Cardiac myosin inhibitor, CK-586, minimally reduces systolic function and ameliorates obstruction in feline hypertrophic cardiomyopathy.

Hypertrophic cardiomyopathy (HCM) remains the most common cardiomyopathy in humans and cats with few preclinical pharmacologic interventional studies. Small-molecule sarcomere inhibitors are promising novel therapeutics for the management of obstructive HCM (oHCM) patients and have shown efficacy in left ventricular outflow tract obstruction (LVOTO) relief. The objective of this study was to explore the 6-, 24-, and 48-hour (h) pharmacodynamic effects of the cardiac myosin inhibitor, CK-586, in six purpose-bred cats with naturally occurring oHCM. A blinded, randomized, five-treatment group, crossover preclinical trial was conducted to assess the pharmacodynamic effects of CK-586 in this oHCM model. Dose assessments and select echocardiographic variables were assessed five times over a 48-h period. Treatment with oral CK-586 safely ameliorated LVOTO in oHCM cats. CK-586 treatment dose-dependently eliminated obstruction (reduced LVOTOmaxPG), increased measures of systolic chamber size (LVIDs Sx), and decreased select measures of heart function (LV FS% and LV EF%) in the absence of impact on heart rate. At all tested doses, a single oral CK-586 dose resulted in improved or resolved LVOTO with well-tolerated, dose-dependent, reductions in LV systolic function. The results from this study pave the way for the potential use of CK-586 in both the veterinary and human clinical setting.

A novel ITGA2B double cytosine frameshift variant (c.1986_1987insCC) leads to Glanzmann's thrombasthenia in a cat.

BACKGROUND: Glanzmann's thrombasthenia (GT) is a congenital platelet disorder affecting approximately 1:1 000 000 people globally and characterized by impaired platelet aggregation and clot retraction. Autosomal recessive, loss-of-function, variants in ITGA2B or ITGB3 of the αIIbß3 receptor cause the disease in humans. A cat affected by Glanzmann's and macrothrombocytopenia was presented to the UC Davis VMTH. HYPOTHESIS/OBJECTIVES: Severe thrombopathia in this cat has an underlying genetic etiology. ANIMALS: A single affected patient, 2 age-matched clinically healthy controls, and a geriatric population (n = 20) of normal cats. METHODS: Physical examination and clinical pathology tests were performed on the patient. Flow cytometry and platelet aggregometry analyses for patient phenotyping were performed. Patient and validation cohort gDNA samples were extracted for Sanger sequencing of a previously identified ITGA2B (c.1986delC) variant. Reverse transcriptase PCR was performed on patient and healthy control PRP samples to verify ITGA2B variant consequence. RESULTS: A novel c.1986_1987insCC autosomal recessive variant in ITGA2B was identified. This variant was absent in a population of 194 unrelated cats spanning 44 different breeds. Complete loss of ITGA2B transcript and protein expression was verified by RT-PCR and flow cytometry, explaining the underlying etiology of GT, and likely macrothrombocytopenia, in this cat. CONCLUSIONS AND CLINICAL IMPORTANCE: This study emphasizes the role of precision medicine in cardiovascular disease of cats and identified yet another variant that may be of utility for screening in the feline population. This study provides a small-volume, standardized, successful protocol for adequate platelet RNA isolation and subsequent molecular assessment of gene expression in cats.

Multi-Omic, Histopathologic, and Clinicopathologic Effects of Once-Weekly Oral Rapamycin in a Naturally Occurring Feline Model of Hypertrophic Cardiomyopathy: A Pilot Study.

Hypertrophic cardiomyopathy (HCM) remains the single most common cardiomyopathy in cats, with a staggering prevalence as high as 15%. To date, little to no direct therapeutical intervention for HCM exists for veterinary patients. A previous study aimed to evaluate the effects of delayed-release (DR) rapamycin dosing in a client-owned population of subclinical, non-obstructive, HCM-affected cats and reported that the drug was well tolerated and resulted in beneficial LV remodeling. However, the precise effects of rapamycin in the hypertrophied myocardium remain unknown. Using a feline research colony with naturally occurring hereditary HCM (n = 9), we embarked on the first-ever pilot study to examine the tissue-, urine-, and plasma-level proteomic and tissue-level transcriptomic effects of an intermittent low dose (0.15 mg/kg) and high dose (0.30 mg/kg) of DR oral rapamycin once weekly. Rapamycin remained safe and well tolerated in cats receiving both doses for eight weeks. Following repeated weekly dosing, transcriptomic differences between the low- and high-dose groups support dose-responsive suppressive effects on myocardial hypertrophy and stimulatory effects on autophagy. Differences in the myocardial proteome between treated and control cats suggest potential anti-coagulant/-thrombotic, cellular remodeling, and metabolic effects of the drug. The results of this study closely recapitulate what is observed in the human literature, and the use of rapamycin in the clinical setting as the first therapeutic agent with disease-modifying effects on HCM remains promising. The results of this study establish the need for future validation efforts that investigate the fine-scale relationship between rapamycin treatment and the most compelling gene expression and protein abundance differences reported here.

The Role of Personalized Medicine in Companion Animal Cardiology.

Cardiomyopathies remain one of the most common inherited cardiac diseases in both human and veterinary patients. To date, well over 100 mutated genes are known to cause cardiomyopathies in humans with only a handful known in cats and dogs. This review highlights the need and use of personalized one-health approaches to cardiovascular case management and advancement in pharmacogenetic-based therapy in veterinary medicine. Personalized medicine holds promise in understanding the molecular basis of disease and ultimately will unlock the next generation of targeted novel pharmaceuticals and aid in the reversal of detrimental effects at a molecular level.

Sex-specific differences and predictors of echocardiographic measures of diastolic dysfunction in rhesus macaques (Macaca mulatta).

BACKGROUND: Diastolic dysfunction in humans is an age-related process with an overrepresentation in women. In rhesus macaques (Macaca mulatta), the incidence and predictors of diastolic dysfunction have yet to be reported. METHODS: Data from routine echocardiographic evaluations on clinically healthy rhesus macaques was obtained and used for univariate, bivariate, hypothesis testing, and linear regression statistical analyses interrogating differences and predictors of diastolic function. RESULTS: Rhesus macaques fully recapitulate previously reported human hemodynamic studies. Female monkeys display impaired diastology and are at an increased risk for developing diastolic dysfunction. Age, sex, and proxies of exercise activity are confirmed predictors for measures of diastolic dysfunction, regardless of specific pathogen-free status. CONCLUSIONS: Rhesus macaques share common sex- and age-related echocardiographic findings as humans, therefore, serve as a valuable translational nonhuman primate model for future studies of diastolic dysfunction. These findings confirm the importance of sex- and age-matching within future rhesus macaque cardiovascular research.

Delayed-release rapamycin halts progression of left ventricular hypertrophy in subclinical feline hypertrophic cardiomyopathy: results of the RAPACAT trial.

OBJECTIVE: Feline hypertrophic cardiomyopathy (HCM) remains a disease with little therapeutic advancement. Rapamycin modulates the mTOR pathway, preventing and reversing cardiac hypertrophy in rodent disease models. Its use in human renal allograft patients is associated with reduced cardiac wall thickness. We sought to evaluate the effects of once-weekly delayed-release (DR) rapamycin over 6 months on echocardiographic, biochemical, and biomarker responses in cats with subclinical, nonobstructive HCM. ANIMALS: 43 client-owned cats with subclinical HCM. METHODS: Cats enrolled in this double-blinded, multicentered, randomized, and placebo-controlled clinical trial were allocated to low- or high-dose DR rapamycin or placebo. Cats underwent physical examination, quality-of-life assessment, blood pressure, hematology, biochemistry, total T4, urinalysis, N-terminal pro-B-type natriuretic peptide, and cardiac troponin I at baseline and days 60, 120, and 180. Fructosamine was analyzed at screening and day 180. Echocardiograms were performed at all time points excluding day 120. Outcome variables were compared using a repeated measures ANCOVA. RESULTS: No demographic, echocardiographic, or clinicopathologic values were significantly different between study groups at baseline, confirming successful randomization. At day 180, the primary study outcome variable, maximum LV myocardial wall thickness at any location, was significantly lower in the low-dose DR rapamycin group compared to placebo (P = .01). Oral DR rapamycin was well tolerated with no significant differences in adverse events between groups. CLINICAL RELEVANCE: Results demonstrate that DR rapamycin was well tolerated and may prevent or delay progressive LV hypertrophy in cats with subclinical HCM. Additional studies are warranted to confirm and further characterize these results.

Advancing Treatments for Feline Hypertrophic Cardiomyopathy: The Role of Animal Models and Targeted Therapeutics.

Feline HCM is the most common cardiovascular disease in cats, leading to devastating outcomes, including congestive heart failure (CHF), arterial thromboembolism (ATE), and sudden death. Evidence demonstrating long-term survival benefit with currently available therapies is lacking. Therefore, it is imperative to explore intricate genetic and molecular pathways that drive HCM pathophysiology to inspire the development of novel therapeutics. Several clinical trials exploring new drug therapies are currently underway, including those investigating small molecule inhibitors and rapamycin. This article outlines the key work performed using cellular and animal models that has led to and continues to guide the development of new innovative therapeutic strategies.

Hypertrophic cardiomyopathy in purpose-bred cats with the A31P mutation in cardiac myosin binding protein-C.

We sought to establish a large animal model of inherited hypertrophic cardiomyopathy (HCM) with sufficient disease severity and early penetrance for identification of novel therapeutic strategies. HCM is the most common inherited cardiac disorder affecting 1 in 250-500 people, yet few therapies for its treatment or prevention are available. A research colony of purpose-bred cats carrying the A31P mutation in MYBPC3 was founded using sperm from a single heterozygous male cat. Cardiac function in four generations was assessed by periodic echocardiography and measurement of blood biomarkers. Results showed that HCM penetrance was age-dependent, and that penetrance occurred earlier and was more severe in successive generations, especially in homozygotes. Homozygosity was also associated with progression from preclinical to clinical disease. A31P homozygous cats represent a heritable model of HCM with early disease penetrance and a severe phenotype necessary for interventional studies aimed at altering disease progression. The occurrence of a more severe phenotype in later generations of cats, and the occasional occurrence of HCM in wildtype cats suggests the presence of at least one gene modifier or a second causal variant in this research colony that exacerbates the HCM phenotype when inherited in combination with the A31P mutation.

Effects of Aficamten on cardiac contractility in a feline translational model of hypertrophic cardiomyopathy.

Hypertrophic cardiomyopathy (HCM) is the most prevalent inherited cardiac disease in humans and cats and lacks efficacious pharmacologic interventions in the preclinical phase of disease. LV outflow tract obstruction (LVOTO) is commonly observed in HCM-affected patients and is a primary driver of heart failure symptoms and reduced quality of life. Novel small-molecule cardiac myosin inhibitors target actin-myosin interactions to alleviate overactive protein interactions. A prospective, randomized, controlled cross-over study was performed to evaluate pharmacodynamic effects of two doses (0.3 and 1 mg/kg) of a next-in-class cardiac myosin inhibitor, aficamten (CK-3773274, CK-274), on cardiac function in cats with the A31P MYBPC3 mutation and oHCM. Dose-dependent reductions in LV systolic function, LVOT pressure gradient, and isovolumetric relaxation times compared to baseline were observed. Promising beneficial effects of reduced systolic function warrant further studies of this next-in-class therapeutic to evaluate the benefit of long-term administration in this patient population.

A nonsense variant in Rap Guanine Nucleotide Exchange Factor 5 (RAPGEF5) is associated with equine familial isolated hypoparathyroidism in Thoroughbred foals.

Idiopathic hypocalcemia in Thoroughbred (TB) foals causes tetany and seizures and is invariably fatal. Based upon the similarity of this disease with human familial hypoparathyroidism and occurrence only in the TB breed, we conducted a genetic investigation on two affected TB foals. Familial hypoparathyroidism was identified, and pedigree analysis suggested an autosomal recessive (AR) mode of inheritance. We performed whole-genome sequencing of the two foals, their unaffected dams and four unaffected, unrelated TB horses. Both homozygosity mapping and an association analysis were used to prioritize potential genetic variants. Of the 2,808 variants that significantly associated with the phenotype using an AR mode of inheritance (P<0.02) and located within a region of homozygosity, 1,507 (54%) were located in a 9.7 Mb region on chr4 (44.9-54.6 Mb). Within this region, a nonsense variant (RAPGEF5 c.2624C>A,p.Ser875*) was significantly associated with the hypoparathyroid phenotype (Pallelic = 0.008). Affected foals were homozygous for the variant, with two additional affected foals subsequently confirmed in 2019. Necropsies of all affected foals failed to identify any histologically normal parathyroid glands. Because the nonsense mutation in RAPGEF5 was near the C-terminal end of the protein, the impact on protein function was unclear. Therefore, we tested the variant in our Xenopus overexpression model and demonstrated RAPGEF5 loss-of-function. This RAPGEF5 variant represents the first genetic variant for hypoparathyroidism identified in any domestic animal species.

TRIM39-RPP21 Variants (∆19InsCCC) Are Not Associated with Juvenile Idiopathic Epilepsy in Egyptian Arabian Horses.

Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the Tripartite Motif-Containing 39-Ribonuclease p/mrp 21kDa Subunit (TRIM39-RPP21) gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffected Egyptian Arabian horses were genotyped using Sanger sequencing. There was no significant genotypic (P = 1.00) or allelic (P = 0.31) association with the ∆19InsCCC variant and JIE status. The previously reported markers in TRIM39-RPPB1 are therefore not associated with JIE in well-phenotyped samples. The ∆19InsCCC variant is a common variant that happens to be positioned in a highly polymorphic region in the Arabian breed.