Development and evaluation of genomics informed real-time PCR assays for the detection and strain typing of Mycobacterium avium subsp. paratuberculosis.

AIMS: This study aimed to identify specific genomic targets for the detection and strain typing of Map and analyse their sensitivity and specificity, and detect Map directly from faeces. METHODS AND RESULTS: A comparative genomics approach was used to identify specific genomic targets for the detection and strain typing of Map. A Map specific qPCR using the primer pair 7132 that targets a DNA segregation ATPase protein was able to detect all strains of Map and is more sensitive than the current Johne's disease PCR assays with a sensitivity of 0.0002 fg µl-1. A strain specific qPCR using the Atsa primer pair that targets the arylsulfase gene was able to differentiate between Type S and Type C strains of Map and was more sensitive than the IS1311 PCR and REA with a sensitivity of 40 fg µl-1 and was specific for Type S Map. Both assays successfully detected Map directly from faeces. CONCLUSION: This study developed and validated two genomics informed qPCR assays, 7132B Map and Atsa Type S and found both assays to be highly specific and sensitive for the detection of Map from culture and directly from faeces. This is the first time that a probe-based qPCR has been designed and developed for Map strain typing, which will greatly improve the response time during outbreak investigations.

A metagenomic investigation of phytoplasma diversity in Australian vegetable growing regions.

In this study, metagenomic sequence data was used to investigate the phytoplasma taxonomic diversity in vegetable-growing regions across Australia. Metagenomic sequencing was performed on 195 phytoplasma-positive samples, originating either from historic collections (n=46) or during collection efforts between January 2015 and June 2022 (n=149). The sampled hosts were classified as crop (n=155), weed (n=24), ornamental (n=7), native plant (n=6), and insect (n=3) species. Most samples came from Queensland (n=78), followed by Western Australia (n=46), the Northern Territory (n=32), New South Wales (n=17), and Victoria (n=10). Of the 195 draft phytoplasma genomes, 178 met our genome criteria for comparison using an average nucleotide identity approach. Ten distinct phytoplasma species were identified and could be classified within the 16SrII, 16SrXII (PCR only), 16SrXXV, and 16SrXXXVIII phytoplasma groups, which have all previously been recorded in Australia. The most commonly detected phytoplasma taxa in this study were species and subspecies classified within the 16SrII group (n=153), followed by strains within the 16SrXXXVIII group ('Ca. Phytoplasma stylosanthis'; n=6). Several geographic- and host-range expansions were reported, as well as mixed phytoplasma infections of 16SrII taxa and 'Ca. Phytoplasma stylosanthis'. Additionally, six previously unrecorded 16SrII taxa were identified, including five putative subspecies of 'Ca. Phytoplasma australasiaticum' and a new putative 16SrII species. PCR and sequencing of the 16S rRNA gene was a suitable triage tool for preliminary phytoplasma detection. Metagenomic sequencing, however, allowed for higher-resolution identification of the phytoplasmas, including mixed infections, than was afforded by only direct Sanger sequencing of the 16S rRNA gene. Since the metagenomic approach theoretically obtains sequences of all organisms in a sample, this approach was useful to confirm the host family, genus, and/or species. In addition to improving our understanding of the phytoplasma species that affect crop production in Australia, the study also significantly expands the genomic sequence data available in public sequence repositories to contribute to phytoplasma molecular epidemiology studies, revision of taxonomy, and improved diagnostics.

First report of barley yellow dwarf virus PAS (Luteovirus pashordei) in oat in Australia.

Luteoviruses (family Tombusviridae) and poleroviruses (family Solemoviridae) are economically important pathogens of cereals such as wheat (Triticum aestivum), barley (Hordeum vulgare) and oat (Avena sativa). In Australia, the luteoviruses barley yellow dwarf virus PAV (BYDV PAV) and barley yellow dwarf virus MAV (BYDV MAV), along with the poleroviruses cereal yellow dwarf virus RPV (CYDV RPV) and maize yellow dwarf virus RMV (MYDV RMV), were distinguished from each other and reported in the 1980s (Sward and Lister 1988; Waterhouse and Helms 1985). The poleroviruses barley virus G (BVG) and cereal yellow dwarf virus RPS (CYDV RPS) were reported in Australia more recently (Nancarrow et al. 2019; Nancarrow et al. 2023), while the luteovirus barley yellow dwarf virus PAS (BYDV PAS) has not previously been reported in Australia. During 2010, an oat plant exhibiting yellow/ red leaf discoloration and stunted growth was collected from a roadside in Horsham, Victoria, Australia. The plant tested positive for BYDV PAV and negative for BYDV MAV, CYDV RPV and MYDV RMV by tissue blot immunoassay (TBIA) as described by Trebicki et al (2017). The virus isolate has since been continuously maintained in a glasshouse in live wheat plants using aphids (Rhopalosiphum padi). In 2021, total RNA extracted from a wheat plant infected with this isolate (Nancarrow et al. 2023) tested positive for BYDV PAV by RT-PCR using the primers BYDV-1/BYDV-2 (Rastgou et al. 2005), but negative for BYDV PAV, CYDV RPV and MYDV RMV using other published primers (Deb and Anderson 2008). A high-throughput sequencing (HTS) library was prepared from the total RNA with the NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB) without ribosomal RNA depletion and sequenced on a NovaSeq 6000 (Illumina). Raw reads were trimmed and filtered using fastp v0.20.0 (Chen et al. 2018) while de novo assembly of all of the resulting 5,049,052 reads was done using SPAdes v3.15.3 (Nurk et al. 2017). BLASTn analysis of the resulting 4,067 contigs (128- 12,457 bp in length) revealed only one large virus-like contig (5,649 bp) which was most similar to BYDV PAS isolates on NCBI GenBank, sharing 87% nucleotide (nt) identity with BYDV PAS isolate OH2 (MN128939), 86% nt identity with the BYDV PAS reference sequence (NC_002160) and 82% nt identity with the BYDV PAV reference sequence (NC_004750). Additionally, 4,008 HTS reads were mapped to the assembled genome sequence with Bowtie2 v2.4.5. (Langmead and Salzberg 2012) with 100% genome coverage and an average coverage depth of 101X. Primers were designed to the assembled genome sequence to generate overlapping amplicons across the genome, and the resulting amplicons were Sanger sequenced. This confirmed the genome sequence of BYDV PAS isolate PT from Australia (5649 bp, GC content 47.9%), which was deposited in GenBank (LC782749). Ten additional plant samples collected from western Victoria, Australia, all tested positive for BYDV PAS by RT-PCR using the primers PASF and PASR (Laney et al. 2018). The additional samples consisted of one oat sample collected in 2005, one barley sample collected in 2007, three wheat samples collected in 2016 and one barley, one brome grass (Bromus sp.) and three wheat samples collected in 2020. BYDV PAS is also efficiently transmitted by R. padi but is often more prevalent and severe than BYDV PAV; it can also overcome some sources of virus resistance that are effective against BYDV PAV (Chay et al. 1996, Robertson and French 2007). To our knowledge, this is the first report of BYDV PAS in Australia. Further work is needed to determine the extent of its distribution, incidence, impacts and epidemiology in Australia, along with its relationship to other BYDV PAS isolates.

The pan-genome of Mycobacterium avium subsp. paratuberculosis (Map) confirms ancestral lineage and reveals gene rearrangements within Map Type S.

BACKGROUND: To date genomic studies on Map have concentrated on Type C strains with only a few Type S strains included for comparison. In this study the entire pan-genome of 261 Map genomes (205 Type C, 52 Type S and 4 Type B) and 7 Mycobacterium avium complex (Mac) genomes were analysed to identify genomic similarities and differences between the strains and provide more insight into the evolutionary relationship within this Mycobacterial species. RESULTS: Our analysis of the core genome of all the Map isolates identified two distinct lineages, Type S and Type C Map that is consistent with previous phylogenetic studies of Map. Pan-genome analysis revealed that Map has a larger accessory genome than Mycobacterium avium subsp. avium (Maa) and Type C Map has a larger accessory genome than Type S Map. In addition, we found large rearrangements within Type S strains of Map and little to none in Type C and Type B strains. There were 50 core genes identified that were unique to Type S Map and there were no unique core genes identified between Type B and Type C Map strains. In Type C Map we identified an additional CE10 CAZyme class which was identified as an alpha/beta hydrolase and an additional polyketide and non-ribosomal peptide synthetase cluster. Consistent with previous analysis no plasmids and only incomplete prophages were identified in the genomes of Map. There were 45 hypothetical CRISPR elements identified with no associated cas genes. CONCLUSION: This is the most comprehensive comparison of the genomic content of Map isolates to date and included the closing of eight Map genomes. The analysis revealed that there is greater variation in gene synteny within Type S strains when compared to Type C indicating that the Type C Map strain emerged after Type S. Further analysis of Type C and Type B genomes revealed that they are structurally similar with little to no genetic variation and that Type B Map may be a distinct clade within Type C Map and not a different strain type of Map. The evolutionary lineage of Maa and Map was confirmed as emerging after M. hominissuis.

Hybrid RNA sequencing of broad bean wilt virus 2 from faba beans.

IMPORTANCE: Globally, viral diseases impair the growth and vigor of cultivated crops such as grains, leading to a significant reduction in quality, marketability, and competitiveness. As an island nation, Australia has a distinct advantage in using its border to prevent the introduction of damaging viruses, which threaten the continental agricultural sector. However, breeding programs in Australia rely on imported seeds as new sources of genetic diversity. As such, it is critical to remain vigilant in identifying new and emerging viral pathogens, by ensuring the availability of accurate genomic diagnostic tools at the grain biosecurity border. High-throughput sequencing offers game-changing opportunities in biosecurity routine testing. Genomic results are more accurate and informative compared to traditional molecular methods or biological indexing. The present work contributes to strengthening accurate phytosanitary screening, to safeguard the Australian grains industry, and expedite germplasm release to the end users.

High-quality full genome assembly of historic Xylella fastidiosa strains from ICMP collection using a hybrid sequencing approach.

High-quality complete genomes of five Xylella fastidiosa strains were assembled by combining Nanopore and Illumina sequencing data. Among these, International Collection of Micro-organisms from Plants (ICMP) 8731, ICMP 8742 and ICMP 8745 belong to subspecies fastidiosa while ICMP 8739 and ICMP 8740 were determined as subspecies multiplex. The strains were further classified into sequence types.

The genetic variability of grapevine Pinot gris virus (GPGV) in Australia.

Grapevine Pinot gris virus (GPGV; genus Trichovirus in the family Betaflexiviridae) was detected in Australia in 2016, but its impact on the production of nursery material and fruit in Australia is still currently unknown. This study investigated the prevalence and genetic diversity of GPGV in Australia. GPGV was detected by reverse transcription-polymerase chain reaction (RT-PCR) in a range of rootstock, table and wine grape varieties from New South Wales, South Australia, and Victoria, with 473/2171 (21.8%) samples found to be infected. Genomes of 32 Australian GPGV isolates were sequenced and many of the isolates shared high nucleotide homology. Phylogenetic and haplotype analyses demonstrated that there were four distinct clades amongst the 32 Australian GPGV isolates and that there were likely to have been at least five separate introductions of the virus into Australia. Recombination and haplotype analysis indicate the emergence of new GPGV strains after introduction into Australia. When compared with 168 overseas GPGV isolates, the analyses suggest that the most likely origin of Australian GPGV isolates is from Europe. There was no correlation between specific GPGV genotypes and symptoms such as leaf mottling, leaf deformation, and shoot stunting, which were observed in some vineyards, and the virus was frequently found in symptomless grapevines.

Non-destructive insect metabarcoding for surveillance and biosecurity in citrus orchards: recording the good, the bad and the psyllids.

Background: The Australian citrus industry remains one of the few in the world to be unaffected by the African and the Asian citrus psyllids, Trioza erytreae Del Guercio and Diaphorina citri Kuwayama, respectively, and the diseases their vectored bacteria can cause. Surveillance, early detection, and strict quarantine measures are therefore fundamental to safeguard Australian citrus. However, long-term targeted surveillance for exotic citrus pests can be a time-consuming and expensive activity, often relying on manually screening large numbers of trap samples and morphological identification of specimens, which requires a high level of taxonomic knowledge. Methods: Here we evaluated the use of non-destructive insect metabarcoding for exotic pest surveillance in citrus orchards. We conducted an 11-week field trial, between the months of December and February, at a horticultural research farm (SuniTAFE Smart Farm) in the Northwest of Victoria, Australia, and processed more than 250 samples collected from three types of invertebrate traps across four sites. Results: The whole-community metabarcoding data enabled comparisons between different trapping methods, demonstrated the spatial variation of insect diversity across the same orchard, and highlighted how comprehensive assessment of insect biodiversity requires use of multiple complimentary trapping methods. In addition to revealing the diversity of native psyllid species in citrus orchards, the non-targeted metabarcoding approach identified a diversity of other pest and beneficial insects and arachnids within the trap bycatch, and recorded the presence of the triozid Casuarinicola cf warrigalensis for the first time in Victoria. Ultimately, this work highlights how a non-targeted surveillance approach for insect monitoring coupled with non-destructive DNA metabarcoding can provide accurate and high-throughput species identification for biosecurity and biodiversity monitoring.

The observation of taxonomic boundaries for the 16SrII and 16SrXXV phytoplasmas using genome-based delimitation.

Within the 16SrII phytoplasma group, subgroups A-X have been classified based on restriction fragment length polymorphism of their 16S rRNA gene, and two species have been described, namely 'Candidatus Phytoplasma aurantifolia' and 'Ca. Phytoplasma australasia'. Strains of 16SrII phytoplasmas are detected across a broad geographic range within Africa, Asia, Australia, Europe and North and South America. Historically, all members of the 16SrII group share ≥97.5 % nucleotide sequence identity of their 16S rRNA gene. In this study, we used whole genome sequences to identify the species boundaries within the 16SrII group. Whole genome analyses were done using 42 phytoplasma strains classified into seven 16SrII subgroups, five 16SrII taxa without official 16Sr subgroup classifications, and one 16SrXXV-A phytoplasma strain used as an outgroup taxon. Based on phylogenomic analyses as well as whole genome average nucleotide and average amino acid identity (ANI and AAI), eight distinct 16SrII taxa equivalent to species were identified, six of which are novel descriptions. Strains within the same species had ANI and AAI values of >97 %, and shared ≥80 % of their genomic segments based on the ANI analysis. Species also had distinct biological and/or ecological features. A 16SrII subgroup often represented a distinct species, e.g., the 16SrII-B subgroup members. Members classified within the 16SrII-A, 16SrII-D, and 16SrII-V subgroups as well as strains classified as sweet potato little leaf phytoplasmas fulfilled criteria to be included as members of a single species, but with subspecies-level relationships with each other. The 16SrXXV-A taxon was also described as a novel phytoplasma species and, based on criteria used for other bacterial families, provided evidence that it could be classified as a distinct genus from the 16SrII phytoplasmas. As more phytoplasma genome sequences become available, the classification system of these bacteria can be further refined at the genus, species, and subspecies taxonomic ranks.

LAMP assay for the detection of the Asian citrus psyllid, Diaphorina citri Kuwayama (Hemiptera: Psylloidea: Psyllidae).

Diaphorina citri Kuwayama, also known as the Asian citrus psyllid (ACP), can vector the bacterium Candidatus Liberibacter asiaticus (CLas), agent of Huanglongbing (HLB): an incurable disease affecting citrus trees worldwide. In citrus growing regions where ACP and HLB are absent, such as Australia, the risk of an incursion and consequent economic damage to citrus industries make this psyllid one of the top-priority pests. Due to ACP's small dimensions and the generally poorly studied native psylloid fauna worldwide, morphological identification of this insect to distinguish it from harmless species is challenging, especially in the field, and with immature, partial or damaged specimens. To allow rapid and efficient detection of ACP in the field, we designed and optimised a new Loop-mediated isothermal amplification (LAMP) assay for the detection of D. citri based on the mitochondrial 16S locus. The optimised ACP 16S LAMP assay produced amplification from D. citri samples within 13.3 ± 3.6 min, with an anneal derivative of ~ 78.5 °C. A synthetic gBlock gene fragment was also developed to be used as positive control for the new LAMP assay with a different anneal derivative of ~ 83 °C. An existing commercially available LAMP assay for detection of the bacterium CLas was also tested in this study on ACP DNA. The ACP 16S LAMP assay we developed and tested here provides a valuable new in-field compatible tool that can allow early detections of ACP, enabling a quick biosecurity response, and could potentially be adopted by a wide range of users, from farmers to agronomists and from researchers to industry.

LAMP (Loop-mediated isothermal amplification) assay for rapid identification of Varroa mites.

Varroa mites are serious pests of European honeybees (Apis mellifera). For detection of Varroa mite, a new molecular LAMP-based assay has been developed, which retains the body of the mite intact for morphological identification. Six novel Varroa LAMP primers were designed from existing DNA sequences of the COI locus to target V. destructor and V. jacobsoni, providing the ability to tell them apart from other non-target beehive associated mite and insect species. This LAMP assay is specific in detecting these Varroa species and has been tested on specimens originating from multiple countries. It produces amplification of V. destructor and V. jacobsoni in 16 ± 3.4 min with an anneal derivative of 78 ± 0.5 °C whilst another Varroa species,V. underwoodi, showed late amplification. A gBlock gene fragment, used here as a positive control has a different anneal derivative of 80 °C. Three non-destructive DNA extraction methods (HotShot, QuickExtract and Xtract) were tested and found to be suitable for use in the field. The LAMP assay was sensitive to very low levels of Varroa DNA, down to 0.24 picogram (~ 1 × 10 copies/µL of Varroa gBlock). This is a new molecular tool for rapid and accurate detection and identification of Varroa mites for pest management, in areas where these mites do not occur.

Fine-scale genomic tracking of Ross River virus using nanopore sequencing.

BACKGROUND: Ross River virus (RRV) is Australia's most common and widespread mosquito-transmitted arbovirus and is of significant public health concern. With increasing anthropogenic impacts on wildlife and mosquito populations, it is important that we understand how RRV circulates in its endemic hotspots to determine where public health efforts should be directed. Current surveillance methods are effective in locating the virus but do not provide data on the circulation of the virus and its strains within the environment. This study examined the ability to identify single nucleotide polymorphisms (SNPs) within the variable E2/E3 region by generating full-length haplotypes from a range of mosquito trap-derived samples. METHODS: A novel tiled primer amplification workflow for amplifying RRV was developed with analysis using Oxford Nanopore Technology's MinION and a custom ARTIC/InterARTIC bioinformatic protocol. By creating a range of amplicons across the whole genome, fine-scale SNP analysis was enabled by specifically targeting the variable region that was amplified as a single fragment and established haplotypes that informed spatial-temporal variation of RRV in the study site in Victoria. RESULTS: A bioinformatic and laboratory pipeline was successfully designed and implemented on mosquito whole trap homogenates. Resulting data showed that genotyping could be conducted in real time and that whole trap consensus of the viruses (with major SNPs) could be determined in a timely manner. Minor variants were successfully detected from the variable E2/E3 region of RRV, which allowed haplotype determination within complex mosquito homogenate samples. CONCLUSIONS: The novel bioinformatic and wet laboratory methods developed here will enable fast detection and characterisation of RRV isolates. The concepts presented in this body of work are transferable to other viruses that exist as quasispecies in samples. The ability to detect minor SNPs, and thus haplotype strains, is critically important for understanding the epidemiology of viruses their natural environment.

First report of cereal yellow dwarf virus RPS infecting wheat in Australia.

Yellow dwarf viruses (YDVs) reduce grain yield in a wide range of cereal hosts worldwide. Cereal yellow dwarf virus RPV (CYDV RPV) and cereal yellow dwarf virus RPS (CYDV RPS) are members of the Polerovirus genus within the Solemoviridae family (Scheets et al. 2020; Sõmera et al. 2021). Along with barley yellow dwarf virus PAV (BYDV PAV) and barley yellow dwarf virus MAV (BYDV MAV) (genus Luteovirus, family Tombusviridae), CYDV RPV is found worldwide and has mostly been identified as being present in Australia based on serological detection (Waterhouse and Helms 1985; Sward and Lister 1988). However, CYDV RPS has not previously been reported in Australia. In October 2020, a plant sample (226W) was collected from a volunteer wheat (Triticum aestivum) plant located near Douglas, Victoria, Australia that displayed yellow-reddish leaf symptoms typical of YDV infection. The sample tested positive for CYDV RPV and negative for BYDV PAV and BYDV MAV by tissue blot immunoassay (TBIA) (Trebicki et al. 2017). Given that CYDV RPV and CYDV RPS can both be detected using serological tests for CYDV RPV (Miller et al. 2002), total RNA was extracted from stored leaf tissue of plant sample 226W for further testing using the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany) with modified lysis buffer (Constable et al. 2007; MacKenzie et al. 1997). The sample was then tested by RT-PCR using three sets of primers that were designed to detect CYDV RPS, targeting three distinct overlapping regions (each approximately 750 bp in length) of the 5' end of the genome where CYDV RPV and CYDV RPS differ most (Miller et al. 2002). The primers CYDV RPS1L (GAGGAATCCAGATTCGCAGCTT)/ CYDV RPS1R (GCGTACCAAAAGTCCACCTCAA) targeted the P0 gene, while CYDV RPS2L (TTCGAACTGCGCGTATTGTTTG)/ CYDV RPS2R (TACTTGGGAGAGGTTAGTCCGG) and CYDV RPS3L (GGTAAGACTCTGCTTGGCGTAC)/ CYDV RPS3R (TGAGGGGAGAGTTTTCCAACCT) targeted two different regions of the RdRp gene. Sample 226W tested positive using all three sets of primers and the amplicons were directly sequenced. NCBI BLASTn and BLASTx analyses showed that the CYDV RPS1 amplicon (Accession No. OQ417707) shared 97% nucleotide (nt) identity and 98% amino acid (aa) identity similarity with the CYDV RPS isolate SW (Accession No. LC589964) from South Korea, while the CYDV RPS2 amplicon (Accession No. OQ417708) shared 96% nt identity and 98% aa identity similarity with the same CYDV RPS isolate SW. The CYDV RPS3 amplicon (Accession No. OQ417709) shared 96% nt identity and 97% aa identity similarity with the CYDV RPS isolate Olustvere1-O (Accession No. MK012664) from Estonia, confirming that isolate 226W is CYDV RPS. In addition, total RNA extracted from 13 plant samples that had previously tested positive for CYDV RPV by TBIA were tested for CYDV RPS using the primers CYDV RPS1 L/R and CYDV RPS3 L/R. The additional samples, consisting of wheat (n=8), wild oat (Avena fatua, n=3) and brome grass (Bromus sp., n=2), were collected at the same time as sample 226W from seven fields within the same region. Five of the wheat samples were collected from the same field as sample 226W, one of which tested positive for CYDV RPS while the remaining 12 samples were negative. To the best of our knowledge, this is the first report of CYDV RPS in Australia. It is not known if CYDV RPS is a recent introduction to Australia, and its incidence and distribution in cereals and grasses in Australia, while currently unknown, is being investigated.

Genome Characterisation of the CGMMV Virus Population in Australia-Informing Plant Biosecurity Policy.

The detection of cucumber green mottle mosaic (CGMMV) in the Northern Territory (NT), Australia, in 2014 led to the introduction of strict quarantine measures for the importation of cucurbit seeds by the Australian federal government. Further detections in Queensland, Western Australia (WA), New South Wales and South Australia occurred in the period 2015-2020. To explore the diversity of the current Australian CGMMV population, 35 new coding sequence complete genomes for CGMMV isolates from Australian incursions and surveys were prepared for this study. In conjunction with published genomes from the NT and WA, sequence, phylogenetic, and genetic variation and variant analyses were performed, and the data were compared with those for international CGMMV isolates. Based on these analyses, it can be inferred that the Australian CGMMV population resulted from a single virus source via multiple introductions.

Enhanced Arbovirus Surveillance with High-Throughput Metatranscriptomic Processing of Field-Collected Mosquitoes.

Surveillance programs are essential for the prevention and control of mosquito-borne arboviruses that cause serious human and animal diseases. Viral metatranscriptomic sequencing can enhance surveillance by enabling untargeted, high-throughput arbovirus detection. We used metatranscriptomic sequencing to screen field-collected mosquitoes for arboviruses to better understand how metatranscriptomics can be utilised in routine surveillance. Following a significant flood event in 2016, more than 56,000 mosquitoes were collected over seven weeks from field traps set up in Victoria, Australia. The traps were split into samples of 1000 mosquitoes or less and sequenced on the Illumina HiSeq. Five arboviruses relevant to public health (Ross River virus, Sindbis virus, Trubanaman virus, Umatilla virus, and Wongorr virus) were detected a total of 33 times in the metatranscriptomic data, with 94% confirmed using reverse transcription quantitative PCR (RT-qPCR). Analysis of metatranscriptomic cytochrome oxidase I (COI) sequences enabled the detection of 12 mosquito and two biting midge species. Screening of the same traps by an established public health arbovirus surveillance program corroborated the metatranscriptomic arbovirus and mosquito species detections. Assembly of genome sequences from the metatranscriptomic data also led to the detection of 51 insect-specific viruses, both known and previously undescribed, and allowed phylogenetic comparison to past strains. We have demonstrated how metatranscriptomics can enhance surveillance by enabling untargeted arbovirus detection, providing genomic epidemiological data, and simultaneously identifying vector species from large, unsorted mosquito traps.

Symptomless turnip yellows virus infection causes grain yield loss in lentil and field pea: A three-year field study in south-eastern Australia.

Turnip yellows virus (TuYV) is a damaging virus that is persistently transmitted by aphids and infects a wide range of grain hosts including lentil (Lens culinaris Medik), field pea (Pisum sativum L.) and canola (Brassica napus L., oilseed rape). Although information is available about the effects of TuYV infection on grain yield in canola, data about its impact on yield in pulses is lacking. In this study, field experiments quantifying the effects of TuYV infection on the grain yield of lentil and field pea were conducted over three consecutive years (2018-2020) with varying weather conditions. Plants artificially inoculated with TuYV using viruliferous green peach aphid (Myzus persicae, Sulzer) were grown under typical field conditions in south-eastern Australia. At maturity, grain yield, along with associated grain and plant growth parameters, were measured. Compared to the non-inoculated control treatment, early TuYV infection reduced grain yield by up to 36% in lentil and 45% in field pea, while late TuYV infection had no significant impact on yield. Despite a high incidence of TuYV infection and significant yield losses recorded in inoculated plots, no obvious symptoms of virus infection were observed in the inoculated plots in any of the six experiments; this lack of visible symptoms in lentil and field pea has significant implications for crop health assessments, demonstrating the importance of testing for virus instead of relying solely on the presence of visual symptoms, and may also be leading to an underestimation of the importance of TuYV in pulses in Australia.

Comparative genomics and genomic diversity of Pseudomonas syringae clade 2b-a in Australia.

BACKGROUND: A zucchini disease outbreak with unusual symptoms associated with Pseudomonas syringae clade 2b was identified in Bundaberg, Australia during autumn 2016. To investigate the genetic diversity of the 11 Australian isolates obtained from the outbreak, the genomes were compared to the publicly available P. syringae strains in phylogroup 2. RESULTS: Average nucleotide identity refined the P. syringae clade 2b-a into four clusters (Cluster A, B, C1 and C2), an expansion from the previously identified A, B and C. Australian isolates were in Cluster A, C1 and C2. Genomic analyses highlighted several key factors that may contribute to the virulence of these isolates. Six orthologous groups, including three virulence factors, were associated with P. syringae phylogroup 2 cucurbit-infecting strains. A region of genome plasticity analysis identified a type VI secretion system pathway in clade 2b-a strains which could also contribute to virulence. Pathogenicity assays on isolates KL004-k1, KFR003-1 and 77-4C, as representative isolates of Cluster A, C1 and C2, respectively, determined that all three isolates can infect pumpkin, squash, watermelon and zucchini var. Eva with different levels of disease severity. Subsequently, type III effectors were investigated and four type III effectors (avrRpt2, hopZ5, hopC1 and hopH1) were associated with host range. The hopZ effector family was also predicted to be associated with disease severity. CONCLUSIONS: This study refined the taxonomy of the P. syringae clade 2b-a, supported the association between effector profile and pathogenicity in cucurbits established in a previous study and provides new insight into important genomic features of these strains. This study also provided a detailed and comprehensive resource for future genomic and functional studies of these strains.

Targeted Whole Genome Sequencing (TWG-Seq) of Cucumber Green Mottle Mosaic Virus Using Tiled Amplicon Multiplex PCR and Nanopore Sequencing.

Rapid and reliable detection tools are essential for disease surveillance and outbreak management, and genomic data is essential to determining pathogen origin and monitoring of transmission pathways. Low virus copy number and poor RNA quality can present challenges for genomic sequencing of plant viruses, but this can be overcome by enrichment of target nucleic acid. A targeted whole genome sequencing (TWG-Seq) approach for the detection of cucumber green mottle mosaic virus (CGMMV) has been developed where overlapping amplicons generated using two multiplex RT-PCR assays are then sequenced using the Oxford Nanopore MinION. Near complete coding region sequences were assembled with ≥100× coverage for infected leaf tissue dilution samples with RT-qPCR cycle quantification (Cq) values from 11.8 to 38 and in seed dilution samples with Cq values 13.8 to 27. Consensus sequences assembled using this approach showed greater than 99% nucleotide similarity when compared to genomes produced using metagenomic sequencing. CGMMV could be confidently detected in historical seed isolates with degraded RNA. Whilst limited access to, and costs associated with second-generation sequencing platforms can influence diagnostic outputs, the portable Nanopore technology offers an affordable high throughput sequencing alternative when combined with TWG-Seq for low copy or degraded samples.

First report of ryegrass cyst nematode, Heterodera mani, in Tasmania, Australia.

Cyst nematodes of the genus Heterodera are a major group of sedentary plant parasites causing a significant economic impact, restricting production and market access globally (Moens et al. 2018). The ryegrass cyst nematode Heterodera mani is in the Avenae group and is found predominantly in pastures and grasslands in Europe, California, and South Africa. It was first described by Mathews (1971) from Northern Ireland. Known hosts are grasses (family Poaceae), principally Lolium perenne (perennial ryegrass), but also Dactylis glomerata (cat grass) and Festuca pratensis (meadow fescue) (Subbotin et al. 2010). Mowat (1974) reported that H. mani causes negligible damage to the yield of L. perenne in pot trials; however, Maas & Brinkman (1982) determined that it may cause significant damage to spring and autumn-sown perennial ryegrass in field conditions. During a routine examination for potato cyst nematode from a farm near Mawbanna in north-west Tasmania, Australia, several pale to dark brown Heterodera cysts were extracted that were lemon shaped with the presence of a small vulval cone at the posterior end and a distinct neck. The J2 (n=20) stylet length ranged from 24-26 µm with round knobs deeply concave anteriorly, hyaline tail length was 37-42 µm, true tail length ranged from 59-68 µm and total body length varied from 526-559 µm. All the above characters match those described for H. mani (Subbotin et al. 2010). To verify this identification, DNA was extracted from five individual J2 juveniles from a single cyst using QIAamp DNA micro kit (Qiagen®), and two gene regions amplified: internal transcribed spacer region of ribosomal RNA (ITS-rRNA) with primer pair AB28 and TW81 and cytochrome oxidase 1 (CO1) with primer pair JB3 and JB5 (Bowles et al. 1992; Curran et al. 1994; Derycke et al. 2005). One PCR reaction contained 10 µM (1 µl each) of each primer, 12.5 µl of OneTaq® DNA Polymerase and 5 µl of DNA template with a final volume of 25 µl. PCR products were sent for purification and Sanger sequencing at Macrogen (Seoul, Rep. of Korea). All resulting sequences were trimmed, aligned, and analysed using Geneious Prime® 2022.0.1 (www.geneious.com). Five ITS sequences (accessions ON402852-ON402856) and five CO1 sequences (accessions ON402857-ON402861) were submitted to GenBank. These ITS sequences were very similar to each other and exhibited 99.16-100% similarity with that of H. mani isolate from Hamminkeln, Germany (AY148377) (Subbotin et al. 2018). The CO1 sequences exhibited 98.96-100% similarity with that of H. mani isolate from Washington, USA (MG523097) (Subbotin et al. 2003). Obtained sequences were mapped to reference sequences downloaded from NCBI GenBank and maximum likelihood phylogenetic trees were calculated. Due to the lack of further living nematode material, pot experiments were not performed. Such experiments are not feasible in Tasmania currently and transfer of live nematode material to the Australian mainland presents logistic and legal issues. However, morphological and molecular evidence for species determination of H. mani was unequivocal and contributes to the list of cyst nematode species present in Australia. This is the first detection of H. mani in Australia and is a range extension of the species from North America, Africa, and Europe to Australia. The nematode may cause damage to perennial ryegrass in Australia, however, impact on yield still needs to be investigated.

Iodixanol density gradients as an effective phytoplasma enrichment approach to improve genome sequencing.

Obtaining complete phytoplasma genomes is difficult due to the lack of a culture system for these bacteria. To improve genome assembly, a non-ionic, low- and iso-osmotic iodixanol (Optiprep™) density gradient centrifugation method was developed to enrich for phytoplasma cells and deplete plant host tissues prior to deoxyribonucleic acid (DNA) extraction and high-throughput sequencing (HTS). After density gradient enrichment, potato infected with a 'Candidatus Phytoplasma australasia'-related strain showed a ∼14-fold increase in phytoplasma HTS reads, with a ∼1.7-fold decrease in host genomic reads compared to the DNA extracted from the same sample without density gradient centrifugation enrichment. Additionally, phytoplasma genome assemblies from libraries equalized to 5 million reads were, on average, ∼15,000 bp larger and more contiguous (N50 ∼14,800 bp larger) than assemblies from the DNA extracted from the infected potato without enrichment. The method was repeated on capsicum infected with Sweet Potato Little Leaf phytoplasma ('Ca. Phytoplasma australasia'-related strain) with a lower phytoplasma titer than the potato. In capsicum, ∼threefold more phytoplasma reads and ∼twofold less host genomic reads were obtained, with the genome assembly size and N50 values from libraries equalized to 3.4 million reads ∼137,000 and ∼4,000 bp larger, respectively, compared to the DNA extracted from infected capsicum without enrichment. Phytoplasmas from potato and capsicum were both enriched at a density of 1.049-1.058 g/ml. Finally, we present two highly contiguous 'Ca. Phytoplasma australasia' phytoplasma reference genomes sequenced from naturally infected Solanaceae hosts in Australia. Obtaining high-quality phytoplasma genomes from naturally infected hosts will improve insights into phytoplasma taxonomy, which will improve their detection and disease management.