Abnormal conduction-induced cardiomyopathy: a poorly explored entity.

A dyssynchronous biventricular activation, which can be determined by left bundle branch block, chronic right ventricular pacing, frequent premature ventricular complexes, or pre-excitation, can cause a global abnormal contractility, thus leading to systolic dysfunction and left ventricular remodelling in a unique nosological entities: abnormal conduction-induced cardiomyopathies. In this clinical scenario, the mainstay therapy is eliminating or improving LV dyssynchrony, removing the trigger. This usually ensures the improvement and even recovery of cardiac geometry and left ventricular function, especially in the absence of genetic background. A multidisciplinary approach, integrating advanced multimodal imaging, is essential for the systematic aetiological definition and the subsequent evaluation and aetiology-guided therapies of patients and their families. This review aims to describe mechanisms, prevalence, risk factors, and diagnostic and therapeutic approach to the various abnormal conduction-induced cardiomyopathies, starting from reasonable certainties and then analysing the grey areas requiring further studies.

Frailty according to the 2019 HFA-ESC definition in patients at risk for advanced heart failure: Insights from the HELP-HF registry.

AIMS: Frailty is highly prevalent in patients with heart failure (HF), but a concordant definition of this condition is lacking. The Heart Failure Association of the European Society of Cardiology (HFA-ESC) proposed in 2019 a new multi-domain definition of frailty, but it has never been validated. METHODS AND RESULTS: Patients from the HELP-HF registry were stratified according to the number of HFA-ESC frailty domains fulfilled and to the cumulative deficits frailty index (FI) quintiles. Prevalence of frailty and of each domain was reported, as well as the rate of the composite of all-cause death and HF hospitalization, its single components, and cardiovascular death in each group and quintile. Among 854 included patients, 37 (4.3%), 206 (24.1%), 365 (42.8%), 217 (25.4%), and 29 (3.4%) patients fulfilled zero, one, two, three, or four domains, respectively, while 179 patients had a FI < 0.21 and were considered not frail. The 1-year risk of adverse events increased proportionally to the number of domains fulfilled (for each criterion increase, all-cause death or HF hospitalization: hazard ratio [HR] 1.43, 95% confidence interval [CI] 1.27-1.62; all-cause death: HR 1.72, 95% CI 1.46-2.02, HF hospitalizations: subHR 1.21, 95% CI 1.04-1.31; cardiovascular death: HR 1.77, 95% CI 1.45-2.15). Consistent results were found stratifying the cohort for FI quintiles. The FI as a continuous variable demonstrated higher discriminative ability than the number of domains fulfilled (area under the curve = 0.68 vs. 0.64, p = 0.004). CONCLUSION: Frailty in patients at risk for advanced HF, assessed via a multi-domain approach and the FI, is highly prevalent and identifies those at increased risk of adverse events. The FI was found to be slightly more effective in identifying patients at increased risk of mortality.

Impact of malnutrition in patients with severe heart failure.

AIM: The role of malnutrition among patients with severe heart failure (HF) is not well established. We evaluated the incidence, predictors, and prognostic impact of malnutrition in patients with severe HF. METHODS AND RESULTS: Nutritional status was measured using the geriatric nutritional risk index (GNRI), based on body weight, height and serum albumin concentration, with malnutrition defined as GNRI ≤98. It was assessed in consecutive patients with severe HF, defined by at least one high-risk 'I NEED HELP' marker, enrolled at four Italian centres between January 2020 and November 2021. The primary endpoint was all-cause mortality. A total of 510 patients with data regarding nutritional status were included in the study (mean age 74 ± 12 years, 66.5% male). Among them, 179 (35.1%) had GNRI ≤98 (malnutrition). At multivariable logistic regression, lower body mass index (BMI) and higher levels of natriuretic peptides (B-type natriuretic peptide [BNP] > median value [685 pg/ml] or N-terminal proBNP > median value [5775 pg/ml]) were independently associated with a higher likelihood of malnutrition. Estimated rates of all-cause death at 1 year were 22.4% and 41.1% in patients without and with malnutrition, respectively (log-rank p < 0.001). The impact of malnutrition on all-cause mortality was confirmed after multivariable adjustment for relevant covariates (adjusted hazard ratio 2.03, 95% confidence interval 1.43-2.89, p < 0.001). CONCLUSION: In a contemporary, real-world, multicentre cohort of patients with severe HF, malnutrition (defined as GNRI ≤98) was common and independently associated with an increased risk of mortality. Lower BMI and higher natriuretic peptides were identified as predictors of malnutrition in these patients.

Characteristics and outcomes of patients with tricuspid regurgitation and advanced heart failure.

AIMS: To evaluate the role of tricuspid regurgitation in advanced heart failure. METHODS: The multicenter observational HELP-HF registry enrolled consecutive patients with heart failure and at least one 'I NEED HELP' criterion evaluated at four Italian centers between January 2020 and November 2021. Patients with no data on tricuspid regurgitation and/or receiving tricuspid valve intervention during follow-up were excluded. The population was stratified by no/mild tricuspid regurgitation vs. moderate tricuspid regurgitation vs. severe tricuspid regurgitation. Variables independently associated with tricuspid regurgitation, as well as the association between tricuspid regurgitation and clinical outcomes were investigated. The primary outcome was all-cause mortality. RESULTS: Among the 1085 patients included in this study, 508 (46.8%) had no/mild tricuspid regurgitation, 373 (34.4%) had moderate tricuspid regurgitation and 204 (18.8%) had severe tricuspid regurgitation. History of atrial fibrillation, any prior valve surgery, high dose of furosemide, preserved left ventricular ejection fraction, moderate/severe mitral regurgitation and pulmonary hypertension were found to be independently associated with an increased likelihood of severe tricuspid regurgitation. Estimated rates of 1-year all-cause death were of 21.4, 24.5 and 37.1% in no/mild tricuspid regurgitation, moderate tricuspid regurgitation and severe tricuspid regurgitation, respectively (log-rank P  < 0.001). As compared with nonsevere tricuspid regurgitation, severe tricuspid regurgitation was independently associated with a higher risk of all-cause mortality (adjusted hazard ratio 1.38, 95% confidence interval 1.01-1.88, P  = 0.042), whereas moderate tricuspid regurgitation did not. CONCLUSION: In a contemporary, real-world cohort of patients with advanced heart failure, several clinical and echocardiographic characteristics are associated with an increased likelihood of severe tricuspid regurgitation. Patients with severe tricuspid regurgitation have an increased risk of mortality.

Clinical burden and predictors of non-cardiovascular mortality and morbidity in advanced heart failure.

BACKGROUND: The changing demographic of heart failure (HF) increases the exposure to non-cardiovascular (non-CV) events. We investigated the distribution of non-CV mortality/morbidity and the characteristics associated with higher risk of non-CV events in patients with advanced HF. METHODS: Patients from the HELP-HF registry were stratified according to the number of 2018 HFA-ESC criteria for advanced HF. Endpoints were non-CV mortality and non-CV hospitalization. Competing risk analyses were performed assessing the association between HFA-ESC criteria and study outcomes and the additional predictors of non-CV endpoints. RESULTS: One thousand one hundred and forty-nine patients were included (median age 77 years-IQR 69-83). At 6, 12, 18 and 22 months, cumulative incidence of CV vs non-CV mortality was 13% vs 5%, 17% vs 8%, 20% vs 12%, 23% vs 12%, and of CV vs non-CV hospitalization was 26% vs 11%, 38% vs 17%, 45% vs 20%, 50% vs 21%. HFA-ESC criteria were associated with increasing adjusted risk of CV death, whereas no association was observed for CV hospitalization, non-CV death and non-CV hospitalization. Predictors of non-CV death were age, chronic obstructive pulmonary disease, dementia, preserved ejection fraction, >1 HF hospitalization and hemoglobin. CONCLUSIONS: Patients with advanced HF are exposed to high, even though not predominant, burden of non-CV outcomes. HFA-ESC criteria aid to stratify the risk of CV death, but are not associated with lower competing risk of non-CV outcomes. Alternative factors can be useful to define the patients with advanced HF at risk of non-CV events in order to better select patients for treatments specifically reducing CV risk.

Guideline-directed medical therapy in severe heart failure with reduced ejection fraction: An analysis from the HELP-HF registry.

AIM: Persistent symptoms despite guideline-directed medical therapy (GDMT) and poor tolerance of GDMT are hallmarks of patients with advanced heart failure (HF) with reduced ejection fraction (HFrEF). However, real-world data on GDMT use, dose, and prognostic implications are lacking. METHODS AND RESULTS: We included 699 consecutive patients with HFrEF and at least one 'I NEED HELP' marker for advanced HF enrolled in a multicentre registry. Beta-blockers (BB) were administered to 574 (82%) patients, angiotensin-converting enzyme inhibitors, angiotensin receptor blockers or angiotensin receptor-neprilysin inhibitors (ACEi/ARB/ARNI) were administered to 381 (55%) patients and 416 (60%) received mineralocorticoid receptor antagonists (MRA). Overall, ≥50% of target doses were reached in 41%, 22%, and 56% of the patients on BB, ACEi/ARB/ARNI and MRA, respectively. Hypotension, bradycardia, kidney dysfunction and hyperkalaemia were the main causes of underprescription and/or underdosing, but up to a half of the patients did not receive target doses for unknown causes (51%, 41%, and 55% for BB, ACEi/ARB/ARNI and MRA, respectively). The proportions of patients receiving BB and ACEi/ARB/ARNI were lower among those fulfilling the 2018 HFA-ESC criteria for advanced HF. Treatment with BB and ACEi/ARB/ARNI were associated with a lower risk of death or HF hospitalizations (adjusted hazard ratio [HR] 0.63, 95% confidence interval [CI] 0.48-0.84, and HR 0.74, 95% CI 0.58-0.95, respectively). CONCLUSIONS: In a large, real-world, contemporary cohort of patients with severe HFrEF, with at least one marker for advanced HF, prescription and uptitration of GDMT remained limited. A significant proportion of patients were undertreated due to unknown reasons suggesting a potential role of clinical inertia either by the prescribing healthcare professional or by the patient. Treatment with BB and ACEi/ARB/ARNI was associated with lower mortality/morbidity.

Role of ejection fraction in patients at risk for advanced heart failure: insights from the HELP-HF registry.

AIMS: Patients with heart failure (HF) with reduced ejection fraction (EF) (HFrEF), mildly reduced EF (HFmrEF), and preserved EF (HFpEF) may all progress to advanced HF, but the impact of EF in the advanced setting is not well established. Our aim was to assess the prognostic impact of EF in patients with at least one 'I NEED HELP' marker for advanced HF. METHODS AND RESULTS: Patients with HF and at least one high-risk 'I NEED HELP' criterion from four centres were included in this analysis. Outcomes were assessed in patients with HFrEF (EF ≤ 40%), HFmrEF (EF 41-49%), and HFpEF (EF ≥ 50%) and with EF analysed as a continuous variable. The prognostic impact of medical therapy for HF in patients with EF < 50% and EF > 50% was also evaluated. All-cause death was the primary endpoint, and cardiovascular death was a secondary endpoint. Among 1149 patients enrolled [mean age 75.1 ± 11.5 years, 67.3% males, 67.6% hospitalized, median follow-up 260 days (inter-quartile range 105-390 days)], HFrEF, HFmrEF, and HFpEF were observed in 699 (60.8%), 122 (10.6%), and 328 (28.6%) patients, and 1 year mortality was 28.3%, 26.2%, and 20.1, respectively (log-rank P = 0.036). As compared with HFrEF patients, HFpEF patients had a lower risk of all-cause death [adjusted hazard ratio (HRadj ) 0.67, 95% confidence interval (CI) 0.48-0.94, P = 0.022], whereas no difference was noted for HFmrEF patients. After multivariable adjustment, a lower risk of all-cause death (HRadj for 5% increase 0.94, 95% CI 0.89-0.99, P = 0.017) and cardiovascular death (HRadj for 5% increase 0.94, 95% CI 0.88-1.00, P = 0.049) was observed at higher EF values. Beta-blockers and renin-angiotensin system inhibitors or sacubitril/valsartan were associated with lower mortality in both EF < 50% and EF ≥ 50% groups. CONCLUSIONS: Among patients with HF and at least one 'I NEED HELP' marker for advanced HF, left ventricular EF is still of prognostic value.

Prognostic role of mitral regurgitation in patients with advanced heart failure.

AIM: The impact of mitral regurgitation (MR) in patients with advanced heart failure (HF) is poorly known. We aimed to evaluate the impact of MR on clinical outcomes of a real-world, contemporary, multicentre population with advanced HF. METHODS: The HELP-HF registry enrolled patients with HF and at least one "I NEED HELP" criterion, at four Italian centres between January 2020 and November 2021. The population was stratified by none/mild MR vs. moderate MR vs. severe MR. Outcomes of interest were all-cause, cardiovascular (CV) death, the composite of all-cause death or first HF hospitalization, first HF hospitalization and recurrent HF hospitalizations. RESULTS: Among 1079 patients, 429 (39.8%) had none/mild MR, 443 (41.1%) had moderate MR and 207 (19.2%) had severe MR. Patients with severe MR were most likely to be inpatients, present with cardiogenic shock, need intravenous loop diuretics and inotropes/vasopressors, have lower ejection fraction and higher natriuretic peptides. Estimated rates of all-cause death, CV death, and the composite of all-cause death or first HF hospitalization at 1 year increased with increasing MR severity. Compared with no/mild MR, severe MR was independently associated with an increased risk of CV death (adjusted HR 1.61, 95% CI 1.04-2.51, p = 0.033) and recurrent HF hospitalizations (adjusted HR 1.49, 95% CI 1.08-2.06, p = 0.015), but not with and increased risk of all-cause death, first HF hospitalization and composite outcome. CONCLUSIONS: In unselected patients with advanced HF, severe MR was common and independently associated with an increased risk of CV death and of recurrent HF hospitalizations.

Clinical and prognostic implications of heart failure hospitalization in patients with advanced heart failure.

BACKGROUND: Hospitalization is associated with poor outcomes in patients with heart failure, but its prognostic role in advanced heart failure is still unsettled. We evaluated the prognostic role of heart failure hospitalization in patients with advanced heart failure. METHODS: The multicenter HELP-HF registry enrolled consecutive patients with heart failure and at least one high-risk 'I NEED HELP' marker. Characteristics and outcomes were compared between patients who were hospitalized for decompensated heart failure (inpatients) or not (outpatients) at the time of enrolment. The primary endpoint was the composite of all-cause mortality or first heart failure hospitalization. RESULTS: Among the 1149 patients included [mean age 75.1 ±â€Š11.5 years, 67.3% men, median left ventricular ejection fraction (LVEF) 35% (IQR 25-50%)], 777 (67.6%) were inpatients at the time of enrolment. As compared with outpatients, inpatients had lower LVEF, higher natriuretic peptides and a worse clinical profile. The 1-year rate of the primary endpoint was 50.9% in inpatients versus 36.8% in outpatients [crude hazard ratio 1.70, 95% confidence interval (CI) 1.39-2.07, P < 0.001]. At multivariable analysis, inpatient status was independently associated with a higher risk of the primary endpoint (adjusted hazard ratio 1.54, 95% CI 1.23-1.93, P < 0.001). Among inpatients, the independent predictors of the primary endpoint were older age, lower SBP, heart failure association criteria for advanced heart failure and glomerular filtration rate 30 ml/min/1.73 m2 or less. CONCLUSION: Hospitalization for heart failure in patients with at least one high-risk 'I NEED HELP' marker is associated with an extremely poor prognosis supporting the need for specific interventions, such as mechanical circulatory support or heart transplantation.

Detailed Assessment of the "I Need Help" Criteria in Patients With Heart Failure: Insights From the HELP-HF Registry.

BACKGROUND: The "I Need Help" markers have been proposed to identify patients with advanced heart failure (HF). We evaluated the prognostic impact of these markers on clinical outcomes in a real-world, contemporary, multicenter HF population. METHODS: We included consecutive patients with HF and at least 1 high-risk "I Need Help" marker from 4 centers. The impact of the cumulative number of "I Need Help" criteria and that of each individual "I Need Help" criterion was evaluated. The primary end point was the composite of all-cause mortality or first HF hospitalization. RESULTS: Among 1149 patients enrolled, the majority had 2 (30.9%) or 3 (22.6%) "I Need Help" criteria. A higher cumulative number of "I Need Help" criteria was independently associated with a higher risk of the primary end point (adjusted hazard ratio for each criterion increase, 1.19 [95% CI, 1.11-1.27]; P<0.001), and patients with >5 criteria had the worst prognosis. Need of inotropes, persistently high New York Heart Association classes III and IV or natriuretic peptides, end-organ dysfunction, >1 HF hospitalization in the last year, persisting fluid overload or escalating diuretics, and low blood pressure were the individual criteria independently associated with a higher risk of the primary end point. CONCLUSIONS: In our HF population, a higher number of "I Need Help" criteria was associated with a worse prognosis. The individual criteria with an independent impact on mortality or HF hospitalization were need of inotropes, New York Heart Association class or natriuretic peptides, end-organ dysfunction, multiple HF hospitalizations, persisting edema or escalating diuretics, and low blood pressure.

The Diagnostic Value of the 12-Lead ECG in Arrhythmogenic Left Ventricular Cardiomyopathy: Novel ECG Signs.

BACKGROUND: Electrocardiographic (ECG) findings in arrhythmogenic left ventricular cardiomyopathy (ALVC) are limited to small case series. OBJECTIVES: This study aimed to analyze the ECG characteristics of ALVC patients and to correlate ECG with cardiac magnetic resonance and genotype data. METHODS: We reviewed data of 54 consecutive ALVC patients (32 men, age 39 ± 15 years) and compared them with 84 healthy controls with normal cardiac magnetic resonance. RESULTS: T-wave inversion was often noted (57.4%), particularly in the inferior and lateral leads. Low QRS voltages in limb leads were observed in 22.2% of patients. The following novel ECG findings were identified: left posterior fascicular block (LPFB) (20.4%), pathological Q waves (33.3%), and a prominent R-wave in V1 with a R/S ratio ≥0.5 (24.1%). The QRS voltages were lower in ALVC compared with controls, particularly in lead I and II. At receiver-operating characteristic analysis, the sum of the R-wave in I to II ≤8 mm (AUC: 0.909; P < 0.0001) and S-wave in V1 plus R-wave in V6 ≤12 mm (AUC: 0.784; P < 0.0001) effectively discriminated ALVC patients from controls. It is noteworthy that 4 of the 8 patients with an apparently normal ECG were recognized by these new signs. Transmural late gadolinium enhancement was associated to LPFB, a R/S ratio ≥0.5 in V1, and inferolateral T-wave inversion, and a ringlike pattern correlated to fragmented QRS, SV1+RV6 ≤12 mm, low QRS voltage, and desmoplakin alterations. CONCLUSIONS: Pathological Q waves, LPFB, and a prominent R-wave in V1 were common ECG signs in ALVC. An R-wave sum in I to II ≤8 mm and SV1+RV6 ≤12 mm were specific findings for ALVC phenotypes compared with controls.

The Role of Advanced Cardiovascular Imaging Modalities in Cardio-Oncology: From Early Detection to Unravelling Mechanisms of Cardiotoxicity.

Advances in cancer therapies have led to a global improvement in patient survival rates. Nevertheless, the price to pay is a concomitant increase in cardiovascular (CV) morbidity and mortality in this population. Increased inflammation and disturbances of the immune system are shared by both cancer and CV diseases. Immunological effects of anti-cancer treatments occur with both conventional chemotherapy and, to a greater extent, with novel biological therapies such as immunotherapy. For these reasons, there is growing interest in the immune system and its potential role at the molecular level in determining cardiotoxicity. Early recognition of these detrimental effects could help in identifying patients at risk and improve their oncological management. Non-invasive imaging already plays a key role in evaluating baseline CV risk and in detecting even subclinical cardiac dysfunction during surveillance. The aim of this review is to highlight the role of advanced cardiovascular imaging techniques in the detection and management of cardiovascular complications related to cancer treatment.

Ischemic Etiology in Advanced Heart Failure: Insight from the HELP-HF Registry.

In patients with advanced heart failure (HF), defined according to the presence of at least one I-NEED-HELP criterium, the updated 2018 Heart Failure Association of the European Society of Cardiology (HFA-ESC) criteria for advanced HF identify a subgroup of patients with HF with worse prognosis, but whether ischemic etiology has a relevant prognostic impact in this very high-risk cohort is unknown. Patients from the HELP-HF registry were stratified according to ischemic etiology and presence of advanced HF based on 2018 HFA-ESC criteria. The primary end point was a composite of all-cause death and HF hospitalization at 1 year. Secondary end points were all-cause death, HF hospitalization, and cardiovascular death at 1 year. Ischemic etiology was a leading cause of HF, in both patients with advanced and nonadvanced HF (46.1% and 42.4%, respectively, p = 0.337). The risk of the primary end point (hazard ratio [HR] 1.31, 95% confidence interval [CI] 1.09 to 1.58) and all-cause mortality (HR 1.37, 95% CI 1.06 to 1.76) was increased in ischemic as compared with nonischemic patients. The risk of the primary end point was consistently higher in ischemic patients in both patients with advanced and nonadvanced HF (advanced HF, HR 1.50 95% CI 1.04 to 2.16; nonadvanced HF, HR 1.25 95% CI 1.01 to 1.56, pinteraction = 0.333), driven by an increased risk of mortality, mainly because of cardiovascular causes. In conclusion, ischemic etiology is the most common cause of HF in patients with at least one I-NEED-HELP marker and with or without advanced HF as defined by the 2018 HFA-ESC definition. In both patients with advanced and not-advanced HF, ischemic etiology carried an increased risk of worse prognosis.

Association of Tricuspid Regurgitation With Outcome in Acute Heart Failure.

BACKGROUND: Tricuspid regurgitation (TR) is common in chronic heart failure (HF) and is associated with negative prognosis. However, evidence on prognostic implications of TR in acute HF is lacking. We sought to investigate the association between TR and mortality and the interaction with pulmonary hypertension (PH) in patients admitted for acute HF. METHODS: We enrolled 1176 consecutive patients with a primary diagnosis of acute HF and with available noninvasive estimation of TR and pulmonary arterial systolic pressure. RESULTS: Moderate-severe TR was present in 352 patients (29.9%) and was associated with older age and more comorbidities. The prevalence of PH (ie, pulmonary arterial systolic pressure >40 mm Hg), right ventricular dysfunction, and mitral regurgitation was higher in moderate-severe TR. At 1 year, 184 (15.6%) patients died. Moderate-severe TR was associated with higher 1-year mortality risk after adjustment for other echocardiographic parameters (pulmonary arterial systolic pressure, left ventricle ejection fraction, right ventricular dysfunction, mitral regurgitation, left and right atrial indexed volumes; hazard ratio, 1.718; P=0.009), and the association with outcome was maintained when clinical variables (eg, natriuretic peptides, serum creatinine and urea, systolic blood pressure, atrial fibrillation) were added to the multivariable model (hazard ratio, 1.761; P=0.024). The association between moderate-severe TR and outcome was consistent in patients with versus without PH, with versus without right ventricular dysfunction, and with versus without left ventricle ejection fraction <50%. Patients with coexistent moderate-severe TR and PH had 3-fold higher 1-year mortality risk compared with patients with no TR or PH (hazard ratio, 3.024; P<0.001). CONCLUSIONS: In patients hospitalized for acute HF, the severity of TR is associated with 1-year survival, regardless of the presence of PH. The coexistence of moderate-severe TR and estimated PH was associated with a further increase in mortality risk. Our data must be interpreted in the context of potential underestimation of pulmonary arterial systolic pressure in patients with severe TR.

New perspectives in diagnosis and risk stratification of non-ischaemic dilated cardiomyopathy.

Dilated cardiomyopathy is a primitive heart muscle condition, characterized by structural and functional abnormalities, in the absence of a specific cause sufficient to determine the disease. It is, though, an 'umbrella' term that describes the final common pathway of different pathogenic processes and gene-environment interactions. Performing an accurate diagnostic workup and appropriate characterization of the patient has a direct impact on the patient's outcome. The physician should adapt a multiparametric approach, including a careful anamnesis and physical examination and integrating imaging data and genetic testing. Aetiological characterization should be pursued, and appropriate arrhythmic risk stratification should be performed. Evaluations should be repeated thoroughly at follow-up, as the disease is dynamical over time and individual risk might evolve. The goal is an all-around characterization of the patient, a personalized medicine approach, in order to establish a diagnosis and therapy tailored for the individual patient.

Predicting left ventricular functional recovery in ischaemic cardiomyopathy: needs and challenges.

Left ventricular (LV) systolic function is an essential parameter for the evaluation of patients with ischaemic heart disease, and therapeutic choices are significantly driven by LV ejection fraction (LVEF) in the early stage of the disease and during follow-up. After an acute coronary syndrome, ventricular dysfunction may be reversible when caused by transient myocardial stunning. Therefore, the identification of clinical, laboratory, and instrumental predictors of improvement in LV systolic function (in addition to LVEF) is essential for an adequate prognostic stratification. In the setting of chronic ischaemic heart disease, there is no evidence that an improvement in LV systolic function is invariably associated with a better prognosis and LVEF is only one of many parameters that should be considered for the risk stratification. This state-of-the-art review will critically analyse the scientific evidence regarding known predictors of LVEF recovery, trying to elucidate their pathophysiological principles and clinical value.

First report of Mal de Rio Cuarto Virus and a picorna-like virus naturally infecting rice (Oryza sativa) in Argentina.

The first rice virus detected in Argentina was Rice stripe necrosis virus (RSNV), a benyvirus known to cause "entorchamiento" due to its characteristic symptom of leaf crinkling. As part of this study, it was proposed to sequence plants naturally infected with RSNV that presented another symptom such as thickening of veins, serrated edges, chlorosis that turns necrotic and dwarfism to detect the presence of other viruses in mixed infections. We worked with 20 rice plants sampled in the San Javier area (Santa Fe, Argentina) and that were positive for RSNV by serology using anti-RSNV antiserum. Total RNA of 5mg leaf tissue from each plant was extracted separately using a Qiagen RNeasy Plant RNA kit. Ten µg of pooled sample was sent for library preparation using Ribo-Zero Plant Kit + TruSeq RNA Library Prep Kit v2 and sequenced on an Illumina HiSeq 1500, 150 nucleotide (nt) flowcell at the IABIMO-CONICET/INTA (Argentina). The 177,005,442 reads generated were mapped to the Oryza sativa genome (RefSeq GCF_001433935) using Geneious software v.9.1.8 (Biomatters Limited, Auckland, New Zealand) to remove rice reads. The remaining reads (63,756,284) were assembled de novo using rnaviralSPAdes, Galaxy tools (https://usegalaxy.org.au/). Contigs were annotated using the BEST HIT of BLASTN vs. nt and BLASTX vs. the non-redundant sequence database. Forty virus sequences were analyzed using the ORF finder and BLAST tools at NCBI (http://www.ncbi.nlm.nih.gov/). The nt identity was calculated using the SDT 1.2 program (Muhire et al., 2014). The BLASTN results showed the presence of 38 contigs (636 reads) with high nt identity (higher than 97.6%) with Mal de Rio Cuarto virus (MRCV), with 58% genome coverage. Two other contigs (120 reads) had high nt identity to Fuyang picorna-like virus 2 (FpiV2, GenBank access MT317172), with 38% genome coverage. MRCV is a species of the Fijivirus genus, Reoviridae family, with a linear dsRNA genome composed of 10 segments encoding 12 proteins (Matthijnssens et al., 2022). In this work, it was possible to partially sequence the 10 segments of MRCV. Contigs with lengths greater than 1,000nt were detected that correspond to segments S1 (2029nt), S2 (2308nt), S3 (1249nt) and S4 (1067nt) and showed 98.32%, 98.48%, 97.68% and 97.75% nt identity with the reference sequences (GenBank access NC_008733, NC_008730, NC_008732 and NC_008729), respectively. A contig of 400 nt was identified as a capsid protein (CP) gene fragment (S10) with 98.75% nt identity to the reference sequence (NC_008734). The presence of MRCV was confirmed in 3 of the 20 samples by DAS-ELISA serological test using anti-MRCV antiserum. FpiV2 was reported for the first time infecting rice in China and, due to its genomic structure, was proposed as a new member of the Picornaviridae family, but without an assigned genus (Chao et al., 2021). It is a monopartite virus, with a linear ssRNA(+) genome of 9.2kb. Analysis of two sequence fragments (1587nt and 2086nt) revealed that they corresponded to the putative RdRp with 83.9% nt identity (90.2% aa) and the putative CP sequence with 86.7% nt identity (96.3% aa) with the GenBank sequence MT317172, respectively. Detection of this picorna-like virus was further confirmed in 2 of the 20 samples by RT-PCR and Sanger sequencing with virus-specific primers (PL2Fw: 5' TTATTTGTGAGTAACAGCCCAGCAC 3'; PL2Rv: 5' AGACCGAGGACTATGGAAGCCTTTC 3', 540nt). To our knowledge, this is the first report of rice as a natural host of MRCV and may be the second detection of FpiV2 worldwide.

Cardiology of the future: xenotransplantation with porcine heart.

The reduced availability of human donor hearts compared with the needs of patients with advanced heart failure refractory to medical therapy has promoted the search for therapeutic alternatives to cardiac allografts. Porcine heart xenotransplantation represents one of the most promising frontiers in this field today. From the first researches in the 1960s to today, the numerous advances achieved in the field of surgical techniques, genetic engineering and immunosuppression have made it possible at the beginning of 2022 to carry out the first swine-to-human heart transplant, attaining a survival of 2 months after surgery. The main intellectual and experimental stages that have marked the history of xenotransplantation, the latest acquisitions in terms of genetic editing, as well as the improvement of immunosuppressive therapy are discussed analytically in this article in order to illustrate the underlying complexity of this therapeutic model.

Prognostic impact of the updated 2018 HFA-ESC definition of advanced heart failure: results from the HELP-HF registry.

AIMS: The Heart Failure Association of the European Society of Cardiology (HFA-ESC) proposed a definition of advanced heart failure (HF) that has not been validated, yet. We assessed its prognostic impact in a consecutive series of patients with high-risk HF. METHODS AND RESULTS: The HELP-HF registry enrolled consecutive patients with HF and at least one high-risk 'I NEED HELP' marker, evaluated at four Italian centres between 1st January 2020 and 30th November 2021. Patients meeting the HFA-ESC advanced HF definition were compared to patients not meeting this definition. The primary endpoint was the composite of all-cause mortality or first HF hospitalization. Out of 4753 patients with HF screened, 1149 (24.3%) patients with at least one high-risk 'I NEED HELP' marker were included (mean age 75.1 ± 11.5 years, 67.3% male, median left ventricular ejection fraction [LVEF] 35% [interquartile range 25%-50%]). Among them, 193 (16.8%) patients met the HFA-ESC advanced HF definition. As compared to others, these patients were younger, had lower LVEF, higher natriuretic peptides and a worse clinical profile. The 1-year rate of the primary endpoint was 69.3% in patients with advanced HF according to the HFA-ESC definition versus 41.8% in the others (hazard ratio [HR] 2.23, 95% confidence interval [CI] 1.82-2.74, p < 0.001). The prognostic impact of the HFA-ESC advanced HF definition was confirmed after multivariable adjustment for relevant covariates (adjusted HR 1.98, 95% CI 1.57-2.50, p < 0.001). CONCLUSIONS: The HFA-ESC advanced HF definition had a strong prognostic impact in a contemporary, real-world, multicentre high-risk cohort of patients with HF.

Aspirin and Infection: A Narrative Review.

Acetylsalicylic acid (ASA) is one of the most commonly used drugs in the world. It derives from the extract of white willow bark, whose therapeutic potential was known in Egypt since 1534 BC. ASA's pharmacological effects are historically considered secondary to its anti-inflammatory, platelet-inhibiting properties; however, human studies demonstrating a pro-inflammatory effect of ASA exist. It is likely that we are aware of only part of ASA's mechanisms of action; moreover, the clinical effect is largely dependent on dosages. During the past few decades, evidence of the anti-infective properties of ASA has emerged. We performed a review of such research in order to provide a comprehensive overview of ASA and viral, bacterial, fungal and parasitic infections, as well as ASA's antibiofilm properties.