RESUMO
Tomatoes (Solanum lycopersicum L.), as a significant solanaceous crop, have attracted global research interest focused on elucidating its plant virus incidence, epidemiology, and pathogenicity, especially in field production (Li et al. 2021; Rivarez et al. 2023). Tobacco vein banding mosaic virus (TVBMV) is classified in the genus Potyvirus. Since its discovery, TVBMV has been documented to infect tobacco, potato, jimsonweed, wild eggplant under nature conditions (Wang et al. 2017). Also, TVBMV could be transmitted to tomatoes by aphids (Myzus persicae) in laboratory conditions (Bi et al. 2020). However, to date, there is no sequence representing TVBMV infecting tomato deposited in NCBI nucleotide database. In August 2023, about 30% of tomato planted in an open field showing typical viral disease symptoms (chlorosis, yellowing, mosaic, curling, and mottling) in Dali, Yunnan, China. To identify the potential pathogen, about 9 symptomatic leave from different plants were collected, pooled and sent for high-throughput sequencing. In summary, total RNA was extracted using TRIzol® Reagent (Invitrogen, CA, USA). Subsequently, RNA sequencing libraries were constructed using the TruSeq RNA sample prep kit (Illumina, CA, USA), followed by RNA-Seq sequencing performed on an Illumina HiSeq4000 platform (LC Sciences, USA). A total of 71,368,934 raw reads (paired-end) of the length 150-bp were generated. After quality control, 69,746,872 reads were retained and subjected to de novo assembly using Trinity (version 2.8.5). The assembled contigs (ranging from 186 nt to 15,573 nt) were searched against the NCBI non-redundant protein (NR) to detect potential viral pathogens using BLASTx with a cutoff e-value of 10-5. As a result, 2 viral contigs were assigned to 2 known viruses: TVBMV (Depth: 1960X, BLASTn similarity: 95.26%) and chilli veinal mottle virus (ChiVMV) (Depth: 3581X, BLASTn similarity: 98.22%). No other viruses and viroids were detected. The presence of TVBMV and ChiVMV were tested positive in all of the 9 samples originally collected. Notably, the detection primer for TVBMV identified in tomato (TVBMV-tomato) was designed from the newly assembled TVBMV genome (Forward: 5'- CTCGGTGAGGAAGGTGACATAAGT'; Reverse: 5'- CTTTCAACACCAGGGAATCTAGTG -3'). The nearly complete genome sequence of TVBMV-tomato was validated by overlapping RT-PCR and submitted to NCBI nucleotide database (accession: PP848192). To assess TVBMV-tomato infectivity, symptomatic tomato leaf sap was mechanically inoculated onto 4 healthy tomatoes, with healthy tomato leaf sap serving as a control. After 3 weeks, plants inoculated with symptomatic sap showed leaf curling and stunting, while control plants remained unaffected. All symptomatic samples tested positive for TVBMV via RT-PCR (4/4). For comparison, TVBMV could not be detected in the control sample. Sanger sequencing verified the expected 986 bp amplicon sequences. However, ChiVMV was also detected in all symptomatic tomato samples, which makes it possible that the symptoms after inoculation were the result of the synergism of TVBMV and ChiVMV. Phylogenetic analysis based on complete coding sequence revealed that TVBMV-tomato was most closely related to TVBMV identified from Solanum lyratum. To our knowledge, this work represents the first report of natural occurrence of TVBMV in agroecosystem in Yunnan, China.
RESUMO
Potato virus H (PVH), belonging to the genus Carlavirus in the family Betaflexiviridae, was initially discovered in potato plants in Inner Mongolia, China (Li et al., 2013). Subsequently, it was documented to infect pepino, a perennial shrub of the Solanaceae family like potatoes (Abouelnasr et al., 2014). Tomato (Solanum lycopersicum L.), a major global crop, faces threats from various plant viruses. In an open field survey in Yunnan, China during July 2023, tomatoes (cultivar: Liangsi) showed typical virus symptoms: leaf yellowing, curling, mottling, and fruit with abnormal shape and color. Eleven symptomatic tomato samples were collected for high-throughput sequencing to identify the potential pathogen. RNA sequencing libraries were prepared using the TruSeq RNA sample prep kit (Illumina, San Diego, CA, USA), followed by RNA-seq sequencing on an Illumina HiSeq4000 platform (LC Sciences, USA). Approximately 77,928,560 paired-end reads (150-bp each) were generated. After quality control, 75,808,296 reads were retained and subjected to de novo assembly using Trinity (version 2.8.5). The assembled contigs, ranging from 198 nt to 15865 nt, were used as queries to search against the NCBI non-redundant protein sequence database (NR) or nucleotide sequence database (NT) to detect the potential pathogens using BLASTx and BLASTn program with a cutoff e-value of 10-5. As a consequence, certain contigs were assigned to 3 plant viruses, including PVH (the highest RdRp blastx identity to UAD82396.1: 97.8%), Capsicum chlorosis virus (CaCV, the highest RdRp blastx identity to APQ31267.1: 98.4%), and southern tomato virus (STV, the highest CP-RdRp fusion protein blastx identity to QOW17541.1: 99.74%). The presence of the identified 3 viruses was subsequently screened in the 11 tomato samples originally collected from the corresponding field. Notably, the specific detection primers for the PVH genome was designed from the newly assembled PVH genome (Forward primer: 5'- ATAGTTGTGCACTGTGTGCCTG-3'; Reverse primer: 5'-GCTTAAGGTTCTTAGCGTATTC-3'), targeting ~1.1kb. Consequently, PVH was detected in 3 out of 11 samples: 2 leaf samples and 1 fruit sample, with one leaf sample showing a single infection. The complete genome sequence of PVH in tomatoes (PVH-tomato) was successfully obtained by assembling nine overlapping regions spanning the entire PVH-tomato genome, following the RT-PCR and the 5' RACE and 3' RACE approaches, and deposited in NCBI nucleotide database with accession number OR397130.1Phylogenetic analysis based on the full genome sequences of PVH-tomato and other publicly available PVH isolates revealed that PVH-tomato was closely related to a PVH isolate found in potatoes in Yunnan (blastn similarity: 97.76%) (Fig. S1A). To test PVH-tomato infectivity and pathogenicity, four healthy Nicotiana benthamiana and four healthy tomato plants were mechanically inoculated with PVH-infected leaf sap; controls used sap from healthy plants. Three weeks post-inoculation, all N. benthamiana (4/4) and three tomato plants (3/4) were PVH-positive by RT-PCR. Symptoms were milder in N. benthamiana, and only two tomato plants (2/4) showed leaf curling. No PVH was detected in control samples (Figure S1B, S1C). Sanger sequencing confirmed the amplicons' expected length of 1093 bp. Previously, PVH was documented only in potato and pepino. This is the first report of tomatoes as natural PVH hosts and PVH infecting N. benthamiana under lab conditions.
RESUMO
Emerging evidence indicates that fatty acid (FA) metabolic pathways regulate host immunity to vertebrate viruses. However, information on FA signaling in plant virus infection remains elusive. In this study, we demonstrate the importance of fatty acid desaturase (FAD), an enzyme that catalyzes the rate-limiting step in the conversion of saturated FAs into unsaturated FAs, during infection by a plant RNA virus. We previously found that the rare Kua-ubiquitin conjugating enzyme (Kua-UEV1) fusion protein FAD4 from Nicotiana benthamiana (NbFAD4) was down-regulated upon turnip mosaic virus (TuMV) infection. We now demonstrate that NbFAD4 is unstable and is degraded as TuMV infection progresses. NbFAD4 is required for TuMV replication, as it interacts with TuMV replication protein 6K2 and colocalizes with viral replication complexes. Moreover, NbFAD4 overexpression dampened the accumulation of immunity-related phytohormones and FA metabolites, and its catalytic activity appears to be crucial for TuMV infection. Finally, a yeast two-hybrid library screen identified the vacuolar H+-ATPase component ATP6V0C as involved in NbFAD4 degradation and further suppression of TuMV infection. This study reveals the intricate role of FAD4 in plant virus infection, and shed lights on a new mechanism by which a V-ATPase is involved in plant antiviral defense.
RESUMO
Green-stem forsythia (Forsythia viridissima), also known as golden bell, is cultivated widely in China as an early spring flowering shrub. In July 2020, yellow or white vein clearing symptoms on leaves were observed in approximate 15% golden bell plants along a landscape river in Ningbo city, Zhejiang province, China. Symptomatic leaves from six different plants were collected and pooled. Total RNA was extracted from about 200 mg pooled sample using TRIzol Reagent (Invitrogen, Carlsbad, USA) and used for high-throughput sequencing (HTS). The cDNA library was constructed using a TruSeq RNA Sample Preparation Kit (Illumina) and an Illumina NovaSeq 6000 platform was utilized to yield 150 nt paired-end reads. CLC Genomic Workbench 11 (QIAGEN) with default parameters were used for data analysis. A total of 41,604,174 paired-end reads were obtained, and 156,853 contigs (16 - 26,665 nt) were generated de novo and compared with sequences in the NCBI nt and nr database using BLASTn and BLASTx, respectively. A total of 197,277 reads were mapped to the citrus leaf blotch virus (CLBV; genus Citrivirus, family Betaflexiviridae) genome with an average coverage of 3191×. A contig of 8783 nt (excluding the poly(A) tail) was aligned to CLBV isolate Vib (accession No. OP751940) by BLASTn with the highest nt sequence identity of 99.7% and 99% query coverage, suggesting that the samples were infected with CLBV (Myung-Hwi Kim et al. 2023). No other virus was detected by this analysis. Subsequently, leaves of the six plants collected above, three plants with mild chlorotic symptoms and three plants without obvious symptoms were tested separately by RT-PCR and all were positive for CLBV. Sap from multiple symptomatic F. viridissima leaves was mechanically inoculated to Nicotiana benthamiana, N. tabacum and Datura stramonium in sextuplicate, but after two months, none of the inoculated plants had obvious symptoms and all of them tested negative for CLBV using RT-PCR. To determine the genome sequence of CLBV present in F. viridissima, a single sample from one plant was selected for genome validtion. The contig sequence was confirmed by Sanger sequencing of RT-PCR products amplified using CLBV-specific primers, and the 5' terminal sequence of the virus was determined using a commercial SUPERSWITCH RACE cDNA Synthesis Kit (Tiosbio, Beijing, China). The complete genomic sequence of CLBV isolated from F. viridissima was 8787 nts long, excluding the poly(A) tail, has the expected three predicted ORFs and was deposited in the GenBank database (accession no. OR766026). Phylogenetic analysis of different CLBV genome sequences from fruit trees and other hosts in GenBank using MEGA11 showed that the golden bell isolate was most closely related to isolate Vib (OP751940) from Viburnum lentago in South Korea, with which it was almost identical (99.7% complete nt sequence identity and >99% aa sequence identity in each of the three ORFs). Ten viruses have been previously reported from Forsythia spp. (Kaminska, M. 1985; Lee et al. 1997), but this is the first report of CLBV in this host. CLBV mainly infects citrus, kiwifruit and apple causing mosaic, chlorosis or yellow vein clearing symptoms, however, bud union disorder was observed in 'Nagami' kumquat infected by CLBV, which caused serious production losses (Cao et al. 2017; Li et al. 2018; Liu et al. 2019; Galipienso et al. 2001). Therefore, further investigation is needed to assess if F. viridissima can be an intermediate host to transfer CLBV to other crops.
RESUMO
Tomato brown rugose fruit virus (ToBRFV) is a newly-emerging tobamovirus which was first reported on tomatoes in Israel and Jordan, and which has now spread rapidly in Asia, Europe, North America, and Africa. ToBRFV can overcome the resistance to other tobamoviruses conferred by tomato Tm-1, Tm-2, and Tm-22 genes, and it has seriously affected global crop production. The rapid and comprehensive transcription reprogramming of host plant cells is the key to resisting virus attack, but there have been no studies of the transcriptome changes induced by ToBRFV in tomatoes. Here, we made a comparative transcriptome analysis between tomato leaves infected with ToBRFV for 21 days and those mock-inoculated as controls. A total of 522 differentially expressed genes were identified after ToBRFV infection, of which 270 were up-regulated and 252 were down-regulated. Functional analysis showed that DEGs were involved in biological processes such as response to wounding, response to stress, protein folding, and defense response. Ten DEGs were selected and verified by qRT-PCR, confirming the reliability of the high-throughput sequencing data. These results provide candidate genes or signal pathways for the response of tomato leaves to ToBRFV infection.
Assuntos
Solanum lycopersicum , Tobamovirus , Viroses , Solanum lycopersicum/genética , Frutas , Reprodutibilidade dos Testes , Perfilação da Expressão Gênica , TranscriptomaRESUMO
Nanoviruses have multipartite, circular, single-stranded DNA genomes and cause huge production losses in legumes and other crops. No viral suppressor of RNA silencing (VSR) has yet been reported from a member of the genus Nanovirus. Here, we demonstrate that the nanovirus U2 protein is a VSR. The U2 protein of milk vetch dwarf virus (MDV) suppressed the silencing of the green fluorescent protein (GFP) gene induced by single-stranded and double-stranded RNA, and the systemic spread of the GFP silencing signal. An electrophoretic mobility shift assay showed that the U2 protein was able to bind double-stranded 21-nucleotide small interfering RNA (siRNA). The cysteine residues at positions 43, 79 and 82 in the MDV U2 protein are critical to its nuclear localization, self-interaction and siRNA-binding ability, and were essential for its VSR activity. In addition, expression of the U2 protein via a potato virus X vector induced more severe necrosis symptoms in Nicotiana benthamiana leaves. The U2 proteins of other nanoviruses also acted as VSRs, and the three conserved cysteine residues were indispensable for their VSR activity.
Assuntos
Nanovirus , Interferência de RNA , Nanovirus/genética , Nanovirus/metabolismo , Cisteína/metabolismo , RNA Interferente Pequeno/metabolismo , Proteínas de Fluorescência Verde/metabolismo , RNA de Cadeia Dupla/genética , Doenças das PlantasRESUMO
A novel mitovirus was detected in taro (Colocasia esculenta) growing in Ningbo, China. The complete genome sequence of Colocasia esculenta associated mitovirus 1 (CeaMV1) was determined by next-generation sequencing combined with RT-PCR and RACE. The genome is 2921 nucleotides long and contains a single ORF encoding a putative RNA-dependent RNA polymerase. Homology searches and phylogenetic analysis suggested that CeaMV1 is a member of a new species in the genus Duamitovirus. This is the first report of a member of the family Mitoviridae associated with taro.
Assuntos
Colocasia , Vírus de RNA , Filogenia , Genoma Viral , Vírus de RNA/genética , RNA Polimerase Dependente de RNA/genéticaRESUMO
An isolate of chilli veinal mottle virus (ChiVMV; genus Potyvirus) of Solanum nigrum L. from southwest China (ChiVMV-YunN/Yuxi) was identified and sequenced (GenBank: OP404087). Comparison with other ChiVMV isolates and recombination analyses suggested a recombinant origin. The most significant recombination event among all 21 complete ChiVMV isolates was an ending breakpoint at 1408-1488 for ChiVMV-YunN/Yuxi with ChiVMV-TaiW and ChiVMV-YunN/Ca operating as the respective major and minor parents. Interestingly, the 5' UTR of ChiVMV-YunN/Yuxi is 15 nucleotides ('AAAAATAAAACAACC') longer than other reported isolates. A full-length clone of ChiVMV-YunN/Yuxi was constructed and was shown to be infectious in Nicotiana benthamiana. The additional 15 nt of 5' UTR in ChiVMV-YunN/Yuxi was stable when transmitted through three generations. Experiments with modified clones showed that the additional 15 nt are essential for infection by this isolate.
Assuntos
Potyvirus , Solanum nigrum , Regiões 5' não Traduzidas , China , Doenças das PlantasRESUMO
Pepper mild mottle virus (PMMoV) is a devastating viral pathogen of pepper (Capsicum annuum) but it is unclear whether and how peppers protect against PMMoV infection. The expression of the chloroplast outer membrane protein 24 (OMP24) of C. annuum was upregulated under PMMoV infection and it interacted with PMMoV coat protein (CP). Silencing of OMP24 in either C. annuum or Nicotiana benthamiana facilitated PMMoV infection, whereas overexpression of N. benthamiana OMP24 in transgenic plants inhibited PMMoV infection. Both C. annuum OMP24 (CaOMP24) and N. benthamiana OMP24 (NbOMP24) localized to the chloroplast and have a moderately hydrophobic transmembrane domain that is necessary for their localization. Overexpression of CaOMP24 induced stromules, perinuclear chloroplast clustering, and accumulation of reactive oxygen species (ROS), the typical defense responses of chloroplasts transferring the retrograde signaling to the nucleus to regulate resistance genes. The expression of PR1 and PR2 was also upregulated significantly in plants overexpressing OMP24. Self-interaction of OMP24 was demonstrated and was required for OMP24-mediated plant defense. Interaction with PMMoV CP interfered with the self-interaction of OMP24 and impaired OMP24-induced stromules, perinuclear chloroplast clustering and ROS accumulation. The results demonstrate the defense function of OMP24 in pepper during viral infection and suggest a possible mechanism by which PMMoV CP modulates the plant defense to facilitate viral infection.
RESUMO
The complete genome of a new virus belonging to the family Betaflexiviridae was identified in garlic and sequenced by next-generation sequencing and reverse transcription PCR. The complete RNA genome (GenBank accession number OP021693) is 8191 nucleotides in length, excluding the 3' poly(A) tail, and contains five open reading frames (ORFs). These open reading frames encode the viral replicase, triple gene block, and coat protein, and the genome organization is typical of members of the subfamily Quinvirinae. The virus has been tentatively named "garlic yellow curl virus" (GYCV). Phylogenetic analysis suggested that it represents an independent evolutionary lineage in the subfamily, clustering with the currently unclassified garlic yellow mosaic associated virus (GYMaV) and peony betaflexivirus 1 (PeV1). Differences between the phylogenies inferred for the replicase and coat protein indicate that the new virus does not belong to any established genus of the family Betaflexiviridae. This is the first report of GYCV in China.
Assuntos
Flexiviridae , Alho , Alho/genética , Filogenia , Genoma Viral , Flexiviridae/genética , RNA , RNA Mensageiro , Fases de Leitura Aberta , RNA Viral/genética , Doenças das PlantasRESUMO
The complete genomic sequence of a waikavirus from Chinese hackberry in Zhejiang province, China, named "hackberry virus A" (HVA), was determined using high-throughput sequencing (HTS) combined with reverse transcription polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE) PCR. The bicistronic genomic RNA of HVA was found to consist of 12,691 nucleotides (nt), excluding the 3'-terminal poly(A) tail, and to encode a large polyprotein of 3783 amino acids (aa) and an additional 10.3-kDa protein. The aa sequences of the Pro-Pol and the CP regions of this virus share 39.8-44.2% and 25.5-36.4% identity, respectively, with currently known waikaviruses. These values are significantly below the current species demarcation threshold (< 75% and < 80% aa identity for the CP and Pro-Pol region, respectively) for the family Secoviridae, indicating that HVA represents a new species in the genus Waikavirus. This is the first report of a virus infecting Chinese hackberry.
Assuntos
Waikavirus , Waikavirus/genética , Sequência de Bases , Genoma Viral , Filogenia , Doenças das Plantas , RNA Viral/genéticaRESUMO
Quantitative real-time PCR (RT-qPCR) is a widely used method for studying alterations in gene expression upon infections caused by diverse pathogens such as viruses. Positive-sense single-stranded (ss(+)) RNA viruses form a major part of all known plant viruses, and some of them are damaging pathogens of agriculturally important crops. Analysis of gene expression following infection by ss(+) RNA viruses is crucial for the identification of potential anti-viral factors. However, viral infections are known to globally affect gene expression and therefore selection and validation of reference genes for RT-qPCR is particularly important. In this study, the expression of commonly used reference genes for RT-qPCR was studied in Nicotiana benthamiana following single infection by 11 ss(+) RNA viruses, including five tobamoviruses, four potyviruses, one potexvirus and one polerovirus. Stability of gene expression was analyzed in parallel by four commonly used algorithms: geNorm, NormFinder, BestKeeper, and Delta CT, and RefFinder was finally used to summarize all the data. The most stably expressed reference genes differed significantly among the viruses, even when those viruses were from the same genus. Our study highlights the importance of the selection and validation of reference genes upon different viral infections.
RESUMO
Previously we reported that the multifunctional cylindrical inclusion (CI) protein of turnip mosaic virus (TuMV) is targeted to endosomes through the interaction with the medium subunit of adaptor protein complex 2 (AP2ß), which is essential for viral infection. Although several functionally important regions in the CI have been identified, little is known about the determinant(s) for endosomal trafficking. The CI protein contains seven conserved acidic dileucine motifs [(D/E)XXXL(L/I)] typical of endocytic sorting signals recognized by AP2ß. Here, we selected five motifs for further study and identified that they all were located in the regions of CI interacting with AP2ß. Coimmunoprecipitation assays revealed that alanine substitutions in the each of these acidic dileucine motifs decreased binding with AP2ß. Moreover, these CI mutants also showed decreased accumulation of punctate bodies, which enter endocytic-tracking styryl-stained endosomes. The mutations were then introduced into a full-length infectious clone of TuMV, and each mutant had reduced viral replication and systemic infection. The data suggest that the acidic dileucine motifs in CI are indispensable for interacting with AP2ß for efficient viral replication. This study provides new insights into the role of endocytic sorting motifs in the intracellular movement of viral proteins for replication.
Assuntos
Potyvirus , Motivos de Aminoácidos , Endossomos/metabolismo , Potyvirus/metabolismo , Proteínas Virais/genética , Proteínas Virais/metabolismo , Replicação ViralRESUMO
Accumulated experimental evidence has shown that viruses recruit the host intracellular machinery to establish infection. It has recently been shown that the potyvirus Turnip mosaic virus (TuMV) transits through the late endosome (LE) for viral genome replication, but it is still largely unknown how the viral replication vesicles labelled by the TuMV membrane protein 6K2 target LE. To further understand the underlying mechanism, we studied the involvement of the vacuolar sorting receptor (VSR) family proteins from Arabidopsis in this process. We now report the identification of VSR4 as a new host factor required for TuMV infection. VSR4 interacted specifically with TuMV 6K2 and was required for targeting of 6K2 to enlarged LE. Following overexpression of VSR4 or its recycling-defective mutant that accumulates in the early endosome (EE), 6K2 did not employ the conventional VSR-mediated EE to LE pathway, but targeted enlarged LE directly from cis-Golgi and viral replication was enhanced. In addition, VSR4 can be N-glycosylated and this is required for its stability and for monitoring 6K2 trafficking to enlarged LE. A non-glycosylated VSR4 mutant enhanced the dissociation of 6K2 from cis-Golgi, leading to the formation of punctate bodies that targeted enlarged LE and to more robust viral replication than with glycosylated VSR4. Finally, TuMV hijacks N-glycosylated VSR4 and protects VSR4 from degradation via the autophagy pathway to assist infection. Taken together, our results have identified a host factor VSR4 required for viral replication vesicles to target endosomes for optimal viral infection and shed new light on the role of N-glycosylation of a host factor in regulating viral infection.
Assuntos
Endossomos/metabolismo , Interações Hospedeiro-Patógeno/fisiologia , Potyvirus/patogenicidade , Proteínas de Transporte Vesicular/metabolismo , Compartimentos de Replicação Viral/metabolismo , Humanos , Doenças das Plantas/microbiologia , Replicação Viral/fisiologiaRESUMO
Jasmonic acid (JA) is a crucial hormone in plant antiviral immunity. Increasing evidence shows that viruses counter this host immune response by interfering with JA biosynthesis and signaling. However, the mechanism by which viruses affect JA biosynthesis is still largely unexplored. Here, we show that a highly conserved chloroplast protein cpSRP54 was downregulated in Nicotiana benthamiana infected by turnip mosaic virus (TuMV). Its silencing facilitated TuMV infection. Furthermore, cpSRP54 interacted with allene oxide cyclases (AOCs), key JA biosynthesis enzymes, and was responsible for delivering AOCs onto the thylakoid membrane (TM). Interestingly, TuMV P1 protein interacted with cpSRP54 and mediated its degradation via the 26S proteosome and autophagy pathways. The results suggest that TuMV has evolved a strategy, through the inhibition of cpSRP54 and its delivery of AOCs to the TM, to suppress JA biosynthesis and enhance viral infection. Interaction between cpSRP54 and AOCs was shown to be conserved in Arabidopsis and rice, while cpSRP54 also interacted with, and was degraded by, pepper mild mottle virus (PMMoV) 126 kDa protein and potato virus X (PVX) p25 protein, indicating that suppression of cpSRP54 may be a common mechanism used by viruses to counter the antiviral JA pathway.
Assuntos
Proteínas de Cloroplastos/metabolismo , Ciclopentanos/metabolismo , Oxirredutases Intramoleculares/metabolismo , Oxilipinas/metabolismo , Doenças das Plantas/virologia , Potyvirus/metabolismo , Tilacoides/metabolismo , Interações Hospedeiro-Parasita/fisiologia , Reguladores de Crescimento de Plantas/metabolismo , Imunidade Vegetal , Viroses/virologiaRESUMO
Plant virus nanoparticles (PVNPs) have been widely used for drug delivery, antibody development and medical imaging because of their good biodegradation and biocompatibility. Particles of pepper mild mottle virus (PMMoV) are elongated and may be useful as drug carriers because their shape favours long circulation, preferential distribution and increased cellular uptake. Moreover, its effective degradation in an acidic microenvironment enables a pH-responsive release of the encapsulated drug. In this study, genetic engineering techniques were used to form rod-shaped structures of nanoparticles (PMMoV) and folated-modified PMMoV nanotubes were prepared by polyethylene glycol (PEG) to provide targeted delivery of paclitaxel (PTX). FA@PMMoV@PTX nanotubes were designed to selectively target tumor cells and to release the encapsulated PTX in response to pH. Efficient cell uptake of FA@PMMoV@PTX nanotubes was observed when incubated with tumor cells, and FA@PMMoV@PTX nanotubes had superior cytotoxicity to free PTX, as reflected by cell survival and apoptosis. This system is a strong candidate for use in developing improved strategies for targeted treatment of tumors.
RESUMO
The complete genomic sequence of a novel ilarvirus from Eleocharis dulcis, tentatively named "water chestnut virus A" (WCVA), was determined using next-generation sequencing (NGS) combined with reverse transcription polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE) PCR. The three genomic RNA components of WCVA were 3578 (RNA1), 2873 (RNA2), and 2073 (RNA3) nucleotides long, with four predicted open reading frames containing conserved domains and motifs typical of ilarviruses. Phylogenetic analysis of each predicted protein consistently placed WCVA in subgroup 4 of the genus Ilarvirus, together with prune dwarf virus, viola white distortion associated virus, Fragaria chiloensis latent virus, and potato yellowing virus. The genetic distances and lack of serological reaction to antisera against other ilarviruses suggest that WCVA is a novel member of the genus.
Assuntos
Eleocharis , Ilarvirus , Sequência de Bases , Genoma Viral , Sequenciamento de Nucleotídeos em Larga Escala , Ilarvirus/genética , Fases de Leitura Aberta , Filogenia , RNA Viral/genéticaRESUMO
Brassinazole-resistant (BZR) family genes encode plant-specific transcription factors (TFs), play essential roles in the regulation of plant growth and development, and have multiple stress-resistance functions. Nicotiana benthamiana is a model plant widely used in basic research. However, members of the BZR family in N. benthamiana have not been identified, and little is known about their function in abiotic stress. In this study, a total of 14 BZR members were identified in the N. benthamiana genome, which could be divided into four groups according to a phylogenetic tree. NbBZRs have similar exon-intron structures and conserved motifs, and may be regulated by cis-acting elements such as STRE, TCA, and ARE, etc. Organ-specific expression analysis showed that NbBZR members have different and diverse expression patterns in different tissues, and most of the members are expressed in roots, stems, and leaves. The analysis of the expression patterns in response to different abiotic stresses showed that all the tested NbBZR members showed a significant down-regulation after drought treatment. Many NbBZR genes also responded in various ways to cold, heat and salt stress treatments. The results imply that NbBZRs have multiple functions related to stress resistance.
Assuntos
Proteínas de Ligação a DNA , Regulação da Expressão Gênica de Plantas , Família Multigênica , Nicotiana , Proteínas de Plantas , Fatores de Transcrição , Proteínas de Ligação a DNA/biossíntese , Proteínas de Ligação a DNA/genética , Perfilação da Expressão Gênica , Estudo de Associação Genômica Ampla , Proteínas de Plantas/biossíntese , Proteínas de Plantas/genética , Nicotiana/genética , Nicotiana/metabolismo , Fatores de Transcrição/biossíntese , Fatores de Transcrição/genéticaRESUMO
Autophagy is induced by viral infection and has antiviral functions in plants, but the underlying mechanism is poorly understood. We previously identified a viral small interfering RNA (vsiRNA) derived from rice stripe virus (RSV) RNA4 that contributes to the leaf-twisting and stunting symptoms caused by this virus by targeting the host eukaryotic translation initiation factor 4A (eIF4A) mRNA for silencing. In addition, autophagy plays antiviral roles by degrading RSV p3 protein, a suppressor of RNA silencing. Here, we demonstrate that eIF4A acts as a negative regulator of autophagy in Nicotiana benthamiana. Silencing of NbeIF4A activated autophagy and inhibited RSV infection by facilitating autophagic degradation of p3. Further analysis showed that NbeIF4A interacts with NbATG5 and interferes with its interaction with ATG12. Overexpression of NbeIF4A suppressed NbATG5-activated autophagy. Moreover, expression of vsiRNA-4A, which targets NbeIF4A mRNA for cleavage, induced autophagy by silencing NbeIF4A. Finally, we demonstrate that eIF4A from rice, the natural host of RSV, also interacts with OsATG5 and suppresses OsATG5-activated autophagy, pointing to the conserved function of eIF4A as a negative regulator of antiviral autophagy. Taken together, these results reveal that eIF4A negatively regulates antiviral autophagy by interacting with ATG5 and that its mRNA is recognized by a virus-derived siRNA, resulting in its silencing, which induces autophagy against viral infection.