Virome release of an invasive exotic plant species in southern France.

The increase in human-mediated introduction of plant species to new regions has resulted in a rise of invasive exotic plant species (IEPS) that has had significant effects on biodiversity and ecosystem processes. One commonly accepted mechanism of invasions is that proposed by the enemy release hypothesis (ERH), which states that IEPS free from their native herbivores and natural enemies in new environments can outcompete indigenous species and become invasive. We here propose the virome release hypothesis (VRH) as a virus-centered variant of the conventional ERH that is only focused on enemies. The VRH predicts that vertically transmitted plant-associated viruses (PAV, encompassing phytoviruses and mycoviruses) should be co-introduced during the dissemination of the IEPS, while horizontally transmitted PAV of IEPS should be left behind or should not be locally transmitted in the introduced area due to a maladaptation of local vectors. To document the VRH, virome richness and composition as well as PAV prevalence, co-infection, host range, and transmission modes were compared between indigenous plant species and an invasive grass, cane bluestem (Bothriochloa barbinodis), in both its introduced range (southern France) and one area of its native range (Sonoran Desert, Arizona, USA). Contrary to the VRH, we show that invasive populations of B. barbinodis in France were not associated with a lower PAV prevalence or richness than native populations of B. barbinodis from the USA. However, comparison of virome compositions and network analyses further revealed more diverse and complex plant-virus interactions in the French ecosystem, with a significant richness of mycoviruses. Setting mycoviruses apart, only one putatively vertically transmitted phytovirus (belonging to the Amalgaviridae family) and one putatively horizontally transmitted phytovirus (belonging to the Geminiviridae family) were identified from B. barbinodis plants in the introduced area. Collectively, these characteristics of the B. barbinodis-associated PAV community in southern France suggest that a virome release phase may have immediately followed the introduction of B. barbinodis to France in the 1960s or 1970s, and that, since then, the invasive populations of this IEPS have already transitioned out of this virome release phase, and have started interacting with several local mycoviruses and a few local plant viruses.

Characterization of the RNA Mycovirome Associated with Grapevine Fungal Pathogens: Analysis of Mycovirus Distribution and Their Genetic Variability within a Collection of Botryosphaeriaceae Isolates.

Botryosphaeriaceae are fungi involved in the decay of various woody species, including the grapevine, leading to significant production losses. This fungal family is largely ubiquitous, and seven species of Botryosphaeriaceae have been identified in French vineyards, with variable levels of aggressiveness, both in vitro and in planta. Mycoviruses can impact the life traits of their fungal hosts, including aggressiveness, and are one of the factors influencing fungal pathogenicity. In this study, the RNA mycovirome of fifteen Botryosphaeriaceae isolates was characterized through the high-throughput sequencing of double-stranded RNA preparations from the respective samples. Eight mycoviruses were detected, including three potential novel species in the Narnaviridae family, as well as in the proposed Mycobunyaviridae and Fusagraviridae families. A large collection of Botryosphaeriaceae isolates was screened using RT-PCR assays specific for 20 Botryosphaeriaceae-infecting mycoviruses. Among the mycoviruses detected, some appeared to be specialists within a single host species, while others infected isolates belonging to multiple Botryosphaeriaceae species. This screening allowed us to conclude that one-third of the Botryosphaeriaceae isolates were infected by at least one mycovirus, and a significant proportion of isolates (43.5%) were found to be coinfected by several viruses, with very complex RNA mycoviromes for some N. parvum isolates.

Comparative performance evaluation of double-stranded RNA high-throughput sequencing for the detection of viral infection in temperate fruit crops.

There is limited information on the compared performance of currently used biological, serological and molecular assays with high-throughput sequencing (HTS) for viral indexing in temperate fruit crops. Here, using a range of samples of predetermined virological status, we compared two performance criteria (inclusivity and analytical sensitivity) of ELISA, molecular hybridization, RT-PCR and double-stranded RNA (dsRNA) HTS for the detection of a total of 14 viruses (10 genera) and four viroids (three genera). Using undiluted samples from individual plants, ELISA had the lowest performance, with an overall detection rate of 68.7%, followed by RT-PCR (82.5%) and HTS (90.7%, and 100% if considering only viruses). The lower performance of RT-PCR reflected the inability to amplify some isolates as a consequence of point mutations affecting primer-binding sites. In addition, HTS identified viruses that had not been identified by others assays in close to two-thirds of samples. Analysis of serial dilutions of fruit tree samples allowed to compare analytical sensitivity for various viruses. ELISA showed the lowest analytical sensitivity but RT-PCR showed higher analytical sensitivity than HTS for a majority of samples. Overall, these results confirm the superiority of HTS over biological indexing in terms of speed, and inclusivity and show that while absolute analytical sensitivity of RT-PCR tends to be higher than that of HTS, PCR inclusivity is affected by viral genetic diversity. Taken together these results make a strong case for the implementation of HTS-based approaches in fruit tree viral testing protocols supporting quarantine and certification programs.

Benchmarking of virome metagenomic analysis approaches using a large, 60+ members, viral synthetic community.

IMPORTANCE: We report here efforts to benchmark performance of two widespread approaches for virome analysis, which target either virion-associated nucleic acids (VANA) or highly purified double-stranded RNAs (dsRNAs). This was achieved using synthetic communities of varying complexity levels, up to a highly complex community of 72 viral agents (115 viral molecules) comprising isolates from 21 families and 61 genera of plant viruses. The results obtained confirm that the dsRNA-based approach provides a more complete representation of the RNA virome, in particular, for high complexity ones. However, for viromes of low to medium complexity, VANA appears a reasonable alternative and would be the preferred choice if analysis of DNA viruses is of importance. Several parameters impacting performance were identified as well as a direct relationship between the completeness of virome description and sample sequencing depth. The strategy, results, and tools used here should prove useful in a range of virome analysis efforts.

First report of Vitis cryptic virus (VCV) infecting mildew-resistant grapevine interspecific hybrids in France.

Vitis cryptic virus (VCV), a deltapartitivirus identified in Japan in Vitis coignetiae (Nabeshima and Abe, 2021), is known from only two other countries. It was detected in China (Fan et al., 2022) and in Russia, including in a V. labrusca and the Saperavi Severnyi interspecific hybrid (Shvets et al., 2022). There is no information on VCV pathogenicity but deltapartitiviruses are generally not pathogenic. Fan et al. (2022) reported VCV graft transmission and chlorotic mottling symptoms developing on a graft-inoculated vine, in spite of the fact that cryptic viruses are not known to move cell-to-cell or be graft-transmissible. In fall 2022, a few plants of the Prior interspecific hybrid (https://www.vivc.de) showed unusual red blotch and leaf curl in Bordeaux (France), prompting the HTS analysis of two plants using total leaf RNA. Following host genome substraction, the ribodepleted RNASeq data was assembled de novo using CLC Genomics Workbench (Candresse et al., 2018) and contigs annotated by BlastX against the GenBank database. Rupestris stem pitting virus, grapevine pinot gris virus, hop stunt viroid and grapevine yellow speckle viroid 1 were identified. In addition, mycoviral contigs were identified, together with contigs for Rhopalosiphum padi virus and a divergent isolate of barley aphid RNA virus 10 (the later only in one plant), and the two genomic RNAs of VCV. The VCV RNA1 contigs were 1570 and 1574 nucleotides (nt) long, respectively, and 100% identical, showing 97.1% nt identity to a Japanese isolate (LC746759). They integrated 6480 and 4613 reads (0.2 and 0.4% of total substracted reads) for a coverage of 611 and 433x, respectively. The VCV RNA2 contigs were also 100% identical and shared 95.5% identity with a Japanese isolate (LC746761). They were 1518-1519 nt long, integrated 11338 and 9999 reads (0.4 and 0.9% of reads) for a coverage of 1109 and 972x, respectively. The Prior VCV RNAs were deposited in GenBank (OR474475-76). Specific RNA2 primers 5' TTACAGGTTTGATTGGAATCATG 3' and 5' ATAGTAGGTCCAATCACTAATC 3' (Tm 56°C) were used to confirm VCV presence in the original plants as well as in three other asymptomatic Prior vines. Amplicons 100% identical to the contigs were obtained from 4 of 5 plants. Two plants of Bronner, one of Prior parents, also tested positive. The rootstock (Fercal) of a VCV-infected Prior and two plants of another hybrid, Artaban, (sampled in the same plot as Prior) tested negative. BlastN datamining identified VCV reads in RNASeq data from a range of wild grapevines including V. acerifolia (SRX2885763), V. quinquangularis (SRX1496837), V. romanetii (SRR3938616), V. cinerea (SRR10135144), V. davidii (SRR3255926), V. amurensis (SRX13387918) and V. vinifera subsp. sylvestris (HAOE01029819, HAOE01001237). Although not experimentally verified, detection in wild Vitis, including V. amurensis, a Saperavi Severnyi, Bronner and Prior progenitor, suggests VCV might have been introduced in these hybrids through crosses aiming to develop powdery and downy mildew resistant varieties. To the best of our knowledge, this is the first report of VCV infection in grapevine in France. The symptoms that prompted this research have not recurred in 2023 and are not linked to VCV because the virus was also identified in symptomless Prior plants. The risk of introducing VCV in European grapevine through breeding efforts appears limited, but VCV may be present in fungal disease-resistant cultivars in a range of countries.

Identification of divergent isolates of cherry latent virus 1 in Greek sweet cherry orchards.

In this study, samples collected from eight sweet cherry trees in northern Greece were analyzed by high-throughput sequencing for the presence of viruses. Bioinformatic analysis revealed the presence of divergent isolates of cherry latent virus 1 (CLV-1), a recently identified trichovirus in a sweet cherry accession imported into the USA from the Republic of Georgia. The complete genome sequences of seven CLV-1 isolates were determined, and phylogenetic analysis indicated that they belonged to a separate clade from the previously characterized Georgian isolate. A small-scale survey confirmed the presence of CLV-1 in 47 out of 151 sweet cherry samples tested, and partial sequencing of 15 isolates showed a high degree of nucleotide sequence similarity among them.

Carrot populations in France and Spain host a complex virome rich in previously uncharacterized viruses.

High-throughput sequencing (HTS) has proven a powerful tool to uncover the virome of cultivated and wild plants and offers the opportunity to study virus movements across the agroecological interface. The carrot model consisting of cultivated (Daucus carota ssp. sativus) and wild carrot (Daucus carota ssp. carota) populations, is particularly interesting with respect to comparisons of virus communities due to the low genetic barrier to virus flow since both population types belong to the same plant species. Using a highly purified double-stranded RNA-based HTS approach, we analyzed on a large scale the virome of 45 carrot populations including cultivated, wild and off-type carrots (carrots growing within the field and likely representing hybrids between cultivated and wild carrots) in France and six additional carrot populations from central Spain. Globally, we identified a very rich virome comprising 45 viruses of which 25 are novel or tentatively novel. Most of the identified novel viruses showed preferential associations with wild carrots, either occurring exclusively in wild populations or infecting only a small proportion of cultivated populations, indicating the role of wild carrots as reservoir of viral diversity. The carrot virome proved particularly rich in viruses involved in complex mutual interdependencies for aphid transmission such as poleroviruses, umbraviruses and associated satellites, which can be the basis for further investigations of synergistic or antagonistic virus-vector-host relationships.

Diversity and Pathobiology of an Ilarvirus Unexpectedly Detected in Diverse Plants and Global Sequencing Data.

High-throughput sequencing (HTS) and sequence mining tools revolutionized virus detection and discovery in recent years, and implementing them with classical plant virology techniques results in a powerful approach to characterize viruses. An example of a virus discovered through HTS is Solanum nigrum ilarvirus 1 (SnIV1) (Bromoviridae), which was recently reported in various solanaceous plants from France, Slovenia, Greece, and South Africa. It was likewise detected in grapevines (Vitaceae) and several Fabaceae and Rosaceae plant species. Such a diverse set of source organisms is atypical for ilarviruses, thus warranting further investigation. In this study, modern and classical virological tools were combined to accelerate the characterization of SnIV1. Through HTS-based virome surveys, mining of sequence read archive datasets, and a literature search, SnIV1 was further identified from diverse plant and non-plant sources globally. SnIV1 isolates showed relatively low variability compared with other phylogenetically related ilarviruses. Phylogenetic analyses showed a distinct basal clade of isolates from Europe, whereas the rest formed clades of mixed geographic origin. Furthermore, systemic infection of SnIV1 in Solanum villosum and its mechanical and graft transmissibility to solanaceous species were demonstrated. Near-identical SnIV1 genomes from the inoculum (S. villosum) and inoculated Nicotiana benthamiana were sequenced, thus partially fulfilling Koch's postulates. SnIV1 was shown to be seed-transmitted and potentially pollen-borne, has spherical virions, and possibly induces histopathological changes in infected N. benthamiana leaf tissues. Overall, this study provides information to better understand the diversity, global presence, and pathobiology of SnIV1; however, its possible emergence as a destructive pathogen remains uncertain. [Formula: see text] Copyright © 2023 The Author(s). This is an open access article distributed under the CC BY 4.0 International license.

Managing the deluge of newly discovered plant viruses and viroids: an optimized scientific and regulatory framework for their characterization and risk analysis.

The advances in high-throughput sequencing (HTS) technologies and bioinformatic tools have provided new opportunities for virus and viroid discovery and diagnostics. Hence, new sequences of viral origin are being discovered and published at a previously unseen rate. Therefore, a collective effort was undertaken to write and propose a framework for prioritizing the biological characterization steps needed after discovering a new plant virus to evaluate its impact at different levels. Even though the proposed approach was widely used, a revision of these guidelines was prepared to consider virus discovery and characterization trends and integrate novel approaches and tools recently published or under development. This updated framework is more adapted to the current rate of virus discovery and provides an improved prioritization for filling knowledge and data gaps. It consists of four distinct steps adapted to include a multi-stakeholder feedback loop. Key improvements include better prioritization and organization of the various steps, earlier data sharing among researchers and involved stakeholders, public database screening, and exploitation of genomic information to predict biological properties.

Molecular diversity of yam virus Y and identification of banana mild mosaic virus isolates infecting yam (Dioscorea spp.).

Two members of the family Betaflexiviridae associated with yam (Dioscorea spp.) have been described so far: yam latent virus (YLV) and yam virus Y (YVY). However, their geographical distribution and molecular diversity remain poorly documented. Using a nested RT-PCR assay, we detected YVY in D. alata, D. bulbifera, D. cayenensis, D. rotundata, and D. trifida in Guadeloupe, and in D. rotundata in Côte d'Ivoire, thus extending the known host range of this virus and geographical distribution. Using amplicon sequencing, we determined that the molecular diversity of YVY in the yam samples analyzed in this work ranged between 0.0 and 29.1% and that this diversity is partially geographically structured. We also identified three isolates of banana mild mosaic virus (BanMMV) infecting D. alata in Guadeloupe, providing the first evidence for BanMMV infection in yam.

Molecular and Biological Characterization of Novel and Known Family Secoviridae Members Infecting Lettuce.

High-throughput sequencing of two lettuces showing virus-like symptoms in France provided evidence of infection by members of the family Secoviridae. One plant (JG1) had a complex mixed infection that involved, among others, a novel waikavirus (lettuce waikavirus 1) and two isolates of a sequivirus related to lettuce mottle virus (LeMoV). The second lettuce plant (JG2) was singly infected by LeMoV. Complete genomic sequences were obtained for all four isolates and, in addition, near complete genome sequences were obtained for other LeMoV or LeMoV-related isolates (from French cultivated and wild lettuces and from a Brazilian cultivated lettuce) and for two isolates of another family Asteraceae-infecting sequivirus, dandelion yellow mosaic virus (DaYMV). Analysis of these genomic sequences allows the proposal of tentative genome organization for the various viruses and clarification of their phylogenetic relationships. Sequence and host range comparisons point to significant differences between the two sequivirus isolates identified in the JG1 plant and LeMoV isolates from France and Brazil, suggesting they belong to a novel species for which the name lettuce star mosaic virus is proposed.

The Expanding Menagerie of Prunus-Infecting Luteoviruses.

Members of the genus Luteovirus are responsible for economically destructive plant diseases worldwide. Over the past few years, three luteoviruses infecting Prunus trees have been characterized. However, the biological properties, prevalence, and genetic diversity of those viruses have not yet been studied. High-throughput sequencing of samples of various wild, cultivated, and ornamental Prunus species enabled the identification of four novel species in the genus Luteovirus for which we obtained complete or nearly complete genomes. Additionally, we identified another new putative species recovered from Sequence Read Archive data. Furthermore, we conducted a survey on peach-infecting luteoviruses in eight European countries. Analyses of 350 leaf samples collected from germplasm, production orchards, and private gardens showed that peach-associated luteovirus (PaLV), nectarine stem pitting-associated virus (NSPaV), and a novel luteovirus, peach-associated luteovirus 2 (PaLV2), are present in all countries; the most prevalent virus was NSPaV, followed by PaLV. The genetic diversity of these viruses was also analyzed. Moreover, the biological indexing on GF305 peach indicator plants demonstrated that PaLV and PaLV2, like NSPaV, are transmitted by graft at relatively low rates. No clear viral symptoms have been observed in either graft-inoculated GF305 indicators or different peach tree varieties observed in an orchard. The data generated during this study provide a broader overview of the genetic diversity, geographical distribution, and prevalence of peach-infecting luteoviruses and suggest that these viruses are likely asymptomatic in peach under most circumstances.

A new potyvirus from hedge mustard (Sisymbrium officinale (L.) Scop.) sheds light on the evolutionary history of turnip mosaic virus.

A novel potyvirus was identified in symptomatic hedge mustard (Sisymbrium officinale (L.) Scop.) and wild radish (Raphanus raphanistrum L.) in France. The nearly complete genome sequence of hedge mustard mosaic virus (HMMV) was determined, demonstrating that it belongs to a sister species to turnip mosaic virus (TuMV). HMMV readily infected several other members of the family Brassicaceae, including turnip, shepherd's purse (Capsella bursa-pastoris), and arabidopsis. The identification of HMMV as a Brassicaceae-infecting virus closely related to TuMV leads us to question the current scenario of TuMV evolution and suggests a possible alternative one in which transition from a monocot-adapted ancestral lifestyle to a Brassicaceae-adapted one could have occurred earlier than previously recognized.Please check and confirm that the authors and their respective affiliations have been correctly identified and amend if necessary.all OK.

The Molecular Characterization of a New Prunus-Infecting Cheravirus and Complete Genome Sequence of Stocky Prune Virus.

As part of a virome characterization of Prunus species, a novel cheravirus was discovered in two wild species, Prunus brigantina and P. mahaleb, and in an apricot (P. armeniaca) accession. The sequence of the two genomic RNAs was completed for two isolates. The Pro-Pol conserved region showed 86% amino acid (aa) identity with the corresponding region of trillium govanianum cheravirus (TgCV), a tentative Cheravirus member, whereas the combined coat proteins (CPs) shared only 40% aa identity with TgCV CPs, well below the species demarcation threshold for the genus. This suggests that the new virus should be considered a new species for which the name alpine wild prunus virus (AWPV) is proposed. In parallel, the complete genome sequence of stocky prune virus (StPV), a poorly known cheravirus for which only partial sequences were available, was determined. A phylogenetic analysis showed that AWPV, TgCV and StPV form a distinct cluster, away from other cheraviruses.

First report of ash shoestring-associated virus (ASaV) infecting European ash (Fraxinus excelsior L.) in France.

Ash shoestring-associated virus (ASaV) is a recently described Emaravirus with five genome segments identified in Germany and Switzerland from European ash (Fraxinus excelsior) or South European flowering ash (F. ornus) trees with chlorotic spots or mosaics and leaf curling or leaf shoestring symptoms [1]. In summer 2021 several European ash trees with severe leaf mosaic and deformation were observed 50 km south east of Bordeaux (France). Double stranded RNAs were purified from the leaves of one of the trees (2021-432) and analyzed by Illumina high throughput sequencing (HTS, 2x150 nt) as described [2]. Following quality trimming, reads were assembled de novo (CLC Genomics Workbench 21, Qiagen) and contigs annotated by BlastX analysis. Contigs homologous to ASaV genomic RNAs 2 to 5 were identified. For ASaV RNA2, four contigs were identified which could be manually assembled to yield a single scaffold while a single contig was obtained for RNAs 3, 4 and 5. The RNA2 scaffold assembled 1,206 reads for an average coverage of 58.2x, while the corresponding values for RNAs 3 to 5 were respectively 21,381 reads (1,529x), 18,146 reads (1,266x) and 1,234 reads (97.4x). While no contig was identified for ASaV RNA1 (or for other viruses), mapping of reads on an RNA1 reference (OU466880) allowed to identify 25 reads for this genomic segment (average coverage 0.4x). In total, ASaV reads represented 3.9% of the ca. 1 million reads obtained from the ash sample. The RNAs 2 to 5 scaffolds for isolate 2021-432 have been deposited in GenBank (OP501824-7). They show between 94.6% and 97.6% nucleotide identity with the corresponding RNAs of a reference isolate (OU466881-4). In order to validate the presence of ASaV in the original tree, PCR primers were designed based on RNAs 1 and 3 sequences. Primers ASaV1-F (5'-ATTATTCACAGTATGAAAGGG-3') and ASaV1-R (5'-GGTGTGGAGAATATCAAACC-3') amplify a 286 nt RNA1 fragment, while primers ASaV3-F (5'-GCTATACCCAGCTGAGGTGC-3') and ASaV3-R (5'-GTGTGCAATTCTATCAGCCTC-3') amplify a 322 nt RNA3 fragment. Amplicons of the expected size were obtained and directly sequenced. The RNA3 amplicon sequence was identical to the corresponding region of the HTS contig, while the RNA1 amplicon was 97.5% identical to the OU466880 reference sequence. The same primer pairs and a third one, ASaV4-F (5'- GAGGTTGCTTTGATGTCAGG -3') and ASaV4-R (5'- TGCCTCTCCGATGGTGATG -3'), amplifying a 411 nt RNA4 fragment, were used to test a European ash (2022-91) showing similar mosaic and shoestring symptoms collected in spring 2022 about 170 km south of Bordeaux. Again, amplifications were positive and the sequences of the amplicons showed 94.3 to 96.5% nt identity with the corresponding regions of the reference ASaV isolate and 93.9 to 94.3% identity with the French 2021-432 isolate. The PCR amplicon sequences for the two French isolates have been deposited in GenBank (OP501828-32). To our knowledge, these results represent the first report of a natural infection of ASaV in European ash in France. Identification of the virus in two ash populations about 150 km apart suggests the virus maybe widespread. The finding of ASaV in an ash tree with severe leaf symptoms and in which no other virus was identified by HTS supports its role as the causal agent of the symptoms observed. Ash trees in Europe are already threatened by the invasive ash dieback agent [3] and ASaV represents a further potential threat that deserves to be evaluated.

A new flavi-like virus identified in populations of wild carrots.

We report the discovery of a new flavi-like virus identified in wild carrots (Daucus carota subsp. carota), using a double-stranded (ds)RNA high-throughput sequencing (HTS) approach. The new virus, tentatively named "carrot flavi-like virus 1" (CtFLV-1), has a large genome of 21.8 kb that harbours a single open reading frame encoding a 7,078-aa polyprotein with conserved RNA helicase (Hel) and RNA-dependent RNA polymerase (RdRp) domains. The new virus is phylogenetically related to recently described flavi-like viruses from arthropods, but its closest relative is a plant-associated virus, gentian Kobu-sho-associated virus (GKSaV). A pairwise comparison showed that these two viruses share 38.4% amino acid (aa) sequence identity in their polyproteins and 73% and 47.8% aa sequence identity in their conserved RdRp and Hel domains, respectively. Based on their similar genome organization and phylogenetic relationship, GKSaV and CtFLV-1 could form the basis for a new genus of plant-associated viruses, possibly within the family Flaviviridae, for which the name "Koshovirus" is proposed.

First report of grapevine red globe virus (GRGV) and grapevine rupestris vein feathering virus (GRVFV) infecting grapevine (Vitis vinifera L.) in Portugal.

Grapevine Red globe virus (GRGV) and grapevine rupestris vein feathering virus (GRVFV) are relatively recently described grape viruses that respectively belong to the genera Maculavirus and Marafivirus in the family Tymoviridae [1]. Owing to their rather recent description, still limited information on their biology, on their molecular variability and on their geographic distribution is available. Both viruses are apparently completely or largely asymptomatic in European grapevine and have likely been overlooked in a wide range of situations (Martelli, 2014). According to sequences in GenBank, GRGV has been identified in Asia (Iran, Japan, China), the Americas (USA, Brazil) and Europe (Spain, France, Slovenia, Hungary, Czech Republic and Germany). GRVFV has been reported from the same countries but also in Oceania (New Zealand, Australia) and from a range of other countries including India, Pakistan and South Korea for Asia, Canada for North America and Switzerland, Slovakia, Italy and Russia for Europe. Evidence for the presence of GRGV and GRVFV in grapevine plants from northern Portugal (variety(ies) unknown) was obtained through the bioinformatic analysis [2] of RNASeq Illumina data obtained from phloem scrapings from five grapevine samples collected in different plots in 2016 [3]. Following grapevine genome substraction, contigs assembly and Blast-based contigs annotation using CLC Genomics Workbench, two plants, #4 and #5b, yielded contigs representing near complete GRGV genomes. The plant #4 contig integrated 474 reads (0.15% of reads for an average coverage of 10.1x) while the corresponding values for the contig for plant #5b are 2185 reads (2.4% of total reads) for a coverage of 47.2x. The two GRGV contigs show 91.4% nucleotide (nt) identity and the closest GRGV full genome sequence in GenBank, MZ451067 from Canada, shares respectively 98.9% and 91.6% nt identity with them. The near complete genome contigs have been deposited in GenBank (ON603917 and ON603918). Simultaneously, two near full length genomic contigs for GRVFV were identified from plant #5b and have also been deposited in GenBank (ON603919 and ON603920). These contigs show 84.4% nt identity to each other and were respectively assembled from 4643 (5.2% of total reads) and 5326 reads (6.0% of total reads) for respective average coverages of 102.3x and 117.3x. The closest full GRVFV genome in GenBank is MZ027155 from the USA, with 84.3-85.3% nt identity. Confirmation of the presence of GRVG and GRVFV in the doubly infected plant #5b was achieved by specific RT-PCR assays. A published assay [4] was used for GRGV and primers GRVFV-Cp-F 5'AAYCCTGTCACHCTCCACTG3' and GRVFV-Cp-R 5'TTCATGGTGGTGCCDGTGAG3' (Tm 55°C) were used for GRVFV. The obtained 447nt GRGV amplicon showed a single difference with the HTS contig while the 218 nt GRVFV amplicon showed 3 mutations as compared to one of the HTS contigs. The different grapevines had initially been sampled because they showed relatively poor and stunted growth but besides GRVFV and/or GRGV the HTS analysis indicated that they were also infected by hop stunt viroid, grapevine yellow speckle viroid 1, grapevine rupestris stem pitting virus, plus respectively a novel nepovirus (plant #4) and grapevine leafroll-associated virus 2 and grapevine Pinot gris virus (plant #5b) so that the results reported here do not shed novel light on the potential pathogenicity of GRGV or GRVFV. To the best of our knowledge, this is the first report of GRGV and GRVFV in Portugal.

Molecular characterization of Cordyline virus 1 isolates infecting yam (Dioscorea spp).

Cordyline virus 1 (CoV1) is a velarivirus that has so far only been reported in ornamental Ti plants (Cordyline fruticosa). Using high-throughput sequencing, we identified CoV1 infection in yam accessions from Vanuatu. Using a specific RT-PCR assay, we found that CoV1 is also present and highly prevalent in Dioscorea alata, D. cayenensis, and D. trifida in Guadeloupe. Phylogenetic analysis showed that CoV1 isolates infecting yam in Guadeloupe display a low level of molecular diversity. These data provide insights into the transmission of CoV1 in yam in Guadeloupe.

Identification of a novel vitivirus from pineapple in Reunion Island.

We report the complete genome sequence of a novel member of the genus Vitivirus (family Betaflexiviridae, subfamily Trivirinae) infecting pineapple. The complete genome sequence of this virus was obtained from total RNA extracted from pineapple leaf samples collected in Reunion Island, using a combination of high-throughput sequencing technologies. The viral genome is 6,757 nt long, excluding the poly(A) tail, and shares all the hallmarks of vitiviruses. Phylogenetic analysis performed on the replication-associated protein and capsid protein gene sequences unambiguously place this new virus, for which we propose the name "pineapple virus A", in the genus Vitivirus.

Virion-Associated Nucleic Acid-Based Metagenomics: A Decade of Advances in Molecular Characterization of Plant Viruses.

Over the last decade, viral metagenomic studies have resulted in the discovery of thousands of previously unknown viruses. These studies are likely to play a pivotal role in obtaining an accurate and robust understanding of how viruses affect the stability and productivity of ecosystems. Among the metagenomics-based approaches that have been developed since the beginning of the 21st century, shotgun metagenomics applied specifically to virion-associated nucleic acids (VANA) has been used to disentangle the diversity of the viral world. We summarize herein the results of 24 VANA-based studies, focusing on plant and insect samples conducted over the last decade (2010 to 2020). Collectively, viruses from 85 different families were reliably detected in these studies, including capsidless RNA viruses that replicate in fungi, oomycetes, and plants. Finally, strengths and weaknesses of the VANA approach are summarized and perspectives of applications in detection, epidemiological surveillance, environmental monitoring, and ecology of plant viruses are provided. [Formula: see text] Copyright © 2022 The Author(s). This is an open access article distributed under the CC BY-NC-ND 4.0 International license.