the presence of different concentrations of bone morphogenetic proteins and interleukin-1 showed that bone morphogenetic proteins were able to partially block the suppressive effect of interleukin-1. This study shows that bone morphogenetic proteins play an important role in chondrogenesis and may prove to be potential therapeutics in cartilage repair.


Assuntos
Proteínas Morfogenéticas Ósseas/farmacologia , Condrócitos/fisiologia , Condrogênese , Proteínas da Matriz Extracelular , Interleucina-1/farmacologia , Mesoderma/fisiologia , Fator de Crescimento Transformador beta , Agrecanas , Biomarcadores/análise , Proteína Morfogenética Óssea 2 , Diferenciação Celular , Células Cultivadas , Colágeno Tipo II/biossíntese , Colágeno Tipo II/genética , Antagonismo de Drogas , Fator 2 de Diferenciação de Crescimento , Fatores de Diferenciação de Crescimento , Proteínas de Grupo de Alta Mobilidade/biossíntese , Proteínas de Grupo de Alta Mobilidade/genética , Humanos , Cinética , Lectinas Tipo C , Proteoglicanas/biossíntese , Proteoglicanas/genética , RNA Mensageiro/biossíntese , Fatores de Transcrição SOX9 , Células-Tronco/efeitos dos fármacos , Células-Tronco/fisiologia , Fatores de Transcrição/biossíntese , Fatores de Transcrição/genética
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA