The 3-(3-oxoisoindolin-1-yl)pentane-2,4-dione (ISOAC1) as a new molecule able to inhibit Amyloid ß aggregation and neurotoxicity.

Amyloid ß 1-42 (Aß1-42) protein aggregation is considered one of the main triggers of Alzheimer's disease (AD). In this study, we examined the in vitro anti-amyloidogenic activity of the isoindolinone derivative 3-(3-oxoisoindolin-1-yl)pentane-2,4-dione (ISOAC1) and its neuroprotective potential against the Aß1-42 toxicity. By performing the Thioflavin T fluorescence assay, Western blotting analyses, and Circular Dichroism experiments, we found that ISOAC1 was able to reduce the Aß1-42 aggregation and conformational transition towards ß-sheet structures. Interestingly, in silico studies revealed that ISOAC1 was able to bind to both the monomer and a pentameric protofibril of Aß1-42, establishing a hydrophobic interaction with the PHE19 residue of the Aß1-42 KLVFF motif. In vitro analyses on primary cortical neurons showed that ISOAC1 counteracted the increase of intracellular Ca2+ levels and decreased the Aß1-42-induced toxicity, in terms of mitochondrial activity reduction and increase of reactive oxygen species production. In addition, confocal microscopy analyses showed that ISOAC1 was able to reduce the Aß1-42 intraneuronal accumulation. Collectively, our results clearly show that ISOAC1 exerts a neuroprotective effect by reducing the Aß1-42 aggregation and toxicity, hence emerging as a promising compound for the development of new Aß-targeting therapeutic strategies for AD treatment.

Size-Based Effects of Anthropogenic Ultrafine Particles on Lysosomal TRPML1 Channel and Autophagy in Motoneuron-like Cells.

Background: An emerging body of evidence indicates an association between anthropogenic particulate matter (PM) and neurodegeneration. Although the historical focus of PM toxicity has been on the cardiopulmonary system, ultrafine PM particles can also exert detrimental effects in the brain. However, only a few studies are available on the harmful interaction between PM and CNS and on the putative pathomechanisms. Methods: Ultrafine PM particles with a diameter < 0.1 µm (PM0.1) and nanoparticles < 20 nm (NP20) were sampled in a lab-scale combustion system. Their effect on cell tracking in the space was studied by time-lapse and high-content microscopy in NSC-34 motor neurons while pHrodo™ Green conjugates were used to detect PM endocytosis. Western blotting analysis was used to quantify protein expression of lysosomal channels (i.e., TRPML1 and TPC2) and autophagy markers. Current-clamp electrophysiology and Fura2-video imaging techniques were used to measure membrane potential, intracellular Ca2+ homeostasis and TRPML1 activity in NSC-34 cells exposed to PM0.1 and NP20. Results: NP20, but not PM0.1, reduced NSC-34 motor neuron movement in the space. Furthermore, NP20 was able to shift membrane potential of motor neurons toward more depolarizing values. PM0.1 and NP20 were able to enter into the cells by endocytosis and exerted mitochondrial toxicity with the consequent stimulation of ROS production. This latter event was sufficient to determine the hyperactivation of the lysosomal channel TRPML1. Consequently, both LC3-II and p62 protein expression increased after 48 h of exposure together with AMPK activation, suggesting an engulfment of autophagy. The antioxidant molecule Trolox restored TRPML1 function and autophagy. Conclusions: Restoring TRPML1 function by an antioxidant agent may be considered a protective mechanism able to reestablish autophagy flux in motor neurons exposed to nanoparticles.

Increased KV2.1 Channel Clustering Underlies the Reduction of Delayed Rectifier K+ Currents in Hippocampal Neurons of the Tg2576 Alzheimer's Disease Mouse.

Alzheimer's disease (AD) is a neurodegenerative disorder characterized by the progressive deterioration of cognitive functions. Cortical and hippocampal hyperexcitability intervenes in the pathological derangement of brain activity leading to cognitive decline. As key regulators of neuronal excitability, the voltage-gated K+ channels (KV) might play a crucial role in the AD pathophysiology. Among them, the KV2.1 channel, the main α subunit mediating the delayed rectifier K+ currents (IDR) and controlling the intrinsic excitability of pyramidal neurons, has been poorly examined in AD. In the present study, we investigated the KV2.1 protein expression and activity in hippocampal neurons from the Tg2576 mouse, a widely used transgenic model of AD. To this aim we performed whole-cell patch-clamp recordings, Western blotting, and immunofluorescence analyses. Our Western blotting results reveal that KV2.1 was overexpressed in the hippocampus of 3-month-old Tg2576 mice and in primary hippocampal neurons from Tg2576 mouse embryos compared with the WT counterparts. Electrophysiological experiments unveiled that the whole IDR were reduced in the Tg2576 primary neurons compared with the WT neurons, and that this reduction was due to the loss of the KV2.1 current component. Moreover, we found that the reduction of the KV2.1-mediated currents was due to increased channel clustering, and that glutamate, a stimulus inducing KV2.1 declustering, was able to restore the IDR to levels comparable to those of the WT neurons. These findings add new information about the dysregulation of ionic homeostasis in the Tg2576 AD mouse model and identify KV2.1 as a possible player in the AD-related alterations of neuronal excitability.

Exploring the Parallel G-Quadruplex Nucleic Acid World: A Spectroscopic and Computational Investigation on the Binding of the c-myc Oncogene NHE III1 Region by the Phytochemical Polydatin.

Trans-polydatin (tPD), the 3-ß-D-glucoside of the well-known nutraceutical trans-resveratrol, is a natural polyphenol with documented anti-cancer, anti-inflammatory, cardioprotective, and immunoregulatory effects. Considering the anticancer activity of tPD, in this work, we aimed to explore the binding properties of this natural compound with the G-quadruplex (G4) structure formed by the Pu22 [d(TGAGGGTGGGTAGGGTGGGTAA)] DNA sequence by exploiting CD spectroscopy and molecular docking simulations. Pu22 is a mutated and shorter analog of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, whose overexpression triggers the metabolic changes responsible for cancer cells transformation. The binding of tPD with the parallel Pu22 G4 was confirmed by CD spectroscopy, which showed significant changes in the CD spectrum of the DNA and a slight thermal stabilization of the G4 structure. To gain a deeper insight into the structural features of the tPD-Pu22 complex, we performed an in silico molecular docking study, which indicated that the interaction of tPD with Pu22 G4 may involve partial end-stacking to the terminal G-quartet and H-bonding interactions between the sugar moiety of the ligand and deoxynucleotides not included in the G-tetrads. Finally, we compared the experimental CD profiles of Pu22 G4 with the corresponding theoretical output obtained using DichroCalc, a web-based server normally used for the prediction of proteins' CD spectra starting from their ".pdb" file. The results indicated a good agreement between the predicted and the experimental CD spectra in terms of the spectral bands' profile even if with a slight bathochromic shift in the positive band, suggesting the utility of this predictive tool for G4 DNA CD investigations.

Exploring the Therapeutic Potential of Phytochemicals in Alzheimer's Disease: Focus on Polyphenols and Monoterpenes.

Alzheimer's disease (AD) is a chronic, complex neurodegenerative disorder mainly characterized by the irreversible loss of memory and cognitive functions. Different hypotheses have been proposed thus far to explain the etiology of this devastating disorder, including those centered on the Amyloid-ß (Aß) peptide aggregation, Tau hyperphosphorylation, neuroinflammation and oxidative stress. Nonetheless, the therapeutic strategies conceived thus far to treat AD neurodegeneration have proven unsuccessful, probably due to the use of single-target drugs unable to arrest the progressive deterioration of brain functions. For this reason, the theoretical description of the AD etiology has recently switched from over-emphasizing a single deleterious process to considering AD neurodegeneration as the result of different pathogenic mechanisms and their interplay. Moreover, much relevance has recently been conferred to several comorbidities inducing insulin resistance and brain energy hypometabolism, including diabetes and obesity. As consequence, much interest is currently accorded in AD treatment to a multi-target approach interfering with different pathways at the same time, and to life-style interventions aimed at preventing the modifiable risk-factors strictly associated with aging. In this context, phytochemical compounds are emerging as an enormous source to draw on in the search for multi-target agents completing or assisting the traditional pharmacological medicine. Intriguingly, many plant-derived compounds have proven their efficacy in counteracting several pathogenic processes such as the Aß aggregation, neuroinflammation, oxidative stress and insulin resistance. Many strategies have also been conceived to overcome the limitations of some promising phytochemicals related to their poor pharmacokinetic profiles, including nanotechnology and synthetic routes. Considering the emerging therapeutic potential of natural medicine, the aim of the present review is therefore to highlight the most promising phytochemical compounds belonging to two major classes, polyphenols and monoterpenes, and to report the main findings about their mechanisms of action relating to the AD pathogenesis.

Nucleic Acids as Biotools at the Interface between Chemistry and Nanomedicine in the COVID-19 Era.

The recent development of mRNA vaccines against the SARS-CoV-2 infection has turned the spotlight on the potential of nucleic acids as innovative prophylactic agents and as diagnostic and therapeutic tools. Until now, their use has been severely limited by their reduced half-life in the biological environment and the difficulties related to their transport to target cells. These limiting aspects can now be overcome by resorting to chemical modifications in the drug and using appropriate nanocarriers, respectively. Oligonucleotides can interact with complementary sequences of nucleic acid targets, forming stable complexes and determining their loss of function. An alternative strategy uses nucleic acid aptamers that, like the antibodies, bind to specific proteins to modulate their activity. In this review, the authors will examine the recent literature on nucleic acids-based strategies in the COVID-19 era, focusing the attention on their applications for the prophylaxis of COVID-19, but also on antisense- and aptamer-based strategies directed to the diagnosis and therapy of the coronavirus pandemic.

Na+/Ca2+ exchanger isoform 1 (NCX1) and canonical transient receptor potential channel 6 (TRPC6) are recruited by STIM1 to mediate Store-Operated Calcium Entry in primary cortical neurons.

Excessive calcium (Ca2+) release from the endoplasmic reticulum (ER) represents an important hallmark of several neurodegenerative diseases. ER is recharged from Ca2+ through the so-called Store-Operated Calcium Entry (SOCE) thus providing Ca2+ signals to regulate critical cell functions. Single transmembrane-spanning domain protein stromal interacting molecule 1 (STIM1), mainly residing in the ER, and plasmalemmal channel Orai1 represent the SOCE key components at neuronal level. However, many other proteins participate to ER Ca2+ refilling including the Na+/Ca2+ exchanger isoform 1 (NCX1), whose regulation by ER remains unknown. In this study, we tested the possibility that neuronal NCX1 may take part to SOCE through the interaction with STIM1. In rat primary cortical neurons and in nerve growth factor (NGF)-differentiated PC12 cells NCX1 knocking down by siRNA strategy significantly prevented SOCE as well as SOCE pharmacological inhibition by SKF-96365 and 2-APB. A significant reduction of SOCE was recorded also in synaptosomes from ncx1-/- mice brain compared with ncx1+/+ mice. Double labeling confocal experiments showed a large co-localization between NCX1 and STIM1 in rat primary cortical neurons. Accordingly, NCX1 and STIM1 co-immunoprecipitated and functionally interacted each other during ischemic preconditioning, a phenomenon inducing ischemic tolerance. However, STIM1 knocking down reduced NCX1 activity recorded by either patch-clamp electrophysiology or Fura-2 single-cell microfluorimetry. Furthermore, canonical transient receptor potential channel 6 (TRPC6) was identified as the mechanism mediating local increase of sodium (Na+) useful to drive NCX1 reverse mode and, therefore, NCX1-mediated Ca2+ refilling. In fact, TRPC6 not only interacted with STIM1, as shown by the co-localization and co-immunoprecipitation with the ER Ca2+ sensor, but it also mediated 1,3-Benzenedicarboxylic acid, 4,4'-[1,4,10-trioxa-7,13-diazacyclopentadecane-7,13-diylbis(5-methoxy-6,12-benzofurandiyl)]bis-, tetrakis[(acetyloxy)methyl] ester (SBFI)-monitored Na+ increase elicited by thapsigargin in primary cortical neurons. Accordingly, efficient TRPC6 knockdown prevented thapsigargin-induced intracellular Na+ elevation and SOCE. Collectively, we identify NCX1 as a new partner of STIM1 in mediating SOCE, whose activation in the reverse mode may be facilitated by the local increase of Na+ concentration due to the interaction between STIM1 and TRPC6 in primary cortical neurons.

The Na+/Ca2+ Exchanger 3 Is Functionally Coupled With the NaV1.6 Voltage-Gated Channel and Promotes an Endoplasmic Reticulum Ca2+ Refilling in a Transgenic Model of Alzheimer's Disease.

The remodelling of neuronal ionic homeostasis by altered channels and transporters is a critical feature of the Alzheimer's disease (AD) pathogenesis. Different reports converge on the concept that the Na+/Ca2+ exchanger (NCX), as one of the main regulators of Na+ and Ca2+ concentrations and signalling, could exert a neuroprotective role in AD. The activity of NCX has been found to be increased in AD brains, where it seemed to correlate with an increased neuronal survival. Moreover, the enhancement of the NCX3 currents (INCX) in primary neurons treated with the neurotoxic amyloid ß 1-42 (Aß1-42) oligomers prevented the endoplasmic reticulum (ER) stress and neuronal death. The present study has been designed to investigate any possible modulation of the INCX, the functional interaction between NCX and the NaV1.6 channel, and their impact on the Ca2+ homeostasis in a transgenic in vitro model of AD, the primary hippocampal neurons from the Tg2576 mouse, which overproduce the Aß1-42 peptide. Electrophysiological studies, carried in the presence of siRNA and the isoform-selective NCX inhibitor KB-R7943, showed that the activity of a specific NCX isoform, NCX3, was upregulated in its reverse, Ca2+ influx mode of operation in the Tg2576 neurons. The enhanced NCX activity contributed, in turn, to increase the ER Ca2+ content, without affecting the cytosolic Ca2+ concentrations of the Tg2576 neurons. Interestingly, our experiments have also uncovered a functional coupling between NCX3 and the voltage-gated NaV1.6 channels. In particular, the increased NaV1.6 currents appeared to be responsible for the upregulation of the reverse mode of NCX3, since both TTX and the Streptomyces griseolus antibiotic anisomycin, by reducing the NaV1.6 currents, counteracted the increase of the INCX in the Tg2576 neurons. In agreement, our immunofluorescence analyses revealed that the NCX3/NaV1.6 co-expression was increased in the Tg2576 hippocampal neurons in comparison with the WT neurons. Collectively, these findings indicate that NCX3 might intervene in the Ca2+ remodelling occurring in the Tg2576 primary neurons thus emerging as a molecular target with a neuroprotective potential, and provide a new outcome of the NaV1.6 upregulation related to the modulation of the intracellular Ca2+ concentrations in AD neurons.

Probing the Ca2+ mobilizing properties on primary cortical neurons of a new stable cADPR mimic.

Cyclic adenosine diphosphate ribose (cADPR) is a second messenger involved in the Ca2+ homeostasis. Its chemical instability prompted researchers to tune point by point its structure, obtaining stable analogues featuring interesting biological properties. One of the most challenging derivatives is the cyclic inosine diphosphate ribose (cIDPR), in which the hypoxanthine isosterically replaces the adenine. As our research focuses on the synthesis of N1 substituted inosines, in the last few years we have produced new flexible cIDPR analogues, where the northern ribose has been replaced by alkyl chains. Interestingly, some of them mobilized Ca2+ ions in PC12 cells. To extend our SAR studies, herein we report on the synthesis of a new stable cIDPR derivative which contains the 2″S,3″R dihydroxypentyl chain instead of the northern ribose. Interestingly, the new cyclic derivative and its open precursor induced an increase in intracellular calcium concentration ([Ca2+]i) with the same efficacy of the endogenous cADPR in rat primary cortical neurons.

Rebound effects of NCX3 pharmacological inhibition: A novel strategy to accelerate myelin formation in oligodendrocytes.

The Na+/Ca2+ exchanger NCX3 is an important regulator of sodium and calcium homeostasis in oligodendrocyte lineage. To date, no information is available on the effects resulting from prolonged exposure to NCX3 blockers and subsequent drug washout in oligodendroglia. Here, we investigated, by means of biochemical, morphological and functional analyses, the pharmacological effects of the NCX3 inhibitor, the 5-amino-N-butyl-2-(4-ethoxyphenoxy)-benzamide hydrochloride (BED), on NCXs expression and activity, as well as intracellular [Na+]i and [Ca2+]i levels, during treatment and following drug washout both in human MO3.13 oligodendrocytes and rat primary oligodendrocyte precursor cells (OPCs). BED exposure antagonized NCX activity, induced OPCs proliferation and [Na+]i accumulation. By contrast, 2 days of BED washout after 4 days of treatment significantly upregulated low molecular weight NCX3 proteins, reversed NCX activity, and increased intracellular [Ca2+]i. This BED-free effect was accompanied by an upregulation of NCX3 expression in oligodendrocyte processes and accelerated expression of myelin markers in rat primary oligodendrocytes. Collectively, our findings show that the pharmacological inhibition of the NCX3 exchanger with BED blocker maybe followed by a rebound increase in NCX3 expression and reversal activity that accelerate myelin sheet formation in oligodendrocytes. In addition, they indicate that a particular attention should be paid to the use of NCX inhibitors for possible rebound effects, and suggest that further studies will be necessary to investigate whether selective pharmacological modulation of NCX3 exchanger may be exploited to benefit demyelination and remyelination in demyelinating diseases.

The Antioxidant Activity of Limonene Counteracts Neurotoxicity Triggered byAß1-42 Oligomers in Primary Cortical Neurons.

Many natural-derived compounds, including the essential oils from plants, are investigated to find new potential protective agents in several neurodegenerative disorders such as Alzheimer's disease (AD). In the present study, we tested the neuroprotective effect of limonene, one of the main components of the genus Citrus, against the neurotoxicity elicited by Aß1-42 oligomers, currently considered a triggering factor in AD. To this aim, we assessed the acetylcholinesterase activity by Ellman's colorimetric method, the mitochondrial dehydrogenase activity by MTT assay, the nuclear morphology by Hoechst 33258, the generation of reactive oxygen species (ROS) by DCFH-DA fluorescent dye, and the electrophysiological activity of KV3.4 potassium channel subunits by patch-clamp electrophysiology. Interestingly, the monoterpene limonene showed a specific activity against acetylcholinesterase with an IC50 almost comparable to that of galantamine, used as positive control. Moreover, at the concentration of 10 µg/mL, limonene counteracted the increase of ROS production triggered by Aß1-42 oligomers, thus preventing the upregulation of KV3.4 activity. This, in turn, prevented cell death in primary cortical neurons, showing an interesting neuroprotective profile against Aß1-42-induced toxicity. Collectively, the present results showed that the antioxidant properties of the main component of the genus Citrus, limonene, may be useful to prevent neuronal suffering induced by Aß1-42 oligomers preventing the hyperactivity of KV3.4.

Lavender and coriander essential oils and their main component linalool exert a protective effect against amyloid-ß neurotoxicity.

Alzheimer's disease (AD) is a neurodegenerative disorder leading to cognitive deficits and cognitive decline. Since no cure or preventing therapy is currently available to counteract AD, natural-derived compounds are investigated to find new potential neuroprotective agents for its treatment. In the present study, we tested the neuroprotective effect of lavender and coriander essential oils (EOs) and their main active constituent linalool, against the neurotoxicity elicited by Aß1-42 oligomers, a key molecular factor in the neurodegeneration of AD. Importantly, our findings on neuronally differentiated PC12 cells exposed to Aß1-42 oligomers are in accordance with previous in vivo studies reporting the neuroprotective potential of lavender and coriander EOs and linalool. We found that lavender and coriander EOs at the concentration of 10 µg/mL as well as linalool at the same concentration were able to improve viability and to reduce nuclear morphological abnormalities in cells treated with Aß1-42 oligomers for 24 hours. Lavender and coriander EOs and linalool also showed to counteract the increase of intracellular reactive oxygen species production and the activation of the pro-apoptotic enzyme caspase-3 induced by Aß1-42 oligomers. Our findings provide further evidence that these EOs and their main constituent linalool could be natural agents of therapeutic interest against Aß1-42 -induced neurotoxicity.

The Na+/Ca2+exchanger in Alzheimer's disease.

As a pivotal player in regulating sodium (Na+) and calcium (Ca2+) homeostasis and signalling in excitable cells, the Na+/Ca2+ exchanger (NCX) is involved in many neurodegenerative disorders in which an imbalance of intracellular Ca2+ and/or Na+ concentrations occurs, including Alzheimer's disease (AD). Although NCX has been mainly implicated in neuroprotective mechanisms counteracting Ca2+ dysregulation, several studies highlighted its role in the neuronal responses to intracellular Na+ elevation occurring in several pathophysiological conditions. Since the alteration of Na+ and Ca2+ homeostasis significantly contributes to synaptic dysfunction and neuronal loss in AD, it is of crucial importance to analyze the contribution of NCX isoforms in the homeostatic responses at neuronal and synaptic levels. Some studies found that an increase of NCX activity in brains of AD patients was correlated with neuronal survival, while other research groups found that protein levels of two NCX subtypes, NCX2 and NCX3, were modulated in parietal cortex of late stage AD brains. In particular, NCX2 positive synaptic terminals were increased in AD cohort while the number of NCX3 positive terminals were reduced. In addition, NCX1, NCX2 and NCX3 isoforms were up-regulated in those synaptic terminals accumulating amyloid-beta (Aß), the neurotoxic peptide responsible for AD neurodegeneration. More recently, the hyperfunction of a specific NCX subtype, NCX3, has been shown to delay endoplasmic reticulum stress and apoptotic neuronal death in hippocampal neurons exposed to Aß insult. Despite some issues about the functional role of NCX in synaptic failure and neuronal loss require further studies, these findings highlight the putative neuroprotective role of NCX in AD and open new strategies to develop new druggable targets for AD therapy.

The Anemonia sulcata Toxin BDS-I Protects Astrocytes Exposed to Aß1-42 Oligomers by Restoring [Ca2+]i Transients and ER Ca2+ Signaling.

Intracellular calcium concentration ([Ca2+]i) transients in astrocytes represent a highly plastic signaling pathway underlying the communication between neurons and glial cells. However, how this important phenomenon may be compromised in Alzheimer's disease (AD) remains unexplored. Moreover, the involvement of several K+ channels, including KV3.4 underlying the fast-inactivating currents, has been demonstrated in several AD models. Here, the effect of KV3.4 modulation by the marine toxin blood depressing substance-I (BDS-I) extracted from Anemonia sulcata has been studied on [Ca2+]i transients in rat primary cortical astrocytes exposed to Aß1-42 oligomers. We showed that: (1) primary cortical astrocytes expressing KV3.4 channels displayed [Ca2+]i transients depending on the occurrence of membrane potential spikes, (2) BDS-I restored, in a dose-dependent way, [Ca2+]i transients in astrocytes exposed to Aß1-42 oligomers (5 µM/48 h) by inhibiting hyperfunctional KV3.4 channels, (3) BDS-I counteracted Ca2+ overload into the endoplasmic reticulum (ER) induced by Aß1-42 oligomers, (4) BDS-I prevented the expression of the ER stress markers including active caspase 12 and GRP78/BiP in astrocytes treated with Aß1-42 oligomers, and (5) BDS-I prevented Aß1-42-induced reactive oxygen species (ROS) production and cell suffering measured as mitochondrial activity and lactate dehydrogenase (LDH) release. Collectively, we proposed that the marine toxin BDS-I, by inhibiting the hyperfunctional KV3.4 channels and restoring [Ca2+]i oscillation frequency, prevented Aß1-42-induced ER stress and cell suffering in astrocytes.

Amyloid ß-Induced Upregulation of Nav1.6 Underlies Neuronal Hyperactivity in Tg2576 Alzheimer's Disease Mouse Model.

Hyperexcitability and alterations in neuronal networks contribute to cognitive impairment in Alzheimer's Disease (AD). Voltage-gated sodium channels (NaV), which are crucial for regulating neuronal excitability, have been implicated in AD-related hippocampal hyperactivity and higher incidence of spontaneous non-convulsive seizures. Here, we show by using primary hippocampal neurons exposed to amyloid-ß1-42 (Aß1-42) oligomers and from Tg2576 mouse embryos, that the selective upregulation of NaV1.6 subtype contributes to membrane depolarization and to the increase of spike frequency, thereby resulting in neuronal hyperexcitability. Interestingly, we also found that NaV1.6 overexpression is responsible for the aberrant neuronal activity observed in hippocampal slices from 3-month-old Tg2576 mice. These findings identify the NaV1.6 channels as a determinant of the hippocampal neuronal hyperexcitability induced by Aß1-42 oligomers. The selective blockade of NaV1.6 overexpression and/or hyperactivity might therefore offer a new potential therapeutic approach to counteract early hippocampal hyperexcitability and subsequent cognitive deficits in the early stages of AD.

Synthesis and Pharmacological Evaluation of a Novel Peptide Based on Anemonia sulcata BDS-I Toxin as a New KV3.4 Inhibitor Exerting a Neuroprotective Effect Against Amyloid-ß Peptide.

There is increasing evidence that the fast-inactivating potassium current IA, encoded by KV3. 4 channels, plays an important role in Alzheimer's Disease (AD), since the neurotoxic ß-amyloid peptide1-42 (Aß1-42) increases the IA current triggering apoptotic processes. The specific inhibition of KV3.4 by the marine toxin extracted from Anemonia sulcata, named blood depressing substance-I (BDS-I), reverts the Aß peptide-induced cell death. The aim of the present study was to identify the smallest fragments of BDS-I, obtained by peptide synthesis, able to inhibit KV3.4 currents. For this purpose, whole-cell patch clamp technique was used to evaluate the effects of BDS-I fragments on KV3.4 currents in CHO cells heterologously expressing KV3.4. We found that BDS-I[1-8] fragment, containing the N-terminal octapeptide sequence of full length BDS-I, was able to inhibit KV3.4 currents in a concentration dependent manner, whereas the scrambled sequence of BDS-I[1-8] and all the other fragments obtained from BDS-I full length were ineffective. As we demonstrated in a previous study, BDS-I full length is able to counteract Aß1-42-induced enhancement of KV3.4 activity, preventing Aß1-42-induced caspase-3 activation and the abnormal nuclear morphology in NGF-differentiated PC-12 cells. Similarly to BDS-I, we found that BDS-I[1-8] blocking KV3.4 currents prevented Aß1-42-induced caspase-3 activation and apoptotic processes. Collectively, these results suggest that BDS-I[1-8] could represent a lead compound to be developed as a new drug targeting KV3.4 channels.

Synthesis and Biological Evaluation of a New Structural Simplified Analogue of cADPR, a Calcium-Mobilizing Secondary Messenger Firstly Isolated from Sea Urchin Eggs.

Herein, we reported on the synthesis of cpIPP, which is a new structurally-reduced analogue of cyclic ADP-ribose (cADPR), a potent Ca2+-releasing secondary messenger that was firstly isolated from sea urchin eggs extracts. To obtain cpIPP the "northern" ribose of cADPR was replaced by a pentyl chain and the pyrophosphate moiety by a phophono-phosphate anhydride. The effect of the presence of the new phosphono-phosphate bridge on the intracellular Ca2+ release induced by cpIPP was assessed in PC12 neuronal cells in comparison with the effect of the pyrophosphate bridge of the structurally related cyclic N1-butylinosine diphosphate analogue (cbIDP), which was previously synthesized in our laboratories, and with that of the linear precursor of cpIPP, which, unexpectedly, revealed to be the only one provided with Ca2+ release properties.

The expression and activity of KV3.4 channel subunits are precociously upregulated in astrocytes exposed to Aß oligomers and in astrocytes of Alzheimer's disease Tg2576 mice.

Astrocyte dysfunction emerges early in Alzheimer's disease (AD) and may contribute to its pathology and progression. Recently, the voltage gated potassium channel KV3.4 subunit, which underlies the fast-inactivating K+ currents, has been recognized to be relevant for AD pathogenesis and is emerging as a new target candidate for AD. In the present study, we investigated both in in vitro and in vivo models of AD the expression and functional activity of KV3.4 potassium channel subunits in astrocytes. In primary astrocytes our biochemical, immunohistochemical, and electrophysiological studies demonstrated a time-dependent upregulation of KV3.4 expression and functional activity after exposure to amyloid-ß (Aß) oligomers. Consistently, astrocytic KV3.4 expression was upregulated in the cerebral cortex, hippocampus, and cerebellum of 6-month-old Tg2576 mice. Further, confocal triple labeling studies revealed that in 6-month-old Tg2576 mice, KV3.4 was intensely coexpressed with Aß in nonplaque associated astrocytes. Interestingly, in the cortical and hippocampal regions of 12-month-old Tg2576 mice, plaque-associated astrocytes much more intensely expressed KV3.4 subunits, but not Aß. More important, we evidenced that the selective knockdown of KV3.4 expression significantly downregulated both glial fibrillary acidic protein levels and Aß trimers in the brain of 6-month-old Tg2576 mice. Collectively, our results demonstrate that the expression and function of KV3.4 channel subunits are precociously upregulated in cultured astrocytes exposed to Aß oligomers and in reactive astrocytes of AD Tg2576 mice.