Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 19 de 19
Filtrar
Mais filtros

Base de dados
Tipo de documento
Intervalo de ano de publicação
1.
Acta Pharm Sin B ; 14(8): 3543-3560, 2024 Aug.
Artigo em Inglês | MEDLINE | ID: mdl-39220862

RESUMO

Pulmonary fibrosis poses a significant health threat with very limited therapeutic options available. In this study, we reported the enhanced expression of mesenchymal homobox 1 (MEOX1) in pulmonary fibrosis patients, especially in their fibroblasts and endothelial cells, and confirmed MEOX1 as a central orchestrator in the activation of profibrotic genes. By high-throughput screening, we identified Ailanthone (AIL) from a natural compound library as the first small molecule capable of directly targeting and suppressing MEOX1. AIL demonstrated the ability to inhibit both the activation of fibroblasts and endothelial-to-mesenchymal transition of endothelial cells when challenged by transforming growth factor-ß1 (TGF-ß1). In an animal model of bleomycin-induced pulmonary fibrosis, AIL effectively mitigated the fibrotic process and restored respiratory functions. Mechanistically, AIL acted as a suppressor of MEOX1 by disrupting the interaction between the transcription factor JUN and the promoter of MEOX1, thereby inhibiting MEOX1 expression and activity. In summary, our findings pinpointed MEOX1 as a cell-specific and clinically translatable target in fibrosis. Moreover, we demonstrated the potent anti-fibrotic effect of AIL in pulmonary fibrosis, specifically through the suppression of JUN-dependent MEOX1 activation.

3.
Front Plant Sci ; 15: 1444683, 2024.
Artigo em Inglês | MEDLINE | ID: mdl-39175488

RESUMO

Plant-derived exosome-like nanoparticles (ELNs) have demonstrated cross-kingdom capabilities in regulating intercellular communication, facilitating drug delivery, and providing therapeutic interventions in humans. However, the functional attributes of konjac-derived ELNs (K-ELNs) remain largely unexplored. This study investigates the isolation, characterization, and functional analysis of K-ELNs, along with the profiling and differential expression analysis of associated miRNAs in both K-ELNs and Konjac tissues. K-ELNs were successfully isolated and characterized from two konjac species using ultracentrifugation, followed by Transmission Electron Microscopy (TEM) and Nanoparticle Tracking Analysis (NTA). Small RNA sequencing identified a total of 3,259 miRNAs across all samples. Differential expression analysis revealed significant differences in miRNA profiles between K-ELNs and tissue samples. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) functional enrichment analysis of target genes provided insights into their roles in modulating pathways associated with diseases such as cancer and neurodegenerative disorders. Additionally, six miRNAs were selected for validation of sequencing results via RT-qPCR. The 5'RLM-RACE method was employed to validate the cleavage sites between differentially expressed miRNAs (DEMs) and their predicted target genes, further substantiating the regulatory roles of miRNAs in konjac. The findings of this study enhance our understanding of the molecular mechanisms underlying the biological functions and applications of K-ELNs, laying the groundwork for future research into their potential therapeutic roles in human health.

4.
Plant Dis ; 2024 Jul 09.
Artigo em Inglês | MEDLINE | ID: mdl-38982670

RESUMO

Amorphophallus albus P. Y. Liu & J. F. Chen is a typical cash crop widely planted in southwest China (Gao et al., 2022). In early August of 2021, a peculiar leaf spot disease was first detected on A. albus in Ankang Academy of Agricultural Sciences manufacturing base (32°69'N, 109°02'E), Shaanxi, China. Small irregular yellow-brown spots (1 to 2 mm) were observed on the surface of A. albus leaf. Following infection of the leaf, it expanded (3 to 5 mm) and became necrotic. Nine planting bases were investigated, and approximately 75% of plants were symptomatic during the rapid expansion period of bulb growth in Hanyin, Langao and Hanbin counties, Ankang City, Shaanxi, China. Higher disease incidence was observed at temperatures above 30℃ and humidity above 80%. Twenty-seven symptomatic tissues of infected leaves were first surface sterilized by immersion in 75% ethanol for 1 minute, followed by rinsing three times in sterile distilled water. The tissues were then cut into 4-5 mm pieces, plated on 1.5% potato dextrose agar (PDA), and incubated at 28±2°C. The hyphal tip from the growing edge of colonies cultured for three days at 28±2℃ was transferred to PDA to obtain pure cultures. Fungal colonies were white, then grey to black with an unevenly distributed, fast-growing aerial mycelium covering the petri dish within five days at 28±2℃. The colony turned dark brown when maintained in the dark at 28±2℃ after seven days, then grayish brown upon sporulation after 15 days (Fig.1f-g). Conidia were brown or black, smooth, spherical to sub-spherical, single-celled (8-12 µm × 10-13µm, average 9-11.5 µm in diameter, n=5µm). The nutritional hyphae exhibited septa, and a portion of the aerial hyphae formed a long, rough conidium, giving rise to a nearly spherical apical sac (Fig.1h). The surface gave rise to several small peduncles bearing clusters of surfaced spherical conidia (Fig.1i). Surfaced spherical conidia were generated on the surface of the small peduncle (Fig.1j). These morphological features were consistent with Nigrospora oryzae (Li et al., 2017). Genomic DNA was extracted from mycelia of the pathogen using an Ezup column fungal genomic DNA extraction kit (Sangon Biotech, Shanghai, China). To confirm the identity of the pathogen, the genomic fragments for the internal transcribed spacer (ITS), LSU (28S) and BenA gene of the isolate were amplified by PCR (Wang et al., 2017) and sent for sequencing. The resultant sequence (GeneBank ID of gene ITS, LSU, BenA are OR723825, OR775345, OR277316, respectively) were compared with the voucher specimens. BLAST results showed >99% identity with those of N.oryzae (GeneBank ID of N.oryzae strain LC2707 ITS, LSU, BenA are KX985954, KY806242, KY019481, respectively). A neighbor joining phylogenetic tree with the concatenated sequences of these genes showed that A-pb169 had the closest match with N. oryzae (Fig. 2). For pathogenicity testing, fifty plants in a period of rapid expansion of bulb growth were selected. Four leaves per plant were inoculated by sprayed till runoff with a conidial suspension of the pathogen (50 µL, 1×106 conidia/ml sterile water), and incubated at 30±2℃ and 80 ± 5% humidity. Control plants received sterile water. On the third day after inoculation, a yellow-brown spot appeared on leave surfaces, the spot gradually expanded; the infection rate was 90 to 95%. Fifteen days after inoculation, infected leaves showed symptoms like those observed in the field, whereas 100 control leaves sprayed with sterile water remained symptomless (Fig.1 a-e). The pathogen was reisolated from infected leaves and confirmed as N. oryzae by morphology and molecular identification. To our knowledge, this is the first report of leaf spot disease of A. albus caused by N. oryzae in China. Since its one of the major cash crops of the southeastern China, further work is necessary to determine its spread and economic impact as well as developing sustainable disease management options.

5.
J Fungi (Basel) ; 10(7)2024 Jul 14.
Artigo em Inglês | MEDLINE | ID: mdl-39057370

RESUMO

Sisal is an important tropical cash crop in southern China. Unfortunately, it is threatened by various diseases. In 2022, a new disease tentatively named marginal leaf blight disease (MLBD) was first observed in sisal fields across Guangxi and Guangdong provinces, with an incidence rate ranging from 13% to 30%. In this work, to isolate and identify the pathogens causing MLBD, sisal leaves exhibiting the typical MLBD symptoms were collected, and nine strains were obtained. Pathogenicity tests, morphological observations, and phylogenetic analyses confirmed that two strains, namely 22GX1-3 and 22GD1-4, identified as Phaeosphaeriopsis obtusispora, were the causative pathogens of MLBD. Further investigations into the biological characteristics of P. obtusispora showed that its mycelia exhibited optimal growth on PDA medium, with the most favourable temperature and pH being 25 °C and 7.0, respectively. The mycelia could grow in temperatures ranging from 10 °C to 32 °C but ceased at 35 °C. Lactose and yeast extract powder were also identified as the optimal carbon and nitrogen sources, respectively. Additionally, the effectiveness of various control agents was assessed on a single strain, 22GX1-3. Among the twelve fungicides tested, difenoconazole was proven the most effective, with an EC50 value of 0.5045 µg/mL. To our knowledge, this is the first report for sisal MLBD caused by P. obtusispora. Our results provide crucial pieces of information for the development of effective management strategies to control sisal MLBD caused by P. obtusispora.

6.
Sci Rep ; 14(1): 16546, 2024 07 17.
Artigo em Inglês | MEDLINE | ID: mdl-39019951

RESUMO

Intercropping systems have garnered attention as a sustainable agricultural approach for efficient land use, increased ecological diversity in farmland, and enhanced crop yields. This study examined the effect of intercropping on the kiwifruit rhizosphere to gain a deeper understanding of the relationships between cover plants and kiwifruit in this sustainable agricultural system. Soil physicochemical properties and bacterial communities were analyzed using the Kiwifruit-Agaricus blazei intercropping System. Moreover, a combined analysis of 16S rRNA gene sequencing and metabolomic sequencing was used to identify differential microbes and metabolites in the rhizosphere. Intercropping led to an increase in soil physicochemical and enzyme activity, as well as re-shaping the bacterial community and increasing microbial diversity. Proteobacteria, Bacteroidota, Myxococcota, and Patescibacteria were the most abundant and diverse phyla in the intercropping system. Expression analysis further revealed that the bacterial genera BIrii41, Acidibacter, and Altererythrobacter were significantly upregulated in the intercropping system. Moreover, 358 differential metabolites (DMs) were identified between the monocropping and intercropping cultivation patterns, with fatty acyls, carboxylic acids and derivatives, and organooxygen compounds being significantly upregulated in the intercropping system. The KEGG metabolic pathways further revealed considerable enrichment of DMs in ABC transporters, histidine metabolism, and pyrimidine metabolism. This study identified a significant correlation between 95 bacterial genera and 79 soil metabolites, and an interactive network was constructed to explore the relationships between these differential microbes and metabolites in the rhizosphere. This study demonstrated that Kiwifruit-Agaricus blazei intercropping can be an effective, labor-saving, economic, and sustainable practice for reshaping bacterial communities and promoting the accumulation and metabolism of beneficial microorganisms in the rhizosphere.


Assuntos
Actinidia , Agaricus , Bactérias , Rizosfera , Microbiologia do Solo , Actinidia/microbiologia , Actinidia/crescimento & desenvolvimento , Agaricus/crescimento & desenvolvimento , Agaricus/metabolismo , Agaricus/genética , Bactérias/genética , Bactérias/metabolismo , Bactérias/classificação , Bactérias/crescimento & desenvolvimento , RNA Ribossômico 16S/genética , Agricultura/métodos , Solo/química , Microbiota , Nutrientes/metabolismo , Produção Agrícola/métodos
7.
Acta Pharmacol Sin ; 45(8): 1644-1659, 2024 Aug.
Artigo em Inglês | MEDLINE | ID: mdl-38589686

RESUMO

Cardiopulmonary progenitor cells (CPPs) constitute a minor subpopulation of cells that are commonly associated with heart and lung morphogenesis during embryonic development but completely subside after birth. This fact offers the possibility for the treatment of pulmonary heart disease (PHD), in which the lung and heart are both damaged. A reliable source of CPPs is urgently needed. In this study, we reprogrammed human cardiac fibroblasts (HCFs) into CPP-like cells (or induced CPPs, iCPPs) and evaluated the therapeutic potential of iCPP-derived exosomes for acute lung injury (ALI). iCPPs were created in passage 3 primary HCFs by overexpressing GLI1, WNT2, ISL1 and TBX5 (GWIT). Exosomes were isolated from the culture medium of passage 6-8 GWIT-iCPPs. A mouse ALI model was established by intratracheal instillation of LPS. Four hours after LPS instillation, ALI mice were treated with GWIT-iCPP-derived exosomes (5 × 109, 5 × 1010 particles/mL) via intratracheal instillation. We showed that GWIT-iCPPs could differentiate into cell lineages, such as cardiomyocyte-like cells, endothelial cells, smooth muscle cells and alveolar epithelial cells, in vitro. Transcription analysis revealed that GWIT-iCPPs have potential for heart and lung development. Intratracheal instillation of iCPP-derived exosomes dose-dependently alleviated LPS-induced ALI in mice by attenuating lung inflammation, promoting endothelial function and restoring capillary endothelial cells and the epithelial cells barrier. This study provides a potential new method for the prevention and treatment of cardiopulmonary injury, especially lung injury, and provides a new cell model for drug screening.


Assuntos
Lesão Pulmonar Aguda , Exossomos , Células-Tronco , Animais , Exossomos/metabolismo , Exossomos/transplante , Lesão Pulmonar Aguda/terapia , Humanos , Camundongos , Células-Tronco/citologia , Células-Tronco/metabolismo , Fibroblastos/metabolismo , Masculino , Camundongos Endogâmicos C57BL , Diferenciação Celular , Células Cultivadas , Lipopolissacarídeos/farmacologia , Pulmão/metabolismo , Pulmão/patologia , Modelos Animais de Doenças
8.
Toxins (Basel) ; 16(3)2024 Mar 16.
Artigo em Inglês | MEDLINE | ID: mdl-38535821

RESUMO

More recently, short peptides in scorpion venom have received much attention because of their potential for drug discovery. Although various biological effects of these short peptides have been found, their studies have been hindered by the lack of structural information especially in modifications. In this study, small peptides from scorpion venom were investigated using high-performance liquid chromatography high-resolution mass spectrometry followed by de novo sequencing. A total of 156 sequences consisting of 2~12 amino acids were temporarily identified from Buthus martensii scorpion venom. The identified peptides exhibited various post-translational modifications including N-terminal and C-terminal modifications, in which the N-benzoyl modification was first found in scorpion venom. Moreover, a short peptide Bz-ARF-NH2 demonstrated both N-terminal and C-terminal modifications simultaneously, which is extremely rare in natural peptides. In conclusion, this study provides a comprehensive insight into the diversity, modifications, and potential bioactivities of short peptides in scorpion venom.


Assuntos
Aminoácidos , Animais Peçonhentos , Venenos de Escorpião , Escorpiões , Espectrometria de Massa com Cromatografia Líquida , Peptídeos
9.
Cell Prolif ; 57(5): e13593, 2024 May.
Artigo em Inglês | MEDLINE | ID: mdl-38185757

RESUMO

Ischemic heart disease, especially myocardial infarction (MI), is one of the leading causes of death worldwide, and desperately needs effective treatments, such as cell therapy. Cardiopulmonary progenitors (CPPs) are stem cells for both heart and lung, but their repairing role in damaged heart is still unknown. Here, we obtained CPPs from E9.5 mouse embryos, maintained their stemness while expanding, and identified their characteristics by scRNA-seq, flow cytometry, quantitative reverse transcription-polymerase chain reaction, and differentiation assays. Moreover, we employed mouse MI model to investigate whether CPPs could repair the injured heart. Our data identified that CPPs exhibit hybrid fibroblastic, endothelial, and mesenchymal state, and they could differentiate into cell lineages within the cardiopulmonary system. Moreover, intramyocardial injection of CPPs improves cardiac function through CPPs exosomes (CPPs-Exo) by promotion of cardiomyocytic proliferation and vascularization. To uncover the underlying mechanism, we used miRNA-seq, bulk RNA-seq, and bioinformatic approaches, and found the highly expressed miR-27b-3p in CPPs-Exo and its target gene Sik1, which can influence the transcriptional activity of CREB1. Therefore, we postulate that CPPs facilitate cardiac repair partially through the SIK1-CREB1 axis via exosomal miR-27b-3p. Our study offers a novel insight into the role of CPPs-Exo in heart repair and highlights the potential of CPPs-Exo as a promising therapeutic strategy for MI.


Assuntos
Proteína de Ligação ao Elemento de Resposta ao AMP Cíclico , Exossomos , MicroRNAs , Animais , MicroRNAs/genética , MicroRNAs/metabolismo , Exossomos/metabolismo , Camundongos , Proteína de Ligação ao Elemento de Resposta ao AMP Cíclico/metabolismo , Proteína de Ligação ao Elemento de Resposta ao AMP Cíclico/genética , Proteínas Serina-Treonina Quinases/metabolismo , Proteínas Serina-Treonina Quinases/genética , Infarto do Miocárdio/metabolismo , Infarto do Miocárdio/genética , Infarto do Miocárdio/terapia , Células-Tronco/metabolismo , Células-Tronco/citologia , Proliferação de Células , Diferenciação Celular , Pulmão/metabolismo , Camundongos Endogâmicos C57BL , Miocárdio/metabolismo , Miocárdio/citologia
10.
Anal Chem ; 95(2): 686-694, 2023 01 17.
Artigo em Inglês | MEDLINE | ID: mdl-36601728

RESUMO

To date, the extremely high polarity and poor signal intensity of macromolecular nucleic acids are greatly impeding the progress of mass spectrometry technology in the quality control of nucleic acid drugs and the characterization of DNA oxidation and RNA modifications. We recently described a general N-(tert-butyldimethylsilyl)-N-methyl-trifluoroacetamide (MTBSTFA) labeling method for oligonucleotide determination and applied it to the full-range profiling of tRNA in vitro and in vivo studies for the first time. The primary advantages of this method include strong retention, no observable byproducts, predictable and easily interpreted MS2 data, and the circumvention of instrument harmful reagents that were necessary in previous methods. Selective labeling of N-(tert-butyldimethylsilyl)-N-methyl-trifluoroacetamide to the terminal phosphate groups of oligonucleotides endows it broadly applicable for DNA/RNA profiling. Moreover, the improvement of sequence coverage was achieved in yeast tRNAphe(GAA) analysis owing to this method's good detection capability of 1-12 nucleotides in length. We also extended this strategy to determine the abundance of modified bases and discover new modifications via digesting RNA into single-nucleotide products, promoting the comprehensive mapping of RNA. The easy availability of derivatization reagent and the simple, rapid one-step reaction render it easy to operate for researchers. When applied in characterizing tRNAs in HepG2 cells and rats with nonalcoholic fatty liver disease, a fragment of U[m1G][m2G], specific for tRNAAsn(QUU) in cells, was significantly upregulated, indicating a possible clue to nonalcoholic fatty liver disease pathogenesis.


Assuntos
Hepatopatia Gordurosa não Alcoólica , Ácidos Nucleicos , Animais , Ratos , Oligonucleotídeos , RNA , RNA de Transferência , Nucleotídeos
11.
Mitochondrial DNA B Resour ; 7(8): 1519-1521, 2022.
Artigo em Inglês | MEDLINE | ID: mdl-36034534

RESUMO

Agave amaniensis Trel. & W. Nowell (1933) has long been used for phytosteroid production, which is also one of the parents of the famous Agave hybrid cultivar 11648 for sisal fiber production. However, its systematic position and phylogenetic relationship remains unknown at the chloroplast (cp) genome level. Therefore, we have sequenced and assembled the cp genome of A. amaniensis via Illumina sequencing. The cp genome is 157,282 bp in length with a GC content of 37.84%. A large single-copy region of 85,899 bp, a small single-copy region of 18,233 bp, and inverted repeat regions of 26,575 bp were found in the cp genome. Based on the annotation, 86 protein-coding genes, eight rRNAs, and 38 tRNAs were identified in the cp genome with total lengths of 78,981 bp, 9050 bp, and 2867 bp, respectively. The phylogenetic tree indicates that A. amaniensis is closely related with A. H11648, A. angustifolia, and A. americana.

12.
Mol Nutr Food Res ; 66(11): e2100963, 2022 06.
Artigo em Inglês | MEDLINE | ID: mdl-35332659

RESUMO

SCOPE: Glutamate (Glu) and γ-aminobutyric acid (GABA) are the major excitatory and inhibitory neurotransmitters that control information flow in the brain. GABA dysfunction is a general vulnerability factor for mental illness. Cinnamaldehyde (CA) is found to have sedation in a mental illness model. However, the specific targets and molecular mechanisms related to the sedative effects of CA have not been elucidated. METHODS AND RESULTS: Metabolomics analysis and target fishing showed CA could increase the expression of GABA in vivo, and α-enolase (ENO1) is the primary target protein of CA associated with sedation. CA mainly binds with ENO1 in the cerebellar granular layer of brain, which influences the first transformations of the input signals arriving in the cerebellar cortex. The α,ß-unsaturated aldehyde group of CA blocks the hydroxy group of Ser40, which induces a loss in ENO1 activation. CA also disturbs the glycolysis pathway and influences the tricarboxylic acid cycle and oxidative phosphorylation, which activate gluconeogenesis to provide energy to the brain. This mechanism is verified in zebrafish with ENO1 or glutamic acid decarboxylase (GAD) deficiency. CONCLUSIONS: CA demonstrates sedation and alleviates GABA dysfunction via covalent binding ENO1, which shows the potential to improve the therapy of mental illness.


Assuntos
Peixe-Zebra , Ácido gama-Aminobutírico , Acroleína/análogos & derivados , Animais , Glutamato Descarboxilase/metabolismo , Fosfopiruvato Hidratase/genética , Fosfopiruvato Hidratase/metabolismo , Peixe-Zebra/metabolismo , Ácido gama-Aminobutírico/metabolismo , Ácido gama-Aminobutírico/farmacologia
13.
Plant Dis ; 2022 Mar 09.
Artigo em Inglês | MEDLINE | ID: mdl-35263157

RESUMO

Gynostemma pentaphyllum, belonging to Cucurbitaceae, is a herbaceous climbing plant with multiple medicinal values (Li et al., 2019). It has been planted in Pingli County (109.35 E, 32.39 N), Ankang, Shaanxi province, China for a long history with more than 3000 ha per year. In April 2021, typical root-knot nematode disease symptoms, stunting and galled roots with massive egg masses, were observed on local G. pentaphyllum plants in several gardens. Meloidogyne females and egg masses were dissected from the infected roots. The female was spherical in body shape with a project neck; the excretory pore was at level of or posterior to stylet knobs, 10-20 annules behind head; the perineal pattern had a high dorsal arch, sometimes square or trapezoidal in shape, without obvious lateral lines. The male head was not offset with body, head cap was of stepped outline and concaved at center of top end in lateral view; stylet knobs were prominent, usually demarcated from shaft. Morphological measurements of females (n=20) were: body length (L)= 851.78 ± 83.55 µm (700.15 µm to 986.48 µm); maximum body width (W)= 633.11 ± 71.69 µm (453.09 µm to 746.31 µm); stylet length (ST)= 14.81 ± 0.69 µm (13.31 µm to 15.76 µm); stylet knob height (STKH)= 1.54 ± 0.09 µm (1.45 µm to 1.81 µm); stylet knob width (STKW)= 3.61 ± 0.11 µm (3.38 µm to 3.87 µm); and distance from dorsal esophageal gland opening to the stylet (DGO)= 3.56 ± 0.13 µm (3.28 µm to 4.90 µm). Measurements of males (n=20) were: L=1756.96 ± 67.81 µm (1643.58 µm to 1862.14 µm); W=55.37 ± 1.28 µm (53.46 µm to 57.66 µm); ST= 22.75 ± 1.05µm (19.14 µm to 24.88 µm); STKH= 2.59 ± 0.14 µm (2.45 µm to 2.72 µm); STKW= 3.66 ± 0.13 µm (3.27 µm to 3.91 µm); and DGO= 3.52 ± 0.18 µm (3.38 µm to 4.72 µm). Measurements of second-stage juveniles (J2) (n=20) were: L= 418.99 ± 22.04 µm (376.89 µm to 450.66 µm); W= 14.77 ± 1.15 µm (13.03 µm to 17.77 µm); ST= 12.84 ± 0.45µm (12.05 µm to 13.75 µm); STKH= 1.44 ± 0.13 µm (1.14 µm to 1.71 µm); STKW= 2.25 ± 0.23 µm (1.81 µm to 2.76 µm); and DGO= 1.81 ± 0.31 µm (0.38 µm to 2.56 µm). The morphological characteristics of this nematode were consistent with Meloidogyne incognita (Kofoid and White, 1919) Chitwood, 1949 (Williams, 1973; Eisenback and Hirschmann, 1981). Identification was further confirmed with DNA extracted from 20 individual females. Part of the rDNA spanning internal transcribed spacer (ITS) 1, 5.8S gene, and ITS2 was amplified with the pair of primers: rDNA-F/R (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (Vrain et al., 1992). A 768 bp fragment (GenBank Accession No. MZ613806) was obtained, showing 100% identical (768 bp to 768 bp) to the known sequences of M. incognita (GenBank Accession Nos. MH113856, KC464469, and MT921010). Species identification was also confirmed by amplifying part of the NADH dehydrogenase subunit 5 (nad5) from mitochondrial DNA with primers: NAD5-F/R (TATTTTTTGTTTGAGATATATTAG/CGTGAATCTTGATTTTCCATTTTT) (Janssen et al., 2016). The resulting 611 bp fragment was deposited in GenBank with Accession No. MZ613807. The fragment showed a highest identity of 99.67% (601 bp out of 611 bp) with sequences from other M. incognita isolates (GenBank Accession Nos. MW759707, MW759706, MW759705). Based on both morphological and molecular data, the root-knot nematode from G. pentaphyllum was identified as M. incognita. A pathogenicity test was carried out by inoculating 1500 J2 hatched from the egg masses dissected from the diseased roots to a 4-weeks-old healthy G. pentaphyllum seedling cultured in sterilized sandy soil in pot, 15 plants were inoculated and 5 non-inoculated plants served as controls. After maintained at 25°C for 6 weeks, all of the inoculated plant roots showed galling symptoms which were similar to those observed in the field. Nematodes were collected from root and soil, and an average reproduction factor value of 3.51 was obtained. While no galls were observed on the control plants. For further confirmation, all egg masses dissected from inoculated plants were identified to be M. incognita with its sequence specific primers Mi-F/Mi-R (GGGCAAGTAAGGATGCTCTGAC/CTTTCATAGCCACGTCGCGATC) (Ray et al., 1994). In this study, G. pentaphyllum has been identified as a new host of M. incognita, hence the occurrence status and control of root-knot disease on G. pentaphyllum caused by this pathogen would be new problems in production and need further study.

14.
Sheng Wu Gong Cheng Xue Bao ; 37(8): 2836-2844, 2021 Aug 25.
Artigo em Chinês | MEDLINE | ID: mdl-34472301

RESUMO

It has been reported that ODB genes play an important role in homologous recombination-directed DNA repair, suggesting their potential applications in plant breeding. To analyze the expression characteristics of tobacco NtODB gene, the cDNA sequence of NtODB was obtained using in silico cloning technique. The physicochemical properties, signal peptide, and advanced structures of the predicted protein were analyzed using bioinformatics tools. The results showed that the NtODB gene has a 579-bp open reading frame which encodes a protein with 192 amino acid residues. The protein NtODB is predicted to be alkaline and hydrophilic. Real-time quantitative PCR showed that NtODB was constitutively expressed in different tissues. Subcellular localization showed that NtODB was mainly expressed in cell membrane and chloroplast. These results may help us to better understand and elucidate the roles of ODB genes in the homologous recombination-directed DNA repair.


Assuntos
Biologia Computacional , Nicotiana , Sequência de Aminoácidos , Sequência de Bases , Clonagem Molecular , Simulação por Computador , DNA Complementar , Filogenia , Melhoramento Vegetal , Nicotiana/genética
15.
Plant Dis ; 105(10): 2990-2999, 2021 Oct.
Artigo em Inglês | MEDLINE | ID: mdl-33728956

RESUMO

Crown rust of barley, caused by Puccinia coronata var. hordei, was first reported by Jin and Steffenson in 1992, and the fungus has been reported only in the United States and Hungary. In China, stripe, stem, and leaf rusts have been reported on barley, but not for crown rust. Recently, a sample (HZJ0004) of rust collected from barley in Qilian county in Qinghai, China, appeared different from the three rusts based on color, size, arrangements of uredinia and/or telia. Teliospores had crown-shaped appendages on the top. Based on the disease symptoms and morphology of urediniospores and teliospores, the fungus was identified as P. coronata var. hordei. Using the internal transcribed spacer sequences, the isolates HZJ0004 from barley and POR3 from buckthorn (Rhamnus sp.) were clustered in one clade with P. coronata var. hordei isolates from barley and Elymus repens but in a different clade from the isolate POC8 from wild oat and the varieties of P. coronata from oats and grasses. At the seedling stage, most of the tested cultivars of barley and rye were susceptible to P. coronata var. hordei isolates HZJ0004 and POR3, but the cultivars of oats, triticale, wheat, and most grasses of genera Aegilops, Brachypodium, Bromus, Calamagrostis, Deschampsia, Elymus, Festuca, and Phleum were resistant, indicating their host specialization on barley. To our knowledge, this is the first report of crown rust on barley in China.


Assuntos
Hordeum , Doenças das Plantas/microbiologia , Puccinia/patogenicidade , Hordeum/microbiologia , Estados Unidos
16.
Nat Prod Res ; 35(6): 921-929, 2021 Mar.
Artigo em Inglês | MEDLINE | ID: mdl-31148468

RESUMO

Chemical investigation of Jasminum pentaneurum Hand.-Mazz led to the isolation and identification of 12 compounds, which included one new secoiridoid glycoside, 10-(3-hydroxy-4-methoxy-benzoate)-ligustroside (4), three secoiridoid glycosides (1-3), and eight phenols (5-12). All compounds were reported for the first time from this plant. Their structures were elucidated based on extensive spectroscopic data analysis, including HR-ESI-MS, UV, IR, 1 D, and 2 D NMR. The absolute configuration of the new one (4) was further elucidated by comparison of its experimental and calculated quantum chemical electronic circular dichroism (ECD) spectra. All the isolates were assayed for their inhibitory activity on four human cancer cells. Compound 11 exhibited inhibitory effects against three human cancer cells SK-MES-1, SMMC-7721 and SGC-7901 with IC50 values ranging from 83.0 to 172.0 µM.


Assuntos
Jasminum/química , Neoplasias/patologia , Compostos Fitoquímicos/farmacologia , Espectroscopia de Ressonância Magnética Nuclear de Carbono-13 , Morte Celular/efeitos dos fármacos , Linhagem Celular Tumoral , Humanos , Concentração Inibidora 50 , Compostos Fitoquímicos/química , Compostos Fitoquímicos/isolamento & purificação , Espectroscopia de Prótons por Ressonância Magnética
17.
BMC Infect Dis ; 20(1): 650, 2020 Sep 04.
Artigo em Inglês | MEDLINE | ID: mdl-32887568

RESUMO

BACKGROUND: Cryptococcus is a conditional pathogenic fungus causing cryptococcosis, which is one of the most serious fungal diseases faced by humans. Lateral flow immunochromatographic assay (LFA) is successfully applied to the rapid detection of cryptococcal antigens. METHODS: Studies were retrieved systematically from the Embase, PubMed, Web of Science, and Cochrane Library before July 2019. The quality of the studies was assessed by Review Manager 5.0 based on the Quality Assessment of Diagnostic Accuracy Study guidelines. The extracted data from the included studies were analyzed by Meta-DiSc 1.4. Stata 12.0 software was used to detect the publication bias. RESULTS: A total of 15 articles with 31 fourfold tables were adopted by inclusion and exclusion criteria. The merged sensitivity and specificity in serum were 0.98 and 0.98, respectively, and those in the cerebrospinal fluid were 0.99 and 0.99, respectively. CONCLUSIONS: Compared to the urine and other samples, LFA in serum and cerebrospinal fluid is favorable evidence for the diagnosis of cryptococcosis with high specificity and sensitivity.


Assuntos
Criptococose/diagnóstico , Imunoensaio/métodos , Antígenos de Fungos/sangue , Antígenos de Fungos/líquido cefalorraquidiano , Antígenos de Fungos/urina , Líquido Cefalorraquidiano/microbiologia , Testes Diagnósticos de Rotina/métodos , Humanos , Sensibilidade e Especificidade
18.
J Anal Methods Chem ; 2020: 5165631, 2020.
Artigo em Inglês | MEDLINE | ID: mdl-32351755

RESUMO

Yizhi Granule (YZG) is a health food containing six traditional Chinese medicines (TCMs). It improves memory barriers in rat experiments. Here, we describe the first fast and sensitive ultraperformance liquid chromatography/electrospray ionization quadrupole time-of-flight mass spectrometry (UPLC/ESI-Q-TOF MS) method for analyzing YZG in plasma. We used this technique for studies in cynomolgus monkey plasma. By comparing retention time, MS, and MS/MS data of reference compounds, 70 compounds were detected in YZG. Of these, 63 were identified including 60 saponins, 2 flavones, and 1 methyl ester. There were 33 saponins, 1 flavone, and 1 methyl ester in the plasma. Next, to study the therapeutic properties of YZG, the neuroprotective effect of some of the absorbed components was evaluated using PC12 cell damage caused by the Aß 25-35 model. The results showed that 9 compounds protect PC12 cells from Aß 25-35 with cell viability (%) of 111.00 ± 8.12 (G-Rb1), 102.20 ± 4.22 (G-Rb2), 100.34 ± 6.47 (G-Rd), 102.83 ± 2.10 (G-Re), 101.68 ± 7.64 (NG-Fa), 101.19 ± 7.83 (NG-R1), 102.53 ± 0.55 (NG-R2), 106.88 ± 4.95 (gypenoside A), and 103.95 ± 4.11 (gypenoside XLIX), respectively, versus the control group (87.51 ± 6.59). These results can reveal the real pharmacodynamic basis of YZG and provide a theoretical basis for subsequent studies. It can also provide some references for the research of Alzheimer's disease.

19.
BMC Cell Biol ; 6(1): 9, 2005 Mar 03.
Artigo em Inglês | MEDLINE | ID: mdl-15743539

RESUMO

BACKGROUND: In this paper, we present and validate a way to measure automatically the extent of cell migration based on automated examination of a series of digital photographs. It was designed specifically to identify the impact of Second Hand Smoke (SHS) on endothelial cell migration but has broader applications. The analysis has two stages: (1) preprocessing of image texture, and (2) migration analysis. RESULTS: The output is a graphic overlay that indicates the front lines of cell migration superimposed on each original image, with automated reporting of the distance traversed vs. time. Expert preference compares to manual placement of leading edge shows complete equivalence of automated vs. manual leading edge definition for cell migration measurement. CONCLUSION: Our method is indistinguishable from careful manual determinations of cell front lines, with the advantages of full automation, objectivity, and speed.


Assuntos
Movimento Celular , Técnicas Citológicas/métodos , Automação , Técnicas Citológicas/normas , Células Endoteliais/citologia , Humanos , Métodos , Fotografação , Reprodutibilidade dos Testes , Fumaça/efeitos adversos
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA