Intestinal Microbes-based Analysis of Immune Mechanism of Childhood Asthma.

This work was developed to explore the relationship between intestinal microflora composition and immune function changes in children with asthma and to provide theoretical references for clinical diagnosis and treatment. Forty-eight children with asthma who received standardized treatment in the outpatient department of pediatric respiratory asthma in Children's Hospital were selected as the research objects, which were rolled into 24 cases of S0 group (complete control) and 24 cases of S1 group (incomplete control group). In addition, ten healthy children with general data matching the research objects were selected as a blank control (D0 group). The intestinal microbial composition and immune function indexes of each group were detected. The results showed that there were differences in the intestinal microbes of the three groups of children with Bifidobacterium, Megasphaera, Oscillibacter, Bilophila, and f_Ruminococcaceae. Among them, the proportions of Bifidobacterium, Megasphaera, and f_Ruminococcaceae in the intestinal microbes of the children in the S1 group were notably less than those in the S0 and D0 groups. The proportion of these three bacterial genera in the S0 group was also considerably smaller than that in the D0 group (P<0.05). In addition, the CD3+ levels of children in the S1 group were notably lower than those in the S0 and D0 groups, while the CD4+ and CD4+/CD3+ were higher than the S0 and D0 groups (P<0.05). The differences between CD3+, CD4+, and CD4+/CD3+ in the S0 and D0 groups were not considerable (P<0.05). The proportions of Bifidobacterium, Megasphaera, f_Ruminococcaceae, and Parasutterella in children with intestinal microbes were significantly positively correlated with CD3+ levels (P<0.05), and significantly negatively correlated with CD4+ and CD4+/CD3+ levels (P<0.05). In short, children with different levels of asthma control had a certain degree of flora disorder and decreased immune function in the intestinal flora. The decrease in the relative abundance of Bifidobacterium, f_Ruminococcaceae of Firmicutes, and Parasutterella of Riken Bacteria, and the increase in the relative abundance of Oscillatoria meant the decline of the immune function of the children.

[A case of Bainbridge-Ropers syndrome with autism in conjunct with ASXL3 gene variant and its clinical analysis].

OBJECTIVE: To retrospectively analyze the clinical phenotype and genetic characteristics of a child with severe mental retardation, language and motor development delays and autism. METHODS: High-throughput sequencing was carried out for the patient. Candidate variant was verified by Sanger sequencing and bioinformatics analysis. RESULTS: The child was found to harbor a heterozygous variant of exon 11:c.1421_1422insTGAATTTTCTGAGGAGGCTGAAAGT(p.Leu483*) of the ASXL3 gene. The same variant was found in neither of her parents, suggesting that it has a de novo origin. CONCLUSION: The exon 11:c.1421_1422ins TGAATTTTCTGAGGAGGCTGAAAGT(p.Leu483*) variant of the ASXL3 gene probably underlay the pathogenesis of Bainbridge-Ropers syndrome in this patient. Above finding has enriched the spectrum of ASXL3 gene variants.

Perinatal Risk Factors Influencing Neonatal Hypoxic Ischemic Encephalopathy in Southern China: A Case-Control Study.

OBJECTIVE: In this study, our objective was to explore the relevant influencing factors of neonatal hypoxic-ischemic encephalopathy (HIE) in Southern China and provide scientific basis for improving the quality of life for neonates. STUDY DESIGN: A retrospective analysis of 306 cases with HIE neonates who were admitted during April 2015 to October 2017 was conducted. A total of 306 non-HIE patients admitted to the same hospital during the same period were also included as controls. The basic clinical characteristics were analyzed, and the risk factors for HIE were assessed by logistic regression analysis. RESULTS: Univariate analysis showed that the differences in medicals during pregnancy, placenta previa, fetal distress during labor, cesarean section, amniotic fluid contamination, abnormal labor stage, and Apgar showed significantly different in the case group and the control group (p < 0.05). The multivariate logistic regression analysis revealed that the placenta previa, medicals during pregnancy, fetal distress, abnormal labor stage, Apgar's score, amniotic fluid contamination, and cesarean section were independent risk factors for HIE. CONCLUSION: The placenta previa, medicals during pregnancy, fetal distress, and abnormal labor stage can increase the risk of HIE. Early detection, early diagnosis, and treatment might make great achievement in improving the life quality of HIE neonates.

Gut microbiota in children with juvenile idiopathic arthritis: characteristics, biomarker identification, and usefulness in clinical prediction.

BACKGROUND: Recent studies have suggested that the gut microbiota is altered in children with juvenile idiopathic arthritis (JIA). However, age, sex, and body mass index (BMI) were not matched in the previous studies, and the results are inconsistent. We conducted an age-, sex-, and BMI-matched cross-sectional study to characterize the gut microbiota in children with JIA, and evaluate its potential in clinical prediction. METHODS: A total of 40 patients with JIA and 42 healthy controls, ranging from 1 to 16 years, were enrolled in this study. Fecal samples were collected for 16S rDNA sequencing. The data were analyzed using QIIME software and R packages. Specifically, the random forest model was used to identify biomarkers, and the receiver operating characteristic curve and the decision curve analysis were used to evaluate model performance. RESULTS: A total of 39 fecal samples from patients with JIA, and 42 fecal samples from healthy controls were sequenced successfully. The Chao 1 and Shannon-Wiener index in the JIA group were significantly lower than those in the control group, and the Bray-Curtis dissimilarity also differed significantly between the two groups. The relative abundance of 4 genera, Anaerostipes, Dialister, Lachnospira, and Roseburia, decreased significantly in the JIA group compared to those in the control group. The 4 genera included microbes that produce short-chain fatty acids (SCFAs) and were negatively correlated with some rheumatic indices. Moreover, 12 genera were identified as potential biomarkers by using the nested cross-validation function of the random forest. A random forest model constructed using these genera was able to differentiate the patients with JIA from the healthy controls, and the area under the receiver operating characteristic curve was 0.7975. The decision curve analysis indicated that the model had usefulness in clinical practice. CONCLUSIONS: The gut microbiota in patients with JIA is altered and characterized by a decreased abundance of 4 SCFA-producing genera. The decreases in the 4 genera correlated with more serious clinical indices. Twelve genera could be used as biomarkers and predictors in clinical practice. TRIAL REGISTRATION: The study is registered online at the Chinese Clinical Trial Registry on 11 May 2018 (registration number: ChiCTR1800016110).

Long non-coding RNA RHPN1-AS1 promotes tumorigenesis and metastasis of ovarian cancer by acting as a ceRNA against miR-596 and upregulating LETM1.

BACKGROUND: In recent decades, long non-coding RNAs (lncRNAs) have been reported as crucial functional regulators involved in ovarian cancer. In the present study, we explored how lncRNA RHPN1-AS1 influences the progression of epithelial ovarian cancer (EOC) through tumor cell-dependent mechanisms. RESULTS: The expression of RHPN1-AS1 in EOC tissues was higher than that in para-cancerous control tissues. High expression of RHPN1-AS1 was closely associated with poor prognosis in EOC patients. N6-methyladenosine (m6A) improved the stability of RHPN1-AS1 methylation transcript by reducing RNA degradation, which resulted in upregulation of RHPN1-AS1 in EOC. In vitro and in vivo functional experiments showed that RHPN1-AS1 promoted EOC cell proliferation and metastasis. RHPN1-AS1 acted as a ceRNA to sponge miR-596, consequently increasing LETM1 expression and activating the FAK/PI3K/Akt signaling pathway. CONCLUSION: RHPN1-AS1-miR-596-LETM1 axis plays a crucial role in EOC progression. Our findings may provide promising drug targets for EOC treatment. METHODS: We determined the aberrantly expressed lncRNAs in EOC via microarray analysis and validated RHPN1-AS1 expression by qRT-PCR. The RHPN1-AS1-miR-596-LETM1 axis was examined by dual-luciferase reporter assay and RIP assay. The mechanism of RHPN1-AS1 was investigated through gain- and loss-of-function studies both in vivo and in vitro.