Essential gene profiles in breast, pancreatic, and ovarian cancer cells.

UNLABELLED: Genomic analyses are yielding a host of new information on the multiple genetic abnormalities associated with specific types of cancer. A comprehensive description of cancer-associated genetic abnormalities can improve our ability to classify tumors into clinically relevant subgroups and, on occasion, identify mutant genes that drive the cancer phenotype ("drivers"). More often, though, the functional significance of cancer-associated mutations is difficult to discern. Genome-wide pooled short hairpin RNA (shRNA) screens enable global identification of the genes essential for cancer cell survival and proliferation, providing a "functional genomic" map of human cancer to complement genomic studies. Using a lentiviral shRNA library targeting ~16,000 genes and a newly developed, dynamic scoring approach, we identified essential gene profiles in 72 breast, pancreatic, and ovarian cancer cell lines. Integrating our results with current and future genomic data should facilitate the systematic identification of drivers, unanticipated synthetic lethal relationships, and functional vulnerabilities of these tumor types. SIGNIFICANCE: This study presents a resource of genome-scale, pooled shRNA screens for 72 breast, pancreatic, and ovarian cancer cell lines that will serve as a functional complement to genomics data, facilitate construction of essential gene profiles, help uncover synthetic lethal relationships, and identify uncharacterized genetic vulnerabilities in these tumor types. SIGNIFICANCE: This study presents a resource of genome-scale, pooled shRNA screens for 72 breast, pancreatic, and ovarian cancer cell lines that will serve as a functional complement to genomics data, facilitate construction of essential gene profiles, help uncover synthetic lethal relationships, and identify uncharacterized genetic vulnerabilities in these tumor types.

Functional coordination of alternative splicing in the mammalian central nervous system.

BACKGROUND: Alternative splicing (AS) functions to expand proteomic complexity and plays numerous important roles in gene regulation. However, the extent to which AS coordinates functions in a cell and tissue type specific manner is not known. Moreover, the sequence code that underlies cell and tissue type specific regulation of AS is poorly understood. RESULTS: Using quantitative AS microarray profiling, we have identified a large number of widely expressed mouse genes that contain single or coordinated pairs of alternative exons that are spliced in a tissue regulated fashion. The majority of these AS events display differential regulation in central nervous system (CNS) tissues. Approximately half of the corresponding genes have neural specific functions and operate in common processes and interconnected pathways. Differential regulation of AS in the CNS tissues correlates strongly with a set of mostly new motifs that are predominantly located in the intron and constitutive exon sequences neighboring CNS-regulated alternative exons. Different subsets of these motifs are correlated with either increased inclusion or increased exclusion of alternative exons in CNS tissues, relative to the other profiled tissues. CONCLUSION: Our findings provide new evidence that specific cellular processes in the mammalian CNS are coordinated at the level of AS, and that a complex splicing code underlies CNS specific AS regulation. This code appears to comprise many new motifs, some of which are located in the constitutive exons neighboring regulated alternative exons. These data provide a basis for understanding the molecular mechanisms by which the tissue specific functions of widely expressed genes are coordinated at the level of AS.

Characterization of SERCA2b Ca2+-Mg2+ ATPase mRNA decay by nuclear proteins.

Gene expression is controlled at several levels including mRNA decay. Sarco/endoplasmic reticulum Ca2+-Mg2+-ATPase isoform 2b (SERCA2b) is central to Ca2+ signalling and homeostasis in several tissues. SERCA2b mRNA decay involves interactions between cis-acting elements in its 3'-region and trans-acting nuclear protein factors. In the presence of the protein factors, the synthetic capped and polyadenylated RNA fragment 2b1 (3444-3753) decays faster than other SERCA2b 3'-region fragments. Here we determined the minimum cis-acting destabilizing element in the decay and its interactions with the nuclear protein factors. The in vitro decay required ATP hydrolysis and Mg2+ but not Ca2+. The decay was directional from 3' to 5', and involved a novel 35b GC rich domain designated 2b1-4 corresponding to 3521-3555. The decay of 2b1 RNA was decreased by (a) competition with 2b1-4, (b) mutation of 2b1 to delete 2b1-4, and (c) depleting the extracts of destabilizing trans-acting factors using immobilized 2b1-4. To determine the minimal destabilizing elements 2b1-4 was divided into 7b domains A-E. Deleting AB, BC, CD or DE inactivated the destabilizing cis-acting element but deleting A, B, C, D or E had no effect. In electrophoresis mobility shift assays the nuclear protein extracts retarded the mobility of labeled uncapped 2b1 RNA without a poly A+ tail. A positive co-operativity in the interactions was shown in protein concentration dependence of the shift and in the competition of 2b1-4 in inhibiting the mobility of 2b1 RNA. Based on further experiments, the domain CDE (3535-3555) was sufficient to compete with 2b1 RNA for the protein binding. Consistent with this competition, excess CDE RNA retarded the in vitro decay of 2b1 RNA. Thus the RNA decay required ATP hydrolysis and Mg2+ but not Ca2+, the minimum binding domain was in the sequence 3535-3555, and the decay may involve a multimeric protein complex.

Control of protein expression through mRNA stability in calcium signalling.

Specific sequences (cis-acting elements) in the 3'-untranslated region (UTR) of RNA, together with stabilizing and destabilizing proteins (trans-acting factors), determine the mRNA stability, and consequently, the level of expression of several proteins. Such interactions were discovered initially for short-lived mRNAs encoding cytokines and early genes like c-jun and c-myc. However, they may also determine the fate of more stable mRNAs in a tissue and disease-dependent manner. The interactions between the cis-acting elements and the trans-acting factors may also be modulated by Ca(2+) either directly or via a control of the phosphorylation status of the trans-acting factors. We focus initially on the basic concepts in mRNA stability with the trans-acting factors AUF1 (destabilizing) and HuR (stabilizing). Sarco/endoplasmic reticulum Ca(2+) pumps, SERCA2a (cardiac and slow twitch muscles) and SERCA2b (most cells including smooth muscle cells), are pivotal in Ca(2+) mobilization during signal transduction. SERCA2a and SERCA2b proteins are encoded by relatively stable mRNAs that contain cis-acting stability determinants in their 3'-regions. We present several pathways where 3'-UTR mediated mRNA decay is key to Ca(2+) signalling: SERCA2a and beta-adrenergic receptors in heart failure, renin-angiotensin system, and parathyroid hormones. Other examples discussed include cytokines vascular endothelial growth factor, endothelin and endothelial nitric oxide synthase. Roles of Ca(2+) and Ca(2+)-binding proteins in mRNA stability are also discussed. We anticipate that these novel modes of control of protein expression will form an emerging area of research that may explore the central role of Ca(2+) in cell function during development and in disease.

Quantitative microarray profiling provides evidence against widespread coupling of alternative splicing with nonsense-mediated mRNA decay to control gene expression.

Sequence-based analyses have predicted that approximately 35% of mammalian alternative splicing (AS) events produce premature termination codon (PTC)-containing splice variants that are targeted by the process of nonsense-mediated mRNA decay (NMD). This led to speculation that AS may often regulate gene expression by activating NMD. Using AS microarrays, we show that PTC-containing splice variants are generally produced at uniformly low levels across diverse mammalian cells and tissues, independently of the action of NMD. Our results suggest that most PTC-introducing AS events are not under positive selection pressure and therefore may not contribute important functional roles.

Role of cis-acting elements in the control of SERCA2b Ca2+ pump mRNA decay by nuclear proteins.

Alternative splicing at position 3495 b yields SERCA2 (sarco/endoplasmic reticulum Ca2+ pump 2) RNA species, namely SERCA2a and SERCA2b which differ in 3'-end regions. This results in SERCA2b RNA being less stable. In vitro decay experiments show that, in the presence of protein extracts from nuclei of LVMs (left ventricular myocytes), the rate of decay of both SERCA2b RNA and synthetic RNA from its 3'-region is greater than that of the corresponding SERCA2a RNA. To search for cis-acting instability elements in the 3'-region of SERCA2b, we examined the effects of LVM nuclear protein extracts on the in vitro decay of six short overlapping capped [m7G(5')ppp(5')Gm] and polyadenylated (A40) RNA fragments from the 3'-end region (3444-4472) of SERCA2b. The proximal fragment 2B1 (3444-3753) was the most unstable. 2B1 RNA without a cap or a polyadenylated tail was analysed further in electrophoretic mobility-shift assays, and was observed to bind to protein(s) in the nuclear extracts. Based on competition for binding to nuclear proteins between radiolabelled 2B1 RNA and short unlabelled RNA fragments, the cis-acting element involved in this binding was the sequence 2B1-4. 2B1-4 is a 35-base (3521-3555, CCAGUCCUGCUCGUUGUGGGCGUGCACCGAGGGGG) GC-rich region just past the splice site (3495). Nuclear extracts decreased the electrophoretic mobility of the radiolabelled 2B1-4 RNA which bound to two proteins (19 and 21 kDa) in cross-linking experiments. Excess 2B1-4 RNA decreased the decay of the 2B1 RNA by the nuclear protein extract. 2B1-del 4 RNA (2B1 with the 2B1-4 domain deleted) also decayed more slowly than the control 2B1 RNA. Thus SERCA2b contains a novel GC-rich cis-acting element involved in its decay by nuclear proteins.

Control of SERCA2a Ca2+ pump mRNA stability by nuclear proteins: role of domains in the 3'-untranslated region.

Alternative splicing of the sarco/endoplasmic reticulum (SERCA2) Ca2+ pump transcript generates the two isoforms: SERCA2a in left ventricular myocytes (LVM) and SERCA2b in most tissues. Nuclear protein extracts from left ventricular myocytes can cause a decay of the 3'-region of the SERCA2a. To determine if all the domains in the 800 b SERCA2a 3'-end region (3344-4243) are equally stable, we examined in vitro decay of synthetically capped, polyadenylated overlapping RNA fragments 2A1-2A6 from the 3'-end region of SERCA2a. Whereas 2A1-2A5 RNAs were stable, the distal fragment 2A6 (4135-4243 b) decayed rapidly. Deleting the 2A6 sequence from the 800-b 3'-end region increased its stability. In mobility shift assays, 2A6 bound to protein(s) in the LVM nuclear extracts in a specific manner: unlabelled 2A6 or the 800 b 3'-region RNA competed for binding but poly A, poly U, and poly C RNA did not. Secondary structure analysis revealed three hairpin loops in 2A6. Experiments using small synthetic RNA fragments for competition with 2A6 binding to nuclear proteins were consistent with a model involving the three hairpin loops. Thus, the secondary structure of the distal domain of SERCA2a RNA may be important in regulating its stability.

Revealing global regulatory features of mammalian alternative splicing using a quantitative microarray platform.

We describe the application of a microarray platform, which combines information from exon body and splice-junction probes, to perform a quantitative analysis of tissue-specific alternative splicing (AS) for thousands of exons in mammalian cells. Through this system, we have analyzed global features of AS in major mouse tissues. The results provide numerous inferences for the functions of tissue-specific AS, insights into how the evolutionary history of exons can impact on their inclusion levels, and also information on how global regulatory properties of AS define tissue type. Like global transcription profiles, global AS profiles reflect tissue identity. Interestingly, we find that transcription and AS act independently on different sets of genes in order to define tissue-specific expression profiles. These results demonstrate the utility of our quantitative microarray platform and data for revealing important global regulatory features of AS.

Sarcoplasmic reticulum Ca2+ pump mRNA stability in cardiac and smooth muscle: role of poly A+ tail length.

Transcripts of the sarco/endoplasmic reticulum Ca2+ pump SERCA2 are alternatively spliced to produce SERCA2a (expressed in left ventricular muscle (LVM)) and SERCA2b (in stomach smooth muscle (SSM)) mRNA that use different polyadenylation sequences. SERCA2 mRNA in LVM is more stable than in SSM. Here, we report that the SERCA2 poly A+ tail length in LVM (32 +/- 2 bases) is longer than in SSM (20 +/- 1). In the in vitro decay assays, the 3'-region mRNA of SERCA2a or SERCA2b is more stable when the poly A+ tail is longer. However, when the poly A+ tail length is similar for SERCA2a and SERCA2b, the SERCA2a RNA is more stable. Thus, the longer poly A+ tail may contribute to, but does not appear to be the sole determinant of, greater stability of SERCA2 mRNA in LVM than in SSM.

Sarcoplasmic reticulum Ca(2+) pump mRNA stability in cardiac and smooth muscle: role of the 3'-untranslated region.

Stomach smooth muscle (SSM) and left ventricular muscle (LVM) express the sarco(endo)plasmic reticulum Ca(2+)-ATPase (SERCA) pump gene SERCA2. Alternative splicing yields two major isoforms, SERCA2a in LVM and slow twitch muscle and SERCA2b in SSM and most other tissues. The splices have different 3'-untranslated regions (UTR) and also encode proteins that differ slightly in their COOH-terminal domains. SERCA2 transcription rates are similar in the two tissues, yet LVM has a much higher level of SERCA2 mRNA than SSM. To understand the control of SERCA2 RNA expression, we inhibited transcription and showed that the half-life of SERCA2 mRNA is significantly longer (P < 0.05) in primary cultures of LVM cells than in SSM cells. Nuclear SERCA2 mRNA levels were also higher in LVM than in SSM. In vitro decay assays using synthetic RNA corresponding to the 3'-UTR of SERCA2a and -2b showed that nuclear extracts produced a faster decay of SERCA2 RNA than cytoplasmic extracts and that nuclear extracts produced a faster decay of SERCA2b than -2a. This was also true when the full-length native mRNA was used instead of the 3'-UTR RNA, and SERCA2b decay by cytoplasmic extracts was faster for LVM than for SSM. We propose that nuclear decay is an initial step in the control of SERCA2 RNA abundance and that this control is maintained or modulated in the cytoplasm. We discuss how these control mechanisms may be part of a control switch in cardiac development and pathophysiology.