An Ochratoxin a DNA Aptamer-Mediated Transcriptional Regulatory Riboswitch Biosensor.

This study developed a transcriptional regulation riboswitch biosensing analytical method based on the Ochratoxin A (OTA) DNA aptamer programming design. OTA DNA aptamer was used to develop artificial riboswitch, a strategy that relies on a simple combination of single-stranded DNA (ssDNA) template with oligonucleotides that base pair only in the -17 to +1 region to define promoter elements. The OTA DNA aptamer sequence GATCGGGTTGGGTGGCGTAAAGGGAGCATCGG (1.12.8) has a typical antiparallel G-quadruplex structure, and the presence of OTA will further stabilize this structure. Based on this property, OTA DNA aptamer can be used to construct riboswitch and potentially transcriptionally regulate gene expression. To further increase the impact of OTA-binding aptamer on the structure, an ssDNA template was prepared based on the rolling circle replication mechanism of the helper phage M13K07. This ssDNA was used in the cell-free expression system to inhibit the expression of the downstream reporter gene colorimetric enzyme catechol (2,3)-dioxygenase (C23DO) in the presence of OTA. C23DO was used to catalyze the substrate catechol to produce a colorimetric output. This study broadens the potential of artificial riboswitch as practical biosensing module tools and contributes to the development of simple, rapid, field-deployable analytical methods with broad application prospects for field placement testing.

Dual pH- and ATP-Responsive Antibacterial Nanospray: On-Demand Release of Antibacterial Factors, Imaging Monitoring, and Accelerated Healing of Bacteria-Infected Wounds under NIR Activation.

The prevalence of pathogenic bacterial infections with high morbidity and mortality poses a widespread challenge to the healthcare system. Therefore, it is imperative to develop nanoformulations capable of adaptively releasing antimicrobial factors and demonstrating multimodal synergistic antimicrobial activity. Herein, an NIR-activated multifunctional synergistic antimicrobial nanospray MXene/ZIF-90@ICG was prepared by incorporating ZIF-90@ICG nanoparticles onto MXene-NH2 nanosheets. MXene/ZIF-90@ICG can on-demand release the antimicrobial factors MXenes, ICG, and Zn2+ in response to variations in pH and ATP levels within the bacterial infection microenvironment. Under NIR radiation, the combination of MXenes, Zn2+, and ICG generated a significant amount of ROS and elevated heat, thereby enhancing the antimicrobial efficacy of PDT and PTT. Meanwhile, NIR excitation could accelerate the further release of ICG and Zn2+, realizing the multimodal synergistic antibacterial effect of PDT/PTT/Zn2+. Notably, introducing MXenes improved the dispersion of the synthesized antimicrobial nanoparticles in aqueous solution, rendering MXene/ZIF-90@ICG a candidate for application as a nanospray. Importantly, MXene/ZIF-90@ICG demonstrated antimicrobial activity and accelerated wound healing in the constructed in vivo subcutaneous Staphylococcus aureus infection model with NIR activation, maintaining a favorable biosafety level. Therefore, MXene/ZIF-90@ICG holds promise as an innovative nanospray for adaptive multimodal synergistic and efficient antibacterial applications with NIR activation.

Aptamer-modified paper-based analytical devices for the detection of food hazards: Emerging applications and future perspective.

Food analysis plays a critical role in assessing human health risks and monitoring food quality and safety. Currently, there is a pressing need for a reliable, portable, and quick recognition element for point-of-care testing (POCT) to better serve the demands of on-site food analysis. Aptamer-modified paper-based analytical devices (Apt-PADs) have excellent characteristics of high portability, high sensitivity, high specificity, and on-site detection, which have been widely used and concerned in the field of food safety. The article reviews the basic components and working principles of Apt-PADs, and introduces their representative applications detecting food hazards. Finally, the advantages, challenges, and future directions of Apt-PADs-based sensing performance are discussed, to provide new directions and insights for researchers to select appropriate Apt-PADs according to specific applications.

A fluorescent nanoprobe and paper-based nanofiber platform for detection and imaging of Fe3+ in actual samples and living cells.

In this study, a novel fluorescent nanoprobe (ZIF-90@FSS) was constructed using a zeolite imidazolium ester skeleton (ZIF-90) incorporating sodium fluorescein within its porous structure. Notably, this nanoprobe exhibited regular fluorescence "off" detection performance of Fe3+ in actual samples and living cells. The concentration range of 0-150 ng/mL exhibited a lowest detection limit of 0.26 ng/mL. A nanofiber paper-based platform (VL78/ZIF-90@FSS) was further developed by coupling the prepared nanoprobe to a multi-dimensional fiber paper via CN bonds, enabling rapid visual white light colorimetric and fluorescence imaging of Fe3+ within 2 min. The constructed nanoprobe and its paper-based detection platforms demonstrated a stable recovery range in tap water, beer, and soy sauce samples during spiking-recovery assessments. The recovery rates ranged from 98.46 % to 108.24 % for the nanoprobe and from 91.75 % to 108.71 % for the nanofiber paper-based platform. Therefore, the developed nano-fluorescent sensor and paper-based nanofiber sensing platform offer a promising strategy for the visual detection of Fe3+, while also presenting novel and valuable methods to investigate the regulatory mechanisms of Fe3+ in living cells.

Real-time carotid plaque recognition from dynamic ultrasound videos based on artificial neural network.

PURPOSE: Carotid ultrasound allows noninvasive assessment of vascular anatomy and function with real-time display. Based on the transfer learning method, a series of research results have been obtained on the optimal image recognition and analysis of static images. However, for carotid plaque recognition, there are high requirements for self-developed algorithms in real-time ultrasound detection. This study aims to establish an automatic recognition system, Be Easy to Use (BETU), for the real-time and synchronous diagnosis of carotid plaque from ultrasound videos based on an artificial neural network. MATERIALS AND METHODS: 445 participants (mean age, 54.6±7.8 years; 227 men) were evaluated. Radiologists labeled a total of 3259 segmented ultrasound images from 445 videos with the diagnosis of carotid plaque, 2725 images were collected as a training dataset, and 554 images as a testing dataset. The automatic plaque recognition system BETU was established based on an artificial neural network, and remote application on a 5G environment was performed to test its diagnostic performance. RESULTS: The diagnostic accuracy of BETU (98.5%) was consistent with the radiologist's (Kappa = 0.967, P < 0.001). Remote diagnostic feedback based on BETU-processed ultrasound videos could be obtained in 150ms across a distance of 1023 km between the ultrasound/BETU station and the consultation workstation. CONCLUSION: Based on the good performance of BETU in real-time plaque recognition from ultrasound videos, 5G plus Artificial intelligence (AI)-assisted ultrasound real-time carotid plaque screening was achieved, and the diagnosis was made.

A novel ternary Y-DNA walker amplification strategy designed fluorescence aptasensor based on Au@SiO2@Fe3O4 nanomaterials for ochratoxin A detection.

A novel ternary Y-DNA walker amplification strategy designed fluorescence aptasensor based on Au@SiO2@Fe3O4 nanomaterials for ultrasensitive and specific ochratoxin A detection in food samples is presented. Au@SiO2@Fe3O4 nanomaterials provide the loading platform as well as separation and recovery properties for the ternary Y-DNA walker. The ternary Y-DNA walker is designed to be driven by Nb.BbvCI cleaving a large number of FAM probes to achieve signal amplification. Since Ochratoxin A (OTA) can bind to the constituent aptamer in the ternary Y-DNA walker, adding OTA will destroy the structure of the ternary Y-DNA walker, thereby inhibiting the driving process of the walker. After optimization of various parameters, a standard curve was obtained from 100 to 0.05 ng·mL-1 of OTA with the limit of determination of 0.027 ng·mL-1. The spiked recovery of peanut samples by this method was 82.00-93.30%, and the aptasensor showed excellent specificity and long-term stability. This simple, robust, and scalable oligonucleotide chain-based ternary Y-DNA walker can provide a general signal amplification strategy for trace analysis.

Universal Near-Infrared Fluorescent Nanoprobes for Detection and Real-Time Imaging of ATP in Real Food Samples, Living Cells, and Bacteria.

Adenosine triphosphate (ATP), an essential metabolite for active microorganisms to maintain life activities, has been widely regarded as a marker of cell activity and an indicator of microbial contamination. Herein, we designed two near-infrared (NIR) fluorescent nanoprobes named CYA@ZIF-90 and CYQ@ZIF-90 by encapsulating the NIR dye CYA/CYQ in ZIF-90 for the rapid detection of ATP. Between them, nanoprobe CYA@ZIF-90 can achieve higher NIR emission (702 nm) and rapid detection (2 min). Based on the superior spatiotemporal resolution imaging of ATP fluctuations in living cells, the applicability of CYA@ZIF-90 for imaging and detection of ATP in living bacteria was explored for the first time. The nanoprobe indirectly realizes the quantitative detection of bacteria, and the detection limit can be as low as 74 CFU mL-1. Therefore, the prepared nanoprobe is expected to become a universal ATP sensing detection tool, which can be further applied to evaluate cell apoptosis, cell proliferation, and food-harmful microbial control.

Concatenated dynamic DNA network modulated SERS aptasensor based on gold-magnetic nanochains and Au@Ag nanoparticles for enzyme-free amplification analysis of tetracycline.

Tetracycline (TC) poses a great threat to food and environmental safety due to its misuse in animal husbandry and aquaculture. Therefore, an efficient analytical method is needed for the detection of TC to prevent possible hazards. Herein, a cascade amplification SERS aptasensor for sensitive determination of TC was constructed based on aptamer, enzyme-free DNA circuits, and SERS technology. The capture probe and signal probe were obtained by binding DNA hairpins H1 and H2 to the prepared Fe3O4@hollow-TiO2/Au nanochains (Fe3O4@h-TiO2/Au NCs) and Au@4-MBA@Ag nanoparticles, respectively. The dual amplification of EDC-CHA circuits significantly facilitated the sensitivity of the aptasensor. Additionally, the introduction of Fe3O4 simplified the operation of the sensing platform due to its superb magnetic capability. Under optimal conditions, the developed aptasensor exhibited a distinct linear response to TC with a low limit of detection of 15.91 pg mL-1. Furthermore, the proposed cascaded amplification sensing strategy exhibited excellent specificity and storage stability, and its practicability and reliability were verified by TC detection of real samples. This study provides a promising idea for the development of specific and sensitive signal amplification analysis platforms in the field of food safety.

Broad-Spectrum Detection of Tetracyclines by Riboswitch-Based Cell-Free Expression Biosensing.

We describe a sensitive and selective method for the determination of tetracycline content in foods using a riboswitch sensor. The sensor is based on a cell-free expression system that can be lyophilized to produce paper-based sensors or tube-based sensors for long-term storage. The riboswitch constructed using artificially screened tetracycline RNA aptamers was cloned into the pET-28a(+) vector of Escherichia coli TOP 10. The expression of the green fluorescent protein was positively correlated with the concentration of tetracyclines. The binding of tetracyclines to the aptamer domain results in a conformational change in the riboswitch secondary structure, resulting in the exposure of the ribosome binding site thereby promoting expression. The detection limits of the prepared sensor for the detection of tetracycline, oxytetracycline, chlortetracycline, and doxycycline were 0.47, 0.079, 0.084, and 0.43 µM, respectively. Moreover, the 1 µM tetracyclines allow for qualitative detection in milk samples by the naked eye. The work provides a proof-of-principle for riboswitch design to address global health and food safety.

Feasibility and Safety of Dual-console Telesurgery with the KangDuo Surgical Robot-01 System Using Fifth-generation and Wired Networks: An Animal Experiment and Clinical Study.

The coronavirus disease 2019 pandemic has drawn attention to telesurgery. Important advances in fifth-generation (5G) mobile telecommunication technology have facilitated the rapid evolution of telesurgery. Previously, only a single console was used in telesurgery; thus, there was the possibility of open or laparoscopic conversion. Furthermore, the 5G network has not been available for regional hospitals in China. From October 2021 to April 2022, dual-console telesurgeries with the KangDuo Surgical Robot-01 (KD-SR-01) system were performed using 5G and wired networks in an animal experiment and clinical study. A partial nephrectomy in a porcine model was performed successfully using a wired network. The console time, warm ischemia time, and control swap time were 69 min, 27 min, and 3 s, respectively. The mean latency time was 130 (range, 60-200) ms. A 32-yr-old male patient successfully underwent a remote pyeloplasty using a series connection of 5G wireless and wired networks. The console time and control swap time were 98 min and 3 s, respectively. The mean latency time was 271 (range, 206-307) ms. In the two studies, data pocket loss was <1%. The results demonstrated that dual-console telesurgery with the KD-SR-01 system is feasible and safe using 5G and wired networks. Patient summary: Advances in fifth-generation (5G) mobile telecommunication technology helped in the rapid evolution of telesurgery. Dual-console telesurgery performed with the KD-SR-01 system using 5G and wired networks was shown to be feasible and safe in an animal experiment and clinical study.

Colorimetric aptasensor for fumonisin B1 detection based on the DNA tetrahedra-functionalized magnetic beads and DNA hydrogel-coated bimetallic MOFzyme.

The toxicity and incidence of fumonisin B1 (FB1) pose a major challenge to public health and the environment, prompting the development of alternative quantitative strategies for FB1. Herein, a colorimetric aptasensor was constructed based on DNA tetrahedra-functionalized magnetic beads (MBs) and DNA hydrogel-coated Mn-Zr bimetallic metal-organic frameworks-based nanozyme (MOFzyme). Initially, MBs functionalized by DNA tetrahedra demonstrated excellent capturing capability for FB1. Along with the capture of FB1, catalyst DNA (C) was released into the supernatant. Aided by fuel DNA (F), C can trigger continuous cleavage of the main chains and cross-linking points of the DNA hydrogel through an entropy-driven DNA circuit integrated into the hydrogel coating. Subsequently, the bimetallic MOFzyme encapsulated inside the DNA hydrogel was exposed and exerted its superb peroxidase-like activity, producing a colorimetric signal whose intensity was positively dependent on the amount of FB1. The developed aptasensor exhibited good linearity in the range of 5 × 10-4 to 50 ng mL-1 with a limit of detection (LOD) of 0.38 pg mL-1, and reasonable specificity in different matrices. Furthermore, the aptasensor was successfully applied to quantify FB1 in actual samples with recoveries fell within 92.25 %- 108.00 %, showing its great potential in environmental monitoring and food safety.

A novel biomimetic network amplification strategy designed fluorescent aptasensor based on yolk-shell Fe3O4 nanomaterials for aflatoxin B1 detection.

In this study, yolk-shell Fe3O4-based nanomaterials designing of fluorescent aptasensor using a new type of biomimetic network-constitutional dynamic networks (CDNs) amplification strategy was developed for aflatoxin B1 (AFB1) detection. By ingeniously designing the base sequences A, a, B, b, and coupling with endonuclease (BbvCI), a constitutes of CDNs is formed as a fluorescence intensity amplifier. With such design, the as- prepared aptasensor exhibits good sensitivity from 50 fg·mL-1-50 ng·mL-1 with a detection limit of 35.94 fg·mL-1. Moreover, the CDNs can achieve 1000-fold amplification in terms of linear range and detection limit. The results confirmed that this new type of biomimetic network amplification strategy can supply-one efficient approach to improve signal amplification. Furthermore, the prepared aptamer sensor was tested for spiked recovery in peanut samples, and the recoveries ranged from 83.79 to 95.06 %, which has confirmed its practical application value in the field of food safety.

A Low-Latency RDP-CORDIC Algorithm for Real-Time Signal Processing of Edge Computing Devices in Smart Grid Cyber-Physical Systems.

Smart grids are being expanded in scale with the increasing complexity of the equipment. Edge computing is gradually replacing conventional cloud computing due to its low latency, low power consumption, and high reliability. The CORDIC algorithm has the characteristics of high-speed real-time processing and is very suitable for hardware accelerators in edge computing devices. The iterative calculation method of the CORDIC algorithm yet leads to problems such as complex structure and high consumption of hardware resource. In this paper, we propose an RDP-CORDIC algorithm which pre-computes all micro-rotation directions and transforms the conventional single-stage iterative structure into a three-stage and multi-stage combined iterative structure, thereby enabling it to solve the problems of the conventional CORDIC algorithm with many iterations and high consumption. An accuracy compensation algorithm for the direction prediction constant is also proposed to solve the problem of high ROM consumption in the high precision implementation of the RDP-CORDIC algorithm. The experimental results showed that the RDP-CORDIC algorithm had faster computation speed and lower resource consumption with higher guaranteed accuracy than other CORDIC algorithms. Therefore, the RDP-CORDIC algorithm proposed in this paper may effectively increase computation performance while reducing the power and resource consumption of edge computing devices in smart grid systems.

Deep learning phase-unwrapping method based on adaptive noise evaluation.

To address the problem of phase unwrapping for interferograms, a deep learning (DL) phase-unwrapping method based on adaptive noise evaluation is proposed to retrieve the unwrapped phase from the wrapped phase. First, this method uses a UNet3+ as the skeleton and combines with a residual neural network to build a network model suitable for unwrapping wrapped fringe patterns. Second, an adaptive noise level evaluation system for interferograms is designed to estimate the noise level of the interferograms by integrating phase quality maps and phase residues of the interferograms. Then, multiple training datasets with different noise levels are used to train the DL network to achieve the trained networks suitable for unwrapping interferograms with different noise levels. Finally, the interferograms are unwrapped by the trained networks with the same noise levels as the interferograms to be unwrapped. The results with simulated and experimental interferograms demonstrate that the proposed networks can obtain the popular unwrapped phase from the wrapped phase with different noise levels and show good robustness in the experiments of phase unwrapping for different types of fringe patterns.

Colorimetric aptasensor targeting zearalenone developed based on the hyaluronic Acid-DNA hydrogel and bimetallic MOFzyme.

Zearalenone (ZEN) is a widespread nonsteroidal mycotoxin with estrogen-like activity. Sensitive and reliable quantification of ZEN in food is critical to ensure food safety and safeguard agricultural production. Herein, by combining the metal-organic frameworks-based nanozyme (MOFzyme) and hyaluronic acid (HA)-DNA hydrogel, a well-designed colorimetric aptasensor was developed. The HA-DNA hydrogel was deposited on the surface of the bimetallic MOFzyme via strand-induced hybridization chain reaction (HCR). Relying on the ZEN-specific aptamer integrated in hydrogel structure, the disintegration of the hydrogel network and the concomitant exposure of the encapsulated MOFzyme could be specifically triggered by the introduction of ZEN molecules. Moreover, the magnitude of hydrogel disintegration was positively correlated with the amount of ZEN, by which the quantification of ZEN can be effortlessly achieved. Benefiting from the delicate design, the satisfactory catalytic performance and stability of bimetallic MOFzyme and the appealing stimuli-responsiveness of DNA hydrogel, the developed aptasensor demonstrated superior analytical performance and ease of use. Under optimal conditions, the linear range of the aptasensor fell between 0.001 and 200 ng mL-1 with a limit of detection (LOD) of 0.8 pg mL-1. Furthermore, the aptasensor was successfully applied for the quantitative detection of ZEN in corn and soybean samples with recoveries ranging from 94.0% to 109.0%. The developed aptasensor is expected to be a prospective universal platform for accurately quantifying food or environmental hazards.

Application of 5G Technology to Conduct Real-Time Teleretinal Laser Photocoagulation for the Treatment of Diabetic Retinopathy.

Importance: Interest in teleophthalmology has been growing, especially during the COVID-19 pandemic. The advent of fifth-generation (5G) wireless systems has the potential to revolutionize teleophthalmology, but these systems have not previously been leveraged to conduct therapeutic telemedicine in the ophthalmology field. Objective: To assess the feasibility of 5G real-time laser photocoagulation as a telemedicine-based treatment for diabetic retinopathy (DR). Design, Setting, and Participants: This was a prospective study involving a retinal specialist from the Peking Union Medical College Hospital in Beijing, China, who performed online 5G real-time navigated retinal laser photocoagulation to treat participants with proliferative or severe nonproliferative DR who had been recruited in the Huzhou First People's Hospital in Zhejiang Province, China, located 1200 km from Beijing from October 2019 to July 2020. Interventions: These teleretinal DR and laser management procedures were conducted using a teleophthalmology platform that used the videoconference platform for teleconsultation, after which telelaser planning and intervention were conducted with a laser system and a platform for remote computer control, which were connected via 5G networks. Main Outcomes and Measures: Diabetic eye prognosis and the real-time laser therapy transmission speed were evaluated. Results: A total of 6 participants (9 eyes) were included. Six eyes were treated via panretinal photocoagulation alone, while 1 eye underwent focal/grid photocoagulation and 2 eyes underwent both panretinal photocoagulation and focal/grid photocoagulation. The mean (SD) age was 53.7 (13.6) years (range, 32-67 years). The mean (SD) duration of diabetes was 14.3 (6.4) years (range, 3-20 years). The mean (SD) logMAR at baseline was 0.32 (0.20) (20/30 Snellen equivalent). Retinal telephotocoagulation operations were performed on all eyes without any noticeable delay during treatment. The mean (SD) number of panretinal photocoagulation laser spots per eye in 1 session was 913 (243). Conclusions and Relevance: This study introduces a novel teleophthalmology paradigm to treat DR at a distance. Applying novel technologies may continue to ensure that remote patients with DR and other conditions have access to essential health care. Further studies will be needed to compare this approach with the current standard of care to determine whether visual acuity or safety outcomes differ.

[Suitability of Internet Medical Services of Hospitals from the Perspective of Suppliers].

Objective To investigate the suitable services of telemedicine at present and the future from the perspective of medical service supplier,clarify the challenges in the development of telemedicine services at present,and provide evidence-based suggestions for improving the quality of telemedicine services. Methods A questionnaire was developed through literature review for the survey of telemedicine services from the perspective of service providers.From January to June in 2020,electronic questionnaires were collected from volunteers.The data were collated and analyzed by Excel 2010 and SPSS 21.0. Results A total of 614 questionnaires were distributed,and 582 effective questionnaires were collected,which showed an effective rate of 94.79%.The participants of this study were mainly young healthcare workers,including doctors,nurses,technicians,and medical students.Among them,68.73% expressed concern to telemedicine services-related work,and more than 50% only had a basic understanding of the related work.The top five developable telemedicine/healthcare services were health management,online consultation,disease re-examination,disease screening,and difficult disease consultation,which were basically consistent with the services suitable for future development. Conclusions Healthcare workers have a high degree of recognition to the development of telemedicine services,while their understanding of the related technologies remains to be improved.The available telemedicine services focus on online consultation,difficult disease consultation,and disease re-examination,while the complicated medical services need to be improved.In the future,efforts should be made to continuously improve the information construction level and narrow the regional gap of medical services,so as to promote the continuous improvement and the coordinated development of medical services between regions.

[Practice and System Construction of Telemedicine for Coronavirus Disease 2019 Epidemic Prevention and Control].

Telemedicine is one of the five key components of the "Internet Plus Healthcare".Due to its high speed,real-timeness,low cost,and wide spread,telemedicine is highly feasible in the prevention and control of major infectious diseases.This article introduces the practiceof telemedicine in Peking Union Medical College Hospital during the cornavirus disease 2019(COVID-19)epidemic,during which the network resources were applied to break geographical restrictions and resolve communication barriers between hospitals and departments.This article summarizes the telemedicine application before,during and after COVID-19 control and elucidates how to build a telemedicine prevention and control system for infectious diseases,with an attempt to further improve telemedicine and is application in the public health emergency system in China.

Development and characterization of sandwich-type enzyme-linked aptamer assay for the detection of rongalite in food.

Rongalite is an essentially strong carcinogen, which due to its properties as a bleaching and brightening, is illegally added to the food processing. In this study, a sandwich-type enzyme-linked aptamer assay (ELAA) is developed by using a rongalite-specific aptamer G02 modified fluorescein amidite (FAM) as a capture probe and aptamer C01 modified biotin as a signal element. In the presence of rongalite, the aptamer G02-rongalite-aptamer C01 complex is produced, and the absorbance value can be subsequently measured. The sandwich-type ELAA was shown to detect rongalite with high specificity and affinity, with a KD value of 19.91 ±â€¯1.321 nM. In addition, the standard curve was established, with the limit of quantification (LOQ) for rongalite at 10 ng mL-1. By calculating the slope of the standard curve and the standard deviation of the blank values, the method detection limit (MDL) was 0.572 ng mL-1. Additionally, the accuracy of the sandwich-type ELAA was demonstrated in real food samples. Compared with high-pressure liquid chromatography (HPLC) assay, the sandwich-type ELAA can detect rongalite directly, and it has great advantages in pre-treatment, operation technique and cost. In short, our data suggest that the sandwich-type ELAA may be applicable as a molecular detection technique for rongalite.