Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 467
Filtrar
1.
J Adolesc ; 2024 Sep 20.
Artigo em Inglês | MEDLINE | ID: mdl-39301917

RESUMO

INTRODUCTION: Rejection sensitivity is considered a risk factor for loneliness; however, the underlying mechanisms remain unknown. Adopting the constructs of exposure, reactivity, and exposure-reactivity from the personality framework, this study investigated three models of rejection sensitivity, bullying victimization, and loneliness to reveal why rejection sensitivity leads to loneliness among Chinese early adolescents. METHODS: Using a longitudinal design, three-wave data were obtained (with approximately 6-month intervals) from 2381 Chinese early adolescents (51.2% boys at Time 1, Mage = 13.38, SD = 0.59) from 7 secondary schools. Students reported on their rejection sensitivity at Time 1, bullying victimization at Times 1 and 2, and their loneliness at Times 2 and 3. A longitudinal moderated mediation model was conducted to analyze the association between variables. RESULTS: Path analyses demonstrated that rejection sensitivity was associated with greater loneliness for adolescents in which association was mediated by bullying victimization. High levels of rejection sensitivity exacerbate the adverse effect of bullying victimization on loneliness. Furthermore, in line with the differential exposure-reactivity model, the effect of rejection sensitivity on loneliness mediated by bullying victimization only existed for high rejection-sensitive adolescents. CONCLUSIONS: The findings emphasize the dual role of rejection sensitivity in the development process of adolescents' loneliness and highlight the importance of identifying rejection-sensitive adolescents for intervention and prevention efforts.

2.
Support Care Cancer ; 32(10): 653, 2024 Sep 11.
Artigo em Inglês | MEDLINE | ID: mdl-39259369

RESUMO

OBJECTIVE: To evaluate the application of a rehabilitation management protocol for urinary incontinence after robot-assisted laparoscopic prostatectomy (RALP). METHODS: We conducted a retrospective cohort study of 114 patients who underwent RALP between August 2021 and November 2021 as the control group and a prospective analysis of 114 patients who underwent RALP between May 2022 and August 2022 as the experimental group. The rehabilitation management protocol focused on preoperative stage, postoperative care, day of catheter removal, 1 month postoperative, 3 months postoperative, 6 months postoperative, and 12 months or more postoperative. RESULTS: The 24-h pad test was significantly lower in the experimental group compared with the control group at 2 and 6 months after RALP (both P < 0.01). The scores of the international consultation on incontinence questionnaire-short form (ICIQ-SF) in the experimental group were significantly lower than those in the control group at 1 month after RALP (P < 0.01).The scores of quality of life in the experimental group were significantly higher than those of the control group at 1, 2, and 6 months after RALP (all P < 0.01).The scores of Broome Pelvic Muscle Self-efficacy Scale (BPMSES) were lower than those of the control group at 1, 2, 3, and 6 months after RALP (all P < 0.01). CONCLUSION: The application of the rehabilitation management protocol had significant beneficial effects on urinary functions and quality of life in patients with prostate cancer after RALP.


Assuntos
Laparoscopia , Prostatectomia , Neoplasias da Próstata , Qualidade de Vida , Procedimentos Cirúrgicos Robóticos , Incontinência Urinária , Humanos , Masculino , Prostatectomia/efeitos adversos , Prostatectomia/métodos , Prostatectomia/reabilitação , Incontinência Urinária/etiologia , Incontinência Urinária/reabilitação , Pessoa de Meia-Idade , Estudos Retrospectivos , Procedimentos Cirúrgicos Robóticos/métodos , Procedimentos Cirúrgicos Robóticos/efeitos adversos , Laparoscopia/métodos , Laparoscopia/efeitos adversos , Idoso , Estudos Prospectivos , Neoplasias da Próstata/cirurgia , Neoplasias da Próstata/reabilitação , Inquéritos e Questionários , Complicações Pós-Operatórias/etiologia , Complicações Pós-Operatórias/reabilitação , Resultado do Tratamento
3.
World J Gastrointest Oncol ; 16(8): 3436-3444, 2024 Aug 15.
Artigo em Inglês | MEDLINE | ID: mdl-39171182

RESUMO

BACKGROUND: Gastric cancer (GC) is one of the most common malignant tumors in the world, and its prognosis is closely related to many factors. In recent years, the incidence of vascular thrombosis in patients with GC has gradually attracted increasing attention, and studies have shown that it may have a significant impact on the survival rate and prognosis of patients. However, the specific mechanism underlying the association between vascular thrombosis and the prognosis of patients with GC remains unclear. AIM: To analyze the relationships between vascular cancer support and other clinicopathological factors and their influence on the prognosis of patients with GC. METHODS: This study retrospectively analyzed the clinicopathological data of 621 patients with GC and divided them into a positive group and a negative group according to the presence or absence of a vascular thrombus. The difference in the 5-year cumulative survival rate between the two groups was compared, and the relationships between vascular cancer thrombus and other clinicopathological factors and their influence on the prognosis of patients with GC were analyzed. RESULTS: Among 621 patients with GC, the incidence of vascular thrombi was 31.7% (197 patients). Binary logistic regression analysis revealed that the degree of tumor differentiation, depth of invasion, and extent of lymph node metastasis were independent influencing factors for the occurrence of vascular thrombi in GC patients (P < 0.01). The trend of the χ 2 test showed that the degree of differentiation, depth of invasion, and extent of lymph node metastasis were linearly correlated with the percentage of vascular thrombi in GC patients (P < 0.01), and the correlation between lymph node metastasis and vascular thrombi was more significant (r = 0.387). Univariate analysis revealed that the 5-year cumulative survival rate of the positive group was significantly lower than that of the negative group (46.7% vs 73.3%, P < 0.01). Multivariate analysis revealed that age, tumor diameter, TNM stage, and vascular thrombus were independent risk factors for the prognosis of GC patients (all P < 0.05). Further stratified analysis revealed that the 5-year cumulative survival rate of stage III GC patients in the thrombolase-positive group was significantly lower than that in the thrombolase-negative group (36.1% vs 51.4%; P < 0.05). CONCLUSION: Vascular cancer status is an independent risk factor affecting the prognosis of patients with GC. The combination of vascular cancer suppositories and TNM staging can better judge the prognosis of patients with GC and guide more reasonable treatment.

4.
iScience ; 27(6): 110117, 2024 Jun 21.
Artigo em Inglês | MEDLINE | ID: mdl-38947521

RESUMO

Dysregulated host immune responses contribute to disease severity and worsened prognosis in COVID-19 infection and the underlying mechanisms are not fully understood. In this study, we observed that IL-33, a damage-associated molecular pattern molecule, is significantly increased in COVID-19 patients and in SARS-CoV-2-infected mice. Using IL-33-/- mice, we demonstrated that IL-33 deficiency resulted in significant decreases in bodyweight loss, tissue viral burdens, and lung pathology. These improved outcomes in IL-33-/- mice also correlated with a reduction in innate immune cell infiltrates, i.e., neutrophils, macrophages, natural killer cells, and activated T cells in inflamed lungs. Lung RNA-seq results revealed that IL-33 signaling enhances activation of inflammatory pathways, including interferon signaling, pathogen phagocytosis, macrophage activation, and cytokine/chemokine signals. Overall, these findings demonstrate that the alarmin IL-33 plays a pathogenic role in SARS-CoV-2 infection and provides new insights that will inform the development of effective therapeutic strategies for COVID-19.

5.
Adv Sci (Weinh) ; : e2307185, 2024 Jul 03.
Artigo em Inglês | MEDLINE | ID: mdl-38958448

RESUMO

Motor learning (ML), which plays a fundamental role in growth and physical rehabilitation, involves different stages of learning and memory processes through different brain regions. However, the neural mechanisms that underlie ML are not sufficiently understood. Here, a previously unreported neuronal projection from the dorsal hippocampus (dHPC) to the zona incerta (ZI) involved in the regulation of ML behaviors is identified. Using recombinant adeno-associated virus, the projections to the ZI are surprisingly identified as originating from the dorsal dentate gyrus (DG) and CA1 subregions of the dHPC. Furthermore, projection-specific chemogenetic and optogenetic manipulation reveals that the projections from the dorsal CA1 to the ZI play key roles in the acquisition and consolidation of ML behaviors, whereas the projections from the dorsal DG to the ZI mediate the retrieval/retention of ML behaviors. The results reveal new projections from the dorsal DG and dorsal CA1 to the ZI involved in the regulation of ML and provide insight into the stages over which this regulation occurs.

6.
Plant Dis ; 2024 Jul 06.
Artigo em Inglês | MEDLINE | ID: mdl-38971963

RESUMO

Siegesbeckia orientalis L., belonging to the family of Asteraceae and also known as 'Xi-Xian Cao' or Herba Siegesbeckiae, has been an important traditional Chinese medicine since the Tang Dynasty (Wang et al., 2021). As the dried aerial parts have medicinal values, S. orientalis is widely grown in China, Japan, Korea, and Vietnam. One almost 600 m2 block of S. orientalis plants with stunting and leaf withering symptoms was found in Luonan County (110.26 E, 34.06 N), Shaanxi Province, in August 2022. Many galls were observed on the roots of these plants, and densities of second-stage juveniles (J2s) were 260~370 per 100 cm3 of soil. Females and eggs were dissected from infected roots, and J2s and males were extracted from the soil for species identification. The perineal patterns of females (n=20) were oval-shaped, with minor dorsal arches, distinct lateral fields, and tiny punctations around anus. The head caps of males were high and obviously narrower than head region which broadened out of the first body annuli. Morphological measurements of females (n=20) were: body length (L) = 897.66 ± 50.89 (860.96-949.74) µm, body width (BW) = 577.69 ± 51.01 (489.91-638.65) µm, stylet length (ST) = 14.03 ± 0.63 (13.25-14.97) µm, dorsal pharyngeal gland orifice to stylet base (DGO) = 4.96 ± 0.47 (4.08-5.37) µm, vulval slit length = 18.82 ± 1.97 (17.24-22.02) µm, vulval slit to anus distance = 13.62 ± 1.22 (12.34-16.18) µm. Measurements of males (n=10) were: L = 1298.73 ± 95.96 (1202.77-1394.69) µm, BW = 28.24 ± 2.38 (25.93-30.55) µm, ST = 20.23 ± 0.78 (19.42-21.04) µm, DGO = 4.89 ± 0.44 (4.56-5.22) µm, spicule length = 28.98 ± 1.68 (26.94-31.02) µm. Measurements of J2s: L = 375.35 ± 14.02 (341.01-400.46) µm, BW = 15.09 ± 1.47 (12.02-16.82) µm, ST = 12.74 ± 0.61(11.46-13.84) µm, DGO = 2.58 ± 0.59 (1.61-3.7) µm, tail length= 74.15 ± 13.73 (50.92-95.09) µm, hyaline tail terminus= 11.36 ± 2.27 (9.53-17.85) µm. These morphological characteristics were consistent with those of Meloidogyne hapla Chitwood, 1949 as described by Whitehead (1968). The DNA of single females (n=10) was isolated using the Proteinase K method for molecular identification (Kumari and Subbotin, 2012). The sequence of rDNA-ITS region was amplified and sequenced with the primers rDNA-F/R (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (Vrain et al., 1992). The 768 bp sequence (GenBank OP542552) was 99.74% identical to the rDNA-ITS sequences of M. hapla (JX024147 and OQ269692). Then the D2/D3 fragments of the 28S rRNA were amplified and sequenced with the primers D2A/D3B (ACAAGTACCGTGAGGGAAAGTTG/TCGGAAGGAACCAGCTACTA) (McClure et al., 2012). The 762 bp fragment (OP554218) showed 100% identical to sequences of M. hapla (MN752204 and OM744204). To confirm the pathogenicity of the population, six 2-week-old healthy S. orientalis seedlings cultured in sterilized sand were each inoculated with 2,000 J2s hatched from egg masses. Four non-inoculated seedlings served as negative controls. After maintenance at 25°C for 60 days, galls appeared on the roots of inoculated plants, being consistent with the symptoms observed in field, while the negative controls showed no symptoms. Females collected from inoculated plants were identified as M. hapla with species-specific primer JWV1/ JWV (Adam et al., 2007), which amplified a fragment of 440 bp. Parasitism was also confirmed by the average recovery of 3,814 J2s per inoculated plant with the reproductive factor of 1.91. This is the first report of S. orientalis being a host of M. hapla. The disease reduces the quality and yield of S. orientalis, and much more efforts would be made for its control in production.

7.
bioRxiv ; 2024 Jul 04.
Artigo em Inglês | MEDLINE | ID: mdl-39005443

RESUMO

Emerging immunotherapies such as immune checkpoint blockade (ICB) and chimeric antigen receptor T-cell (CAR-T) therapy have revolutionized cancer treatment and have improved the survival of patients with multiple cancer types. Despite this success many patients are unresponsive to these treatments or relapse following treatment. CRISPR activation and knockout (KO) screens have been used to identify novel single gene targets that can enhance effector T cell function and promote immune cell targeting and eradication of tumors. However, cancer cells often employ multiple genes to promote an immunosuppressive pathway and thus modulating individual genes often has a limited effect. Paralogs are genes that originate from common ancestors and retain similar functions. They often have complex effects on a particular phenotype depending on factors like gene family similarity, each individual gene's expression and the physiological or pathological context. Some paralogs exhibit synthetic lethal interactions in cancer cell survival; however, a thorough investigation of paralog pairs that could enhance the efficacy of cancer immunotherapy is lacking. Here we introduce a sensitive computational approach that uses sgRNA sets enrichment analysis to identify cancer-intrinsic paralog pairs which have the potential to synergistically enhance T cell-mediated tumor destruction. We have further developed an ensemble learning model that uses an XGBoost classifier and incorporates features such as gene characteristics, sequence and structural similarities, protein-protein interaction (PPI) networks, and gene coevolution data to predict paralog pairs that are likely to enhance immunotherapy efficacy. We experimentally validated the functional significance of these predicted paralog pairs using double knockout (DKO) of identified paralog gene pairs as compared to single gene knockouts (SKOs). These data and analyses collectively provide a sensitive approach to identify previously undetected paralog pairs that can enhance cancer immunotherapy even when individual genes within the pair has a limited effect.

8.
JACC Basic Transl Sci ; 9(6): 733-750, 2024 Jun.
Artigo em Inglês | MEDLINE | ID: mdl-39070276

RESUMO

Heart failure (HF) with left ventricular diastolic dysfunction is a growing global concern. This study evaluated myocardial oxidized nicotinamide adenine dinucleotide (NAD+) levels in human systolic and diastolic HF and in a murine model of HF with preserved ejection fraction, exploring NAD+ repletion as therapy. We quantified myocardial NAD+ and nicotinamide phosphoribosyltransferase levels, assessing restoration with nicotinamide riboside (NR). Findings show significant NAD+ and nicotinamide phosphoribosyltransferase depletion in human diastolic HF myocardium, but NR successfully restored NAD+ levels. In murine HF with preserved ejection fraction, NR as preventive and therapeutic intervention improved metabolic and antioxidant profiles. This study underscores NAD+ repletion's potential in diastolic HF management.

9.
Curr Med Imaging ; 20: e15734056298648, 2024.
Artigo em Inglês | MEDLINE | ID: mdl-38874029

RESUMO

BACKGROUND: Patients with diffuse large B-cell lymphoma (DLBCL) often experience a poor prognosis due to cardiac damage induced by anthracycline chemotherapy, with left ventricular diastolic dysfunction manifesting early. Vector Flow Mapping (VFM) is a novel technology, and its effectiveness in detecting left ventricular diastolic dysfunction following anthracycline chemotherapy remains unverified. OBJECTS: This study evaluates left ventricular diastolic function in DLBCL patients after anthracycline chemotherapy using vector flow mapping (VFM). MATERIALS AND METHODS: We prospectively enrolled 54 DLBCL patients who had undergone anthracycline chemotherapy (receiving a minimum of 4 cycles) as the case group and 54 age- and sex-matched individuals as controls. VFM assessments were conducted in the case group pre-chemotherapy (T0), post-4 chemotherapy cycles (T4), and in the control group. Measurements included basal, middle, and apical segment energy loss (ELb, ELm, ELa) and intraventricular pressure differences (IVPDb, IVPDm, IVPDa) across four diastolic phases: isovolumic relaxation (D1), rapid filling (D2), slow filling (D3), and atrial contraction (D4). RESULTS: When comparing parameters between the control and case groups at T0, no significant differences were observed in general data, conventional ultrasound parameters, and VFM parameters (all P > 0.05). From T0 to T4, ELa significantly increased throughout the diastole cycle (all P < 0.05); ELm increased only during D4 (all P < 0.05); and ELb increased during D1, D2, and D4 (all P < 0.05). All IVPD measurements (IVPDa, IVPDm, IVPDb) increased during D1 and D4 (all P < 0.05) but decreased during D2 and D3 (all P < 0.05). Significant positive correlations were identified between ELa-D4, IVPDa-D4, and parameters A, e', E/e,' and LAVI (all r > 0.5, all P < 0.001). Negative correlations were noted with E/A for ELa- D4 IVPDa-D4 (all r < -0.5, all P < 0.001). Positive correlations were observed for IVPDa-D1, IVPDa-D2 with E, E/e', and LAVI (0.3

Assuntos
Antraciclinas , Linfoma Difuso de Grandes Células B , Disfunção Ventricular Esquerda , Humanos , Linfoma Difuso de Grandes Células B/tratamento farmacológico , Linfoma Difuso de Grandes Células B/diagnóstico por imagem , Feminino , Masculino , Antraciclinas/uso terapêutico , Pessoa de Meia-Idade , Estudos Prospectivos , Disfunção Ventricular Esquerda/diagnóstico por imagem , Disfunção Ventricular Esquerda/induzido quimicamente , Disfunção Ventricular Esquerda/fisiopatologia , Adulto , Diástole , Estudos de Casos e Controles , Idoso , Função Ventricular Esquerda/efeitos dos fármacos , Função Ventricular Esquerda/fisiologia , Ecocardiografia/métodos
10.
Plant Sci ; 344: 112109, 2024 Jul.
Artigo em Inglês | MEDLINE | ID: mdl-38704094

RESUMO

Advances in next-generation sequencing (NGS) have significantly reduced the cost and improved the efficiency of obtaining single nucleotide polymorphism (SNP) markers, particularly through restriction site-associated DNA sequencing (RAD-seq). Meanwhile, the progression in whole genome sequencing has led to the utilization of an increasing number of reference genomes in SNP calling processes. This study utilized RAD-seq data from 242 individuals of Engelhardia roxburghiana, a tropical tree of the walnut family (Juglandaceae), with SNP calling conducted using the STACKS pipeline. We aimed to compare both reference-based approaches, namely, employing a closely related species as the reference genome versus the species itself as the reference genome, to evaluate their respective merits and limitations. Our findings indicate a substantial discrepancy in the number of obtained SNPs between using a closely related species as opposed to the species itself as reference genomes, the former yielded approximately an order of magnitude fewer SNPs compared to the latter. While the missing rate of individuals and sites of the final SNPs obtained in the two scenarios showed no significant difference. The results showed that using the reference genome of the species itself tends to be prioritized in RAD-seq studies. However, if this is unavailable, considering closely related genomes is feasible due to their wide applicability and low missing rate as alternatives. This study contributes to enrich the understanding of the impact of SNP acquisition when utilizing different reference genomes.


Assuntos
Genoma de Planta , Sequenciamento de Nucleotídeos em Larga Escala , Polimorfismo de Nucleotídeo Único , Sequenciamento de Nucleotídeos em Larga Escala/métodos , Análise de Sequência de DNA/métodos
11.
J Fungi (Basel) ; 10(4)2024 Apr 12.
Artigo em Inglês | MEDLINE | ID: mdl-38667956

RESUMO

Candida auris, a resilient pathogenic yeast with frequent multidrug resistance, presents a persistent challenge in healthcare settings. The timely identification of C. auris is crucial for infection control and prevention, especially in facilities facing unique hurdles, such as our institution, which serves four major hospitals and approximately 80% of the Texas inmate population. Understaffing, communal living, and financial constraints exacerbate infection control issues. To address common staff shortages, streamline testing services, and enhance testing efficiency, there was a pressing need for rapid and high-throughput detection of C. auris. This study presents the validation and utility of an assay implemented on the Hologic Fusion Open Access platform using samples collected from high-risk patients' axilla and groin areas, as well as environmental swab samples from patient rooms. Our assay complemented efforts to control C. auris outbreaks within our healthcare system, providing valuable insights into its presence within surveillance samples. This assay demonstrated the value of high-throughput molecular detection platforms in challenging healthcare environments by aiding infection preventionists in containing the spread of C. auris and preventing nosocomial infections. Our research contributes essential data on the suitability and performance of the Hologic Fusion Open Access platform for C. auris detection. These findings hold significant implications for enhancing surveillance and control measures in high-risk settings, making a significant impact on the field of infection control and prevention.

12.
Langmuir ; 40(17): 9028-9038, 2024 Apr 30.
Artigo em Inglês | MEDLINE | ID: mdl-38635954

RESUMO

Aqueous zinc-ion batteries (AZIBs) suffer from sharp cycling deterioration due to serious interfacial side reactions and corrosion problems on the zinc anode. Herein, an efficacious approach to construct hydrophobic ZnMoO4 coatings on Zn (denoted as Zn@ZMO) is proposed to mitigate direct contact between the zinc anode and electrolyte and enhance its cycle life. The hydrophobic ZnMoO4 layer (contact angle = 128°) with a honeycomb-like structure is prepared by an in situ liquid phase deposition method. The as-prepared ZnMoO4 coating exhibits persistent corrosion protection for Zn through 30 days of immersion in a 2 M ZnSO4 electrolyte, indicating excellent stability of the ZnMoO4 layer and ensuring its available application in AZIBs. Unique microchannels in this kind of honeycomb-like structured coating favor Zn2+ ion diffusion and ease of ion transport, especially at high current cycling. Its robust surface exclusion can effectively counter other side reactions induced by water, simultaneously. As a result, the Zn@ZMO symmetrical cell shows a remarkable cycle lifespan exceeding 2700 h at 1 mA cm-2/1 mA h cm-2, surpassing that of the bare zinc cell by more than 100 folds. At a current density of 5 A g-1, the Zn@ZMO//V2O5 cell can still achieve a specific capacity of 167.0 mA h g-1 after 500 cycles with a capacity retention rate of 88%, which demonstrates its long-term cycling stability.

13.
Phytomedicine ; 128: 155324, 2024 Jun.
Artigo em Inglês | MEDLINE | ID: mdl-38552437

RESUMO

BACKGROUND: Researchers have not studied the integrity, orderly correlation, and dynamic openness of complex organisms and explored the laws of systems from a global perspective. In the context of reductionism, antidepressant development formerly focused on advanced technology and molecular details, clear targets and mechanisms, but the clinical results were often unsatisfactory. PURPOSE: MDD represents an aggregate of different and highly diverse disease subtypes. The co-occurrence of stress-induced nonrandom multimorbidity is widespread, whereas only a fraction of the potential clusters are well known, such as the MDD-FGID cluster. Mapping these clusters, and determining which are nonrandom, is vital for discovering new mechanisms, developing treatments, and reconfiguring services to better meet patient needs. STUDY DESIGN: Acute stress 15-minute forced swimming (AFS) or CUMS protocols can induce the nonrandom MDD-FGID cluster. Multiple biological processes of rats with depression-like behaviours and gastrointestinal dysmobility will be captured under conditions of stress, and the Fructus Aurantii-Rhizoma Chuanxiong (ZQCX) decoction will be utilized to dock the MDD-FGID cluster. METHODS/RESULTS: Here, Rhizoma Chuanxiong, one of the seven components of Chaihu-shugan-San, elicited the best antidepressant effect on CUMS rats, followed by Fructus Aurantii. ZQCX reversed AFS-induced depression-like behaviours and gastrointestinal dysmobility by regulating the glutamatergic system, AMPAR/BDNF/mTOR/synapsin I pathway, ghrelin signalling and gastrointestinal nitric oxide synthase. Based on the bioethnopharmacological analysis strategy, the determined meranzin hydrate (MH) and senkyunolide I (SI) by UPLC-PDA, simultaneously absorbed by the jejunum and hippocampus of rats, have been considered major absorbed bioactive compounds acting on behalf of ZQCX. Cotreatment with MH and SI at an equivalent dose in ZQCX synergistically replicated over 50.33 % efficacy of the parent formula in terms of antidepressant and prokinetic actions by modulating neuroinflammation and ghrelin signalling. CONCLUSION: Brain-centric mind shifts require the integration of multiple central and peripheral systems and the elucidation of the underlying neurobiological mechanisms that ultimately contribute to novel therapeutic options. Ghrelin signalling and the immune system may partially underlie multimorbidity vulnerability, and ZQCX anchors stress-induced MDD-FGID clusters by docking them. Combining the results of micro details with the laws of the macro world may be more effective in finding treatments for MDD.


Assuntos
Medicamentos de Ervas Chinesas , Ratos Sprague-Dawley , Estresse Psicológico , Animais , Medicamentos de Ervas Chinesas/farmacologia , Estresse Psicológico/tratamento farmacológico , Masculino , Ratos , Antidepressivos/farmacologia , Modelos Animais de Doenças , Gastroenteropatias/tratamento farmacológico , Depressão/tratamento farmacológico , Transtorno Depressivo Maior/tratamento farmacológico , Motilidade Gastrointestinal/efeitos dos fármacos , Sistemas Neurossecretores/efeitos dos fármacos , Comportamento Animal/efeitos dos fármacos , Citrus/química , Fator Neurotrófico Derivado do Encéfalo/metabolismo
14.
BMC Cardiovasc Disord ; 24(1): 135, 2024 Mar 02.
Artigo em Inglês | MEDLINE | ID: mdl-38431545

RESUMO

Takotsubo syndrome (TTS), commonly referred to as "broken heart syndrome," is a distinctive form of acute and reversible heart failure that primarily affects young to middle-aged individuals, particularly women. While emotional or physical stressors often trigger TTS, rare cases have been linked to interventional procedures for congenital heart disease (CHD). Despite its recognition, the exact causes of TTS remain elusive. Research indicates that dysregulation in autonomic nerve function, involving sympathetic and parasympathetic activities, plays a pivotal role. Genetic factors, hormonal influences like estrogen, and inflammatory processes also contribute, unveiling potential gender-specific differences in its occurrence. Understanding these multifaceted aspects of TTS is crucial for refining clinical approaches and therapies. Continued research efforts will not only deepen our understanding of this syndrome but also pave the way for more targeted and effective diagnostic and treatment strategies. In this report, we conduct an in-depth analysis of a case involving a TTS patient, examining the illness progression and treatment procedures. The aim of this analysis is to enhance the understanding of TTS among primary care physicians. By delving into this case, we aspire to prevent misdiagnosis of typical TTS cases that patients may present, thereby ensuring a more accurate diagnosis and appropriate treatment.


Assuntos
Permeabilidade do Canal Arterial , Insuficiência Cardíaca , Cardiomiopatia de Takotsubo , Pessoa de Meia-Idade , Humanos , Feminino , Cardiomiopatia de Takotsubo/diagnóstico por imagem , Cardiomiopatia de Takotsubo/etiologia , Permeabilidade do Canal Arterial/complicações , Insuficiência Cardíaca/complicações , Emoções , Síndrome
15.
Front Endocrinol (Lausanne) ; 15: 1350958, 2024.
Artigo em Inglês | MEDLINE | ID: mdl-38469138

RESUMO

With the development of social population ageing, bone fracture has become a global public health problem due to its high morbidity, disability and mortality. Fracture healing is a complex phenomenon involving the coordinated participation of immigration, differentiation and proliferation of inflammatory cells, angioblasts, fibroblasts, chondroblasts and osteoblasts which synthesize and release bioactive substances of extracellular matrix components, Mortality caused by age-related bone fractures or osteoporosis is steadily increasing worldwide as the population ages. Fibroblasts play an important role in the process of fracture healing. However, it is not clear how the growth factors and extracellular matrix stiffness of the bone-regeneration microenvironment affects the function of osteoblasts and fibroblasts in healing process. Therefore, this article focuses on the role of fibroblasts in the process of fracture healing and mechanisms of research progress.


Assuntos
Fraturas Ósseas , Osteoporose , Humanos , Consolidação da Fratura , Regeneração Óssea , Fibroblastos
16.
Neurochem Int ; 175: 105718, 2024 May.
Artigo em Inglês | MEDLINE | ID: mdl-38490487

RESUMO

Alzheimer's disease (AD) is the most common cause of dementia in the elderly. Recent evidence suggests that gamma-aminobutyric acid B (GABAB) receptor-mediated inhibition is a major contributor to AD pathobiology, and GABAB receptors have been hypothesized to be a potential target for AD treatment. The aim of this study is to determine how GABAB regulation alters cognitive function and brain activity in an AD mouse model. Early, middle and late stage (8-23 months) amyloid precursor protein (APP) and presenilin 1 (PS1) transgenic mice were used for the study. The GABAB agonist baclofen (1 and 2.5 mg/kg, i. p.) and the antagonist phaclofen (0.5 mg/kg, i. p.) were used. Primarily, we found that GABAB activation was able to improve spatial and/or working memory performance in early and late stage AD animals. In addition, GABAB activation and inhibition could regulate global and local EEG oscillations in AD animals, with activation mainly regulating low-frequency activity (delta-theta bands) and inhibition mainly regulating mid- and high-frequency activity (alpha-gamma bands), although the regulated magnitude at some frequencies was reduced in AD. The cognitive improvements in AD animals may be explained by the reduced EEG activity in the theta frequency band (2-4 Hz). This study provides evidence for a potential therapeutic effect of baclofen in the elderly AD brain and for GABAB receptor-mediated inhibition as a potential therapeutic target for AD.


Assuntos
Doença de Alzheimer , Precursor de Proteína beta-Amiloide , Humanos , Camundongos , Animais , Idoso , Precursor de Proteína beta-Amiloide/genética , Precursor de Proteína beta-Amiloide/metabolismo , Camundongos Transgênicos , Baclofeno/farmacologia , Presenilina-1/genética , Receptores de GABA-B , Doença de Alzheimer/tratamento farmacológico , Doença de Alzheimer/metabolismo , Ácido gama-Aminobutírico , Cognição , Eletroencefalografia , Modelos Animais de Doenças
17.
ISME J ; 18(1)2024 Jan 08.
Artigo em Inglês | MEDLINE | ID: mdl-38365240

RESUMO

Delineating cohesive ecological units and determining the genetic basis for their environmental adaptation are among the most important objectives in microbiology. In the last decade, many studies have been devoted to characterizing the genetic diversity in microbial populations to address these issues. However, the impact of extreme environmental conditions, such as temperature and salinity, on microbial ecology and evolution remains unclear so far. In order to better understand the mechanisms of adaptation, we studied the (pan)genome of Exiguobacterium, a poly-extremophile bacterium able to grow in a wide range of environments, from permafrost to hot springs. To have the genome for all known Exiguobacterium type strains, we first sequenced those that were not yet available. Using a reverse-ecology approach, we showed how the integration of phylogenomic information, genomic features, gene and pathway enrichment data, regulatory element analyses, protein amino acid composition, and protein structure analyses of the entire Exiguobacterium pangenome allows to sharply delineate ecological units consisting of mesophilic, psychrophilic, halophilic-mesophilic, and halophilic-thermophilic ecotypes. This in-depth study clarified the genetic basis of the defined ecotypes and identified some key mechanisms driving the environmental adaptation to extreme environments. Our study points the way to organizing the vast microbial diversity into meaningful ecologically units, which, in turn, provides insight into how microbial communities adapt and respond to different environmental conditions in a changing world.


Assuntos
Exiguobacterium , Extremófilos , Genômica , Filogenia , Proteínas
18.
Sci Rep ; 14(1): 577, 2024 01 05.
Artigo em Inglês | MEDLINE | ID: mdl-38182638

RESUMO

Sarcomas (SARC) are a highly heterogeneous cancer type that is prone to recurrence and metastasis. Numerous studies have confirmed that Siglecs are involved in immune signaling and play a key role in regulating immune responses in inflammatory diseases and various cancers. However, studies that systematically explore the therapeutic and prognostic value of Siglecs in SARC patients are very limited. The online databases GEPIA, UALCAN, TIMER, The Kaplan-Meier Plotter, GeneMANIA, cBioPortal, and STING were used in this study. IHC staining was performed on the collected patient tissues, and clinical data were statistically analyzed. The transcript levels of most Siglec family members showed a high expression pattern in SARC. Compared with normal tissues, Siglec-5, Siglec-10, and Siglec-12 were abnormally highly expressed in tumor tissues. Importantly, Siglec-15 was significantly associated with poor prognosis. Functional enrichment analysis showed that the Siglec family was mainly enriched in hematopoietic cell lineages. The genes associated with molecular mutations in the Siglec family were mainly TP53 and MUC16, among which Siglec-2 and Siglec-15 were significantly associated with the survival of patients. The expression levels of all Siglec family members were significantly correlated with various types of immune cells (B cells, CD8 + T cells, CD4 + T cells, macrophages, neutrophils and dendritic cells). Furthermore, a significant correlation was found between the somatic copy number changes of all Siglec molecules and the abundance of immune infiltrates. Our study paints a promising vision for the development of immunotherapy drugs and the construction of prognostic stratification models by investigating the therapeutic and prognostic potential of the Siglec family for SARC.


Assuntos
Sarcoma , Neoplasias de Tecidos Moles , Humanos , Lectinas Semelhantes a Imunoglobulina de Ligação ao Ácido Siálico/genética , Prognóstico , Sarcoma/genética , Biomarcadores , Microambiente Tumoral/genética
19.
Cereb Cortex ; 34(2)2024 01 31.
Artigo em Inglês | MEDLINE | ID: mdl-38244565

RESUMO

Impairments in working memory (WM) are evident in both clinically diagnosed patients with mild cognitive decline and older adults at risk, as indicated by lower scores on neuropsychological tests. Examining the WM-related neural signatures in at-risk older adults becomes essential for timely intervention. WM functioning relies on dynamic brain activities, particularly within the frontoparietal system. However, it remains unclear whether the cognitive decline would be reflected in the decreased dynamic reconfiguration of brain coactivation states during WM tasks. We enrolled 47 older adults and assessed their cognitive function using the Montreal Cognitive Assessment. The temporal dynamics of brain coactivations during a WM task were investigated through graph-based time-frame modularity analysis. Four primary recurring states emerged: two task-positive states with positive activity in the frontoparietal system (dorsal attention and central executive); two task-negative states with positive activity in the default mode network accompanied by negative activity in the frontoparietal networks. Heightened WM load was associated with increased flexibility of the frontoparietal networks, but the cognitive decline was correlated with reduced capacity for neuroplastic changes in response to increased task demands. These findings advance our understanding of aberrant brain reconfiguration linked to cognitive decline, potentially aiding early identification of at-risk individuals.


Assuntos
Disfunção Cognitiva , Memória de Curto Prazo , Humanos , Idoso , Memória de Curto Prazo/fisiologia , Encéfalo/diagnóstico por imagem , Encéfalo/fisiologia , Cognição/fisiologia , Disfunção Cognitiva/diagnóstico por imagem , Mapeamento Encefálico , Testes Neuropsicológicos , Imageamento por Ressonância Magnética
20.
Geroscience ; 46(1): 447-462, 2024 Feb.
Artigo em Inglês | MEDLINE | ID: mdl-37698782

RESUMO

Older adults often have difficulty in making decisions under uncertainty, increasing the risk of financial exploitation. However, it is still under investigation about the extent to which cognitive decline influences risky decision-making and the underlying neural correlates. We hypothesized that the individual differences of risk-taking behavior depend on cognitive integrity, in which the dorsal and ventral fronto-amygdala connectivity would play dissociable roles. In the current study, thirty-six young and 51 older adults were tested with the Iowa gambling task combing resting-state and task-related functional magnetic resonance imaging. The results showed significant changes in behaviors and the fronto-amygdala network in older adults relative to young adults. More importantly, age-effect on risk-taking behaviors was remarkably different in cognitively normal and impaired older adults. In resting-state analysis, task performance was positively correlated with the ventral fronto-amygdala connectivity and negatively correlated with the dorsal fronto-amygdala connectivity in cognitively impaired older adults, compared with cognitively normal individuals. Furthermore, task-related analysis confirmed the relationships between dorsal/ventral fronto-amygdala network and risk-taking behaviors depending on cognitive integrity. These findings indicate that the fronto-amygdala network is crucial for understanding altered risky decision-making in aging, suggesting dissociable contributions of the dorsal and ventral pathways in the context of cognitive decline.


Assuntos
Tonsila do Cerebelo , Disfunção Cognitiva , Humanos , Idoso , Tonsila do Cerebelo/diagnóstico por imagem , Envelhecimento/psicologia
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA