Single-Shot Readout of a Nuclear Spin in Silicon Carbide.

Solid-state qubits with a photonic interface is very promising for quantum networks. Color centers in silicon carbide have shown excellent optical and spin coherence, even when integrated with membranes and nanostructures. Additionally, nuclear spins coupled with electron spins can serve as long-lived quantum memories. Pioneering work previously has realized the initialization of a single nuclear spin and demonstrated its entanglement with an electron spin. In this Letter, we report the first realization of single-shot readout for a nuclear spin in SiC. We obtain a deterministic nuclear spin initialization and readout fidelity of 94.95% with a measurement duration of 1 ms. With a dual-step readout scheme, we obtain a readout fidelity as high as 99.03% within 0.28 ms by sacrificing the success efficiency. Our Letter complements the experimental toolbox of harnessing both electron and nuclear spins in SiC for future quantum networks.

Experimental Generation of Spin-Photon Entanglement in Silicon Carbide.

A solid-state approach for quantum networks is advantageous, as it allows the integration of nanophotonics to enhance the photon emission and the utilization of weakly coupled nuclear spins for long-lived storage. Silicon carbide, specifically point defects within it, shows great promise in this regard due to the easy of availability and well-established nanofabrication techniques. Despite of remarkable progresses made, achieving spin-photon entanglement remains a crucial aspect to be realized. In this Letter, we experimentally generate entanglement between a silicon vacancy defect in silicon carbide and a scattered single photon in the zero-phonon line. The spin state is measured by detecting photons scattered in the phonon sideband. The photonic qubit is encoded in the time-bin degree of freedom and measured using an unbalanced Mach-Zehnder interferometer. Photonic correlations not only reveal the quality of the entanglement but also verify the deterministic nature of the entanglement creation process. By harnessing two pairs of such spin-photon entanglement, it becomes straightforward to entangle remote quantum nodes at long distance.

First Report of Meloidogyne arenaria Infecting Maize in Guizhou Province of China.

Maize (Zea mays L.) as the most important crops is globally cultivated for food, feedstuff and industrial raw materials. During August to September 2021, we carried out a survey on the soil-borne diseases of tobacco in Guizhou Province. Poorly developed maize plants were observed in the same field of root-knot nematode (RKN) infected tobacco (Nicotiana tabacum L.) in Dafang County, Bijie City (106º00'08"E, 22º24'81"N) (Figure 1A). Roots of maize plant were taken back to laboratory for nematode identification and infecting confirmation in greenhouse. Females, males, second-stage juveniles (J2s) and eggs were collected from the sampling roots and nematodes were identified based on morphological and molecular characteristics. The identification of the nematode was performed by observations of morphological characters of adults (n= 30) and molecular analysis. Perineal pattern of female showed distinct characteristics of a low dorsal arch and lateral field marked by forked and broken striae and without punctate markings between the anus and tail terminus (Fig. 1B). J2s hatched from eggs demonstrated the morphometric characters of body length = 433.25 µm, body width = 16.31 µm, stylet length = 10.43 µm. DGO = 3.62 µm, tail length = 52.78 µm, and hyaline tail terminus = 11.14 µm (Fig. 1C). For molecular analysis, females from infected roots of maize in fields and in Koch's postulate experiment were definitively identified via PCR using the M. arenaria species-specific markers (Far/Rar：TCGGCGATAGAGGTAAATGAC/TCGGCGATAGACACTACAACT). PCR products of females amplification were run in the agar gel, and a PCR product of 420 bp band was identified for M. arenaria for all tested female samples (Fig. 1E). The obtained specific fragment was sequenced and submitted to GenBank with accession number of OP503512. A 100% identity of the Fare/Rare sequence with M. arenaria (Accession: GQ395518.1, J. Phytopathol. 160(2): 59-66, 2012, MZ555757.1，MZ555753.1, U42342.1）were found through NCBI blast. Therefore, based on morphological and molecular analysis, the nematodes from maize were determined to be M. arenaria according to the related description of (Perry et al., 2009). Koch's postulate was conducted in greenhouse by inoculation of J2 from the original population to pots containing two-week old maize seedlings (n= 15, 1000 J2/seedling) and 5 seedlings were nonincubated as controls. Plants were maintained in greenhouse at 26 to 28°C. On day 50 after inoculation, all the inoculated plants showed typical RKN symptoms such as stunting and galled roots which were similar to those observed in the field (Fig. 2A). Females, J2 and eggs were found in the roots after staining(Fig. 2B, C, D) by the method of Bybd et al. (1983), while uninoculated control plants presented normal development, confirming that Maize was a host of M. arenaria. M. arenaria is one of the most damaging plant-parasitic nematodes, which can infect many crops worldwide, resulting in great losses on the crop quality and yield. The Southern Root-Knot Nematode (M. incognita) had been known to cause root-knot nematode disease on maize in Shandong Province of China(Shi et al.,2020). As a major rotation crop, maize was recommended for the management of RKNs and most soil-born pathogens in tobacco planting systems in China. However, the findings of M. arenaria on maize demonstrates that further investigation and management strategies should be conduct. To our knowledge, this is the first report of M. arenaria parasitizing maize in Guizhou province of China.

Complete chloroplast genome of the grain Chenopodium quinoa Willd., an important economical and dietary plant.

The grain Chenopodium quinoa Willd. is the main traditional food of Inca aboriginal, which was a native grain in South American Andes Mountains, the edible and cultivation history of which has been more than five thousand years. In this study, we sequenced the complete chloroplast genome of C. quinoa on the Illumina platform by shotgun genome skimming method. The complete chloroplast genome of C. quinoa was 152,087 bp in length with the GC content 37.2%, which was comprised of a large single copy (LSC) region of 83,570 bp, a small single copy (SSC) region of 18,107 bp, and a pair of inverted repeats (IRA/IRB) of 25,205 bp. The chloroplast genome encoded 133 genes including 88 protein-coding genes, 37 tRNA genes and eight rRNA genes. Phylogenetic analysis constructed using the maximum likelihood (ML) method strongly supported the monophyly of each genus in the family Chenopodiaceae, and the genus Chenopodium is sister to Spinacia as a cluster, which closely grouped to Dysphania.

Complete mitochondrial genome of Chrysolophus pictus (Galliformes: Phasianidae), a national protected wild pheasant in China.

The complete mitochondrial genome (mitogenome) of golden pheasant Chrysolophus pictus from North China was sequenced by the shotgun genome skimming methods. The mitogenome of C. pictus was 16,678 bp in length, consisting of 13 protein-coding genes, 22 tRNA genes, two rRNA genes and one non-coding control region (D-loop). Its overall base composition was 30.4% A, 24.8% T, 31.2% C and 13.6% G. All protein-coding genes had a typical ATG initiation codon except COX1 with GTG and terminated with a TAN codon, whereas COX1 terminated with a codon of AGG, COX3, ND2 and ND4 terminated with a single T. The ML phylogenetic tree constructed using 13 protein-coding genes showed that Chrysolophus species formed a monophyletic group, which was sister to the clade clustered by the two genera Crossoptilon and Lophura.

Complete mitochondrial genome of Mustela sibirica (Carnivora: Mustelidae), a protected and endangered species in China.

We sequenced the complete mitochondrial genome (mitogenome) of Mustela sibirica in China by the shotgun genome skimming methods. The mitogenome of M. sibirica is 16,558bp in length with the base composition of 32.9% A, 27.3% T, 26.0% C, and 13.9% G, and consists of 13 protein-coding genes (PCGs), 22 tRNAs, two rRNAs, and one non-coding control region. The 13 PCGs use ATG as initiation codons except ND3, ND5 and ND2 which initiate with codons ATA and ATT, respectively. Four (COX3, ND1, ND2 and ND4) of the 13 PCGs terminate with a single T- -, and the remainder with a TAA termination codon except ND3 and CYT B using TA- and AGA as termination codon. The phylogenetic tree based on 13 protein-coding genes indicated that M. sibirica is sister to the clade grouped with three species M. nigripes, M. eversmannii, and M. putorius, and Mustelinae species formed a monophyletic group, which is close to the Lutrinae clade within Mustelidae.

[Cloning,expression and characterization of chalcone isomerase from medicinal plant Chinese sumac (Rhus chinensis)].

Flavonoids are a group of secondary metabolites found in plants. They have many pharmacological functions and play an important role in Chinese sumac( Rhus chinensis),which is a well-known traditional Chinese medicinal plant. Chalcone isomerase( CHI,EC 5. 5. 1. 6) is one of the key enzymes in the flavonoids biosynthesis pathway. In this paper,the full-length c DNA sequence encoding the chalcone isomerase from R. chinensis( designated as Rc CHI) was cloned by RT-PCR and rapid-amplification of c DNA Ends( RACE). The Rc CHI c DNA sequence was 1 058 bp and the open reading frame( ORF) was 738 bp. The ORF predicted to encode a 245-amino acid polypeptide. Rc CHI gene contained an intron and two exons. The sequence alignments revealed Rc CHI shared47. 1%-71. 6% identity with the homologues in other plants. Real-time PCR analysis showed that the total flavonoid levels were positively correlated with tissue-specific expressions of Rc CHI mRNA in different tissues. The recombinant protein was successfully expressed in an Escherichia coli strain with the p GEX-6 P-1 vector. In this paper,the CHI gene was cloned and characterized in the family of Anacardiaceae and will help us to obtain better knowledge of the flavonoids biosynthesis of the flavonoid compounds in R. chinensis.

Clcn3 deficiency ameliorates high-fat diet-induced obesity and adipose tissue macrophage inflammation in mice.

Obesity induces accumulation of adipose tissue macrophages (ATMs) and ATM-driven inflammatory responses that promote the development of glucose and lipid metabolism disorders. ClC-3 chloride channel/antiporter, encoded by the Clcn3, is critical for some basic cellular functions. Our previous work has shown significant alleviation of type 2 diabetes in Clcn3 knockout (Clcn3-/-) mice. In the present study we investigated the role of Clcn3 in high-fat diet (HFD)-induced obesity and ATM inflammation. To establish the mouse obesity model, both Clcn3-/- mice and wild-type mice were fed a HFD for 4 or 16 weeks. The metabolic parameters were assessed and the abdominal total adipose tissue was scanned using computed tomography. Their epididymal fat pad tissue and adipose tissue stromal vascular fraction (SVF) cells were isolated for analyses. We found that the HFD-fed Clcn3-/- mice displayed a significant decrease in obesity-induced body weight gain and abdominal visceral fat accumulation as well as an improvement of glucose and lipid metabolism as compared with HFD-fed wild-type mice. Furthermore, the Clcn3 deficiency significantly attenuated HFD-induced ATM accumulation, HFD-increased F4/80+ CD11c+ CD206- SVF cells as well as HFD-activated TLR-4/NF-κB signaling in epididymal fat tissue. In cultured human THP-1 macrophages, adenovirus-mediated transfer of Clcn3 specific shRNA inhibited, whereas adenovirus-mediated cDNA overexpression of Clcn3 enhanced lipopolysaccharide-induced activation of NF-κB and TLR-4. These results demonstrate a novel role for Clcn3 in HFD-induced obesity and ATM inflammation.

Complete mitochondrial genome of Rhus gall aphid Meitanaphis microgallis (Hemiptera: Aphididae: Eriosomatinae).

We sequenced the complete mitochondrial genome of the Chinese Rhus gall aphid Meitanaphis microgallis (Hemiptera: Aphididae: Eriosomatinae: Fordini) by the genome skimming method on an Illunima platform. The assembled mitogenome is 16,191 bp in length with a very high A + T content of 84.3%. This genome consists of 13 protein-coding genes, 22 tRNAs, 2 rRNAs, and a control region. All the protein-coding genes have a typical ATN initiation codon and TAA termination codon except COX1 and ND4 with a single T as stop codon. The tRNAs ranged in size from 59 to 77 bp and formed a clover-leaf secondary structure except tRNA-Ser (AGN). We constructed the phylogenetic relationship of Fordini aphids including all the Rhus gall aphids, and the ML tree showed that M. microgallis grouped with M. elongallis as its sister group.

Complete mitochondrial genome of Capreolus pygargus (Cervidae: Capreolinae), a protected and threatened species in China.

We sequenced the complete mitochondrial genome (mitogenome) of Siberian Roe Deer, Capreolus pygargus, in China by the shotgun genome-skimming methods. The mitogenome of C. pygargus is totally 16,353 bp in length and contains 13 protein-coding genes (PCGs), 22 tRNA genes, two rRNA genes, and a control region. The sequence has a higher A + T content of 63.4% than G + C 36.6% and with a base composition of 33.4% A, 23.2% C, 13.4% G, and 30.0% T. All of the 13 PCGs initiate a typical ATN codon except Nd4L with GTG. Six PCGs terminate with a TAA codon, while Cyt b, Atp8, and Nd1 terminate with AGA, TAG, and TA-, respectively. Whereas, Cox3, Nd2, Nd3, and Nd4 terminate with a single T-. The phylogenetic trees of the subfamily Capreolinae with 13 PCGs indicated that Capreolus species were well-supported as a monophyletic group, which is sister to the clade of Hydropotes with well-support.

Complete mitochondrial genome of Ciconia nigra (Ciconiiformes: Ciconiidae), a threatened stork in China.

The complete mitochondrial genome (mitogenome) of black stork Ciconia nigra from North China was sequenced by shotgun genome-skimming method. The mitogenome of C. nigra was 17,787 bp in length and consists of 13 protein-coding genes, 22 tRNAs, two rRNAs, and one non-coding control region (D-loop). All protein-coding genes initiate with ATG codon except for ND2, ND3, and COX1, which uses ATA, ATC, and GTG as their initiation codons, respectively. The termination codon of protein-coding genes shows rich diversity with six termination codons (TAA, AGG, AGA, TAG, T, and A). The phylogenetic trees based on 13 protein-coding genes showed that Ciconia formed a monophyletic group, which was sister to the clade clustered by Threskiorothidae species.

Complete mitochondrial genome of Prionailurus bengalensis (Carnivora: Felidae), a protected species in China.

The complete mitochondrial genome (mitogenome) of the leopard cat Prionailurus bengalensis in China was sequenced using the shotgun genome-skimming method. The mitogenome of P. bengalensis is totally 17,006 bp in length with a higher A + T content of 60.4% than that of G + C and consists of 13 protein-coding genes (PCGs), two rRNAs, 22 tRNAs, and one non-coding control region. All the PCGs initiate with a typical ATN codon and terminate with a TAA codon except for the four PCGs (COX1, ND2, ND3, and ND4) terminating with a single T-and one gene CYT B with AGA as stop codon. Most of the tRNA genes have a clover-leaf secondary structure except for tRNAS (AGN), which loses a dihydrouridine (DHU) arm. The ML phylogenetic tree showed that P. viverrinus nested in the group of P. bengalensis individuals, which is close to the clade clustered by the two genera Otocolobus and Felis.

Complete mitochondrial genome of the North American Rhus gall aphid Melaphis rhois (Hemiptera: Aphididae: Eriosomatinae).

We sequenced the complete mitochondrial genome (mitogenome) for the North American Rhus gall aphid species Melaphis rhois. The mitogenome is 15,436 bp in length with a high A + T content of 82.7%, consisting of 13 protein-coding genes, 22 tRNA genes, 2 rRNA genes, and a control region. Its gene order is identical to that of the eastern Asian species Schlechtendalia chinensis. All protein-coding genes start with a typical ATN codon and terminate with a TAA codon except COI and ND4 by a single T residue. All the tRNAs except tRNACys formed a clover-leaf secondary structure. The mitogenome phylogeny of Aphididae suggests that M. rhois is most closely related to the eastern Asian Rhus gall aphid S. chinensis with the present sampling scheme.

Complete mitochondrial genome of the Rhus gall aphid Schlechtendalia chinensis (Hemiptera: Aphididae: Eriosomatinae).

We sequenced the first complete mitochondrial genome for the aphid subfamily, Eriosomatinae, from a Rhus gall aphid, Schlechtendalia chinensis. The mitogenome of S. chinensis is 16,047 bp in length with a high A + T content of 84.2% and consists of 13 protein-coding genes, 24 tRNA genes including two extra tRNAPhe , two rRNA genes, a repeat region, and a control region. All protein-coding genes have a typical ATN initiation codon and TAA termination codon except COI and ND4, which terminate with a single T. All 24 tRNAs have the expected clover-leaf secondary structure and range in size from 62 to 73 bp. The lengths of rrnL and rrnS genes are 1274 and 772 bp, respectively. The repeat region is 335 bp and is uncommon among known aphid sequences for starting with a tRNAPhe . The control region is 705 bp in length and is located between rrnS and tRNAIle . We present a phylogeny of mitogenomes showing that S. chinensis is sister to Aphidinae.

Clinical Analysis of Familial Nonmedullary Thyroid Carcinoma.

OBJECTIVE: To analyze the clinical characteristics of familial nonmedullary thyroid carcinoma (FNMTC), in order to provide evidence for early diagnosis and treatment. METHODS: We retrospectively investigated the inpatients between September 2006 and September 2013 in the First Bethune Hospital of Jilin University, in which 78 patients with FNMTC from 31 families were analyzed by a comparison with 3445 control cases from the patients with sporadic nonmedullary thyroid carcinoma (SNMTC). RESULTS: There was no significant difference in gender, age, and tumor size between FNMTC and SNMTC patients. However, the characteristics of disease in multifoci, neck lymph node metastasis, invasion to the surrounding tissues, and coexistence with Hashimoto disease in two types of cancer patients show significant difference. They are: multifoci: 71.8% (56/78) in FNMTC versus 46.3% (1595/3445) in SNMTC; neck lymph node metastasis: 52.6% (41/78) in FNMTC versus 33.3% (1148/3445) in SNMTC; surrounding tissue invasion: 64.1% (50/78) in FNMTC versus 48.5% (1670/3445) in SNMTC; coexistence with Hashimoto disease: 30.8% (24/78) in FNMTC versus 20.0% (689/3445) in SNMTC. CONCLUSION: Lymph node metastasis, multifoci, invasion to the surrounding tissues, and combination with chronic lymphocytic thyroiditis are the main features of FNMTC, which suggests the extent of the operation for FNMTC patients should be amplified properly.

RNA sequencing analysis reveals transcriptomic variations in tobacco (Nicotiana tabacum) leaves affected by climate, soil, and tillage factors.

The growth and development of plants are sensitive to their surroundings. Although numerous studies have analyzed plant transcriptomic variation, few have quantified the effect of combinations of factors or identified factor-specific effects. In this study, we performed RNA sequencing (RNA-seq) analysis on tobacco leaves derived from 10 treatment combinations of three groups of ecological factors, i.e., climate factors (CFs), soil factors (SFs), and tillage factors (TFs). We detected 4980, 2916, and 1605 differentially expressed genes (DEGs) that were affected by CFs, SFs, and TFs, which included 2703, 768, and 507 specific and 703 common DEGs (simultaneously regulated by CFs, SFs, and TFs), respectively. GO and KEGG enrichment analyses showed that genes involved in abiotic stress responses and secondary metabolic pathways were overrepresented in the common and CF-specific DEGs. In addition, we noted enrichment in CF-specific DEGs related to the circadian rhythm, SF-specific DEGs involved in mineral nutrient absorption and transport, and SF- and TF-specific DEGs associated with photosynthesis. Based on these results, we propose a model that explains how plants adapt to various ecological factors at the transcriptomic level. Additionally, the identified DEGs lay the foundation for future investigations of stress resistance, circadian rhythm and photosynthesis in tobacco.

[Rules and impact factors of greenhouse gases emission in the saline-alkali paddy fields in different years].

With the method of combining field sampling and plot test, we took saline-alkali paddy field of Qianguo county, Jilin province as an investigation object. According to the nature of soil in the area, we monitored CH4 and N2O which released from soil during rice growth period and tested the soil pH and soil organic carbon to analyze the law and reasons of greenhouse gas emission in the paddy fields. The results showed that N2O emission from paddy fields presented three peaks with distinct seasonal patterns. Application of fertilizer provided additional reactive substrate, which affected N2O emission significantly. Under flooding conditions, the main source of N2O is a denitrification process, while after drainage, nitrification was the predominance. CH4 emission showed a single peak at rice tillering stage when rice grew vigorously. That deoxidation condition dominated in the deep water layer in the paddy fields provided suitable conditions for CH4 producing microorganisms, which result in the emergence of CH4 emission peak. The pH doesn't have an obvious influence on CH4 and N2O, while SOC content in soil and pattern of CH4 emission showed a significantly positive correlation.

Identification and quantitation of glycosidically bound aroma compounds in three tobacco types by gas chromatography-mass spectrometry.

Glycosidically bound aroma compounds in three different types of tobacco were investigated. After isolation of extracts obtained by Amberlite XAD-2 adsorption and ethyl acetate elution, glycosides were analyzed after enzymatic hydrolysis by gas chromatography-mass spectrometry (GC-MS) or directly after trifluoroacetylated (TFA) derivatization by GC-MS in electron ionization (EI) and negative chemical ionization (NCI) mode. In total 21 bound aglycones were identified by ß-glucosidase hydrolysis. These aglycones mainly consisted of C13-norisoprenoids, aromatic components and sesquiterpenoids. Additionally, with the aid of enzymatic hydrolysis, 15 ß-d-glucopyranosides and 1 ß-d-rutinoside were tentatively identified by TFA derivatization. TFA method was validated by repeatability and successfully employed to analyze different types of tobacco. Principal component analysis (PCA) was carried out on identified glycoside variables to visualize the difference between the tobacco types and the relationship between the glycoside variables and the tobacco types was established.

Comparative transcriptome analysis of tobacco (Nicotiana tabacum) leaves to identify aroma compound-related genes expressed in different cultivated regions.

To identify genes that are differentially expressed in tobacco in response to environmental changes and to decipher the mechanisms by which aromatic carotenoids are formed in tobacco, an Agilent Tobacco Gene Expression microarray was adapted for transcriptome comparison of tobacco leaves derived from three cultivated regions of China, Kaiyang (KY), Weining (WN) and Tianzhu (TZ). A total of 1,005 genes were differentially expressed between leaves derived from KY and TZ, 733 between KY and WN, and 517 between TZ and WN. Genes that were upregulated in leaves from WN and TZ tended to be involved in secondary metabolism pathways, and included several carotenoid pathway genes, e.g., NtPYS, NtPDS, and NtLCYE, whereas those that were down-regulated tended to be involved in the response to temperature and light. The expression of 10 differentially expressed genes (DEGs) was evaluated by real-time quantitative polymerase chain reaction (qRT-PCR) and found to be consistent with the microarray data. Gene Ontology and MapMan analyses indicate that the genes that were differentially expressed among the three cultivated regions were associated with the light reaction of photosystem II, response to stimuli, and secondary metabolism. High-performance liquid chromatography (HPLC) analysis showed that leaves derived from KY had the lowest levels of lutein, ß-carotene, and neoxanthin, whereas the total carotenoid content in leaves from TZ was greatest, a finding that could well be explained by the expression patterns of DEGs in the carotenoid pathway. These results may help elucidate the molecular mechanisms underlying environmental adaptation and accumulation of aroma compounds in tobacco.

[Polymorphism in coding region of pig PRDX6 gene and its genetic effects analysis].

PRDX6, a member of antioxidant protein superfamily, plays an important role in oxidative stress, catabolism of lipids and phospholipid lipisomes. Therefore, we used PRDX6 as an important candidate gene for meat quality according to its physiological and biochemical function. Partial coding sequence of porcine PRDX6 was isolated and two potenial SNPs, one at 417 bp (C/T) and the other at 423 bp (A/G), were found in the fourth exon by comparison of the obtained sequence from different pig breeds. In order to explore the relationship between PRDX6 polymorphism and meat quality, genetic variation and trait association of these two SNPs were separately performed in 6 purebred pig population and 247 F2 "Large White x Meishan" resource population by pyrosequencing. The results showed that allele C was predominant in western pig breeds, while allele T was predominant in Chinese indigenous breeds at 417 bp (C/T). This SNP was significantly associated with the intramuscular fat and water moisture (P < 0.05). The A/G mutation at 423 bp was significantly associated with drip water rate, water holding capacity, intramuscular fat, and water moisture (P < 0.05). Allele A was predominant in western pig breeds, while allele G was predominant in Chinese indigenous breeds. These two SNPs were likely to be important markers affecting meat quality traits (especially the muscle tenderness).