Four different gene-related cone-rod dystrophy: clinical and genetic findings in six Chinese families with diverse modes of inheritance.

Purpose: To investigate pathogenic variants in six families with cone-rod dystrophy (CORD) presenting various inheritance patterns by using whole-exome sequencing (WES) and analyzing phenotypic features. Methods: A total of six families with CORD were enrolled in Ningxia Eye Hospital for this study. The probands and their family members received comprehensive ophthalmic examinations, and DNA was abstracted from patients and family members. Whole-exome sequencing was performed on probands to screen the causative variants, and all suspected pathogenic variants were determined via Sanger sequencing. Furthermore, co-segregation analysis was performed on available family members. The pathogenicity of novel variants was predicted using in silico analysis and evaluated according to the American College of Medical Genetics and Genomics (ACMG) guidelines. Results: Of the six families, two families were assigned as X-linked recessive (XL), two families were assigned as autosomal recessive (AR), and two families were assigned as autosomal dominant (AD). Pathogenic variants were detected in CACNA1F in two X-linked recessive probands, among which family 1 had a hemizygous frameshift variant c.2201del (p.Val734Glyfs*17) and family 2 had a hemizygous missense variant c.245G>A (p.Arg82Gln). Both probands had high myopia, with fundus tessellation accompanied by abnormalities in the outer structure of the macular area. The homozygous splice variant c.2373 + 5G>T in PROM1 and the homozygous nonsense variant c.604C>T (p.Arg202Ter) in ADAM9 were detected in two autosomal recessive families of the probands. Both probands showed different degrees of atrophy in the macular area, and the lesions showed hypofluorescence changes in autofluorescence. The heterozygous variation in CRX c.682C>T (p.Gln228Ter) was detected in two autosomal dominant families. The onset age of the two probands was late, with better vision and severe macular atrophy. According to ACMG guidelines and the analysis of online in silico tools, all variations were labeled as potentially harmful or pathogenic. Conclusion: Pathogenic variants in CACNA1F, PROM1, ADAM9, and CRX genes were identified in six families affected by the diverse inheritance patterns of CORD. Furthermore, the potential impact of the nonsense-mediated decay (NMD) mechanism on the manifestation of CORD phenotypes was examined and addressed. Simultaneously, the spectrum of pathogenic variants and clinical phenotypes associated with the CORD gene was extended.

Novel mutations of the X-linked genes associated with early-onset high myopia in five Chinese families.

PURPOSE: To report novel pathogenic variants of X-linked genes in five Chinese families with early-onset high myopia (eoHM) by using whole-exome sequencing and analyzing the phenotypic features. METHODS: 5 probands with X-linked recessive related eoHM were collected in Ningxia Eye Hospital from January 2021 to June 2022. The probands and their family members received comprehensive ophthalmic examinations,and DNA was abstracted from patients and family members. Whole-exome sequencing was performed on probands to screen the causative variants, and all suspected pathogenic variants were determined by Sanger sequencing and co-segregation analysis was performed on available family members. The pathogenicity of novel variants was predicted using silico analysis and evaluated according to ACMG guidelines. RT-qPCR was used to detect differences in the relative mRNAs expression of candidate gene in mRNAs available with the proband and family members in the pedigree 2. The relationship between genetic variants and clinical features was analyzed. RESULTS: All probands were male, and all pedigrees conformed to an X-linked recessive inheritance pattern. They were diagnosed with high myopia at their first visits between 4 and 7 years old. Spherical equivalent ranged between - 6.00D and - 11.00D.The five novel hemizygous variants were found in the probands, containing frameshift deletion variant c.797_801del (p.Val266Alafs*75) of OPN1LW gene in the pedigree 1, nonsense variant c.513G > A (p.Trp171Ter)of RP2 gene in the pedigree 2, missense variant c.98G > T (p.Cys33Phe) of GPR143 gene in the pedigree 3, frameshift deletion variant c.1876_1877del (p.Met626Valfs*22) of FRMD7 gene in the pedigree 4 and inframe deletion variant c.670_ 675del (p.Glu192_ Glu193del) of HMGB3 gene in the pedigree 5. All variants were classified as pathogenic or likely pathogenic by the interpretation principles of HGMD sequence variants and ACMG guidelines. In family 2, RT-qPCR showed that the mRNA expression of RP2 gene was lower in the proband than in other normal family members, indicating that such variant caused an effect on gene function at the mRNA expression level. Further clinical examination showed that pedigrees 1, 2, 3, and 4 were diagnosed as X-linked recessive hereditary eye disease with early-onset high myopia, including quiescent cone dysfunction, retinitis pigmentosa, ocular albinism, and idiopathic congenital nystagmus respectively. The pedigree 5 had eoHM in the right eye and ptosis in both eyes. CONCLUSION: In this paper,we are the first to report five novel hemizygous variants in OPN1LW, RP2, GPR143, FRMD7, HMGB3 genes are associated with eoHM. Our study extends the genotypic spectrums for eoHM and better assists ophthalmologists in assessing, diagnosing, and conducting genetic screening for eoHM.

De novo variation in EP300 gene cause Rubinstein-Taybi syndrome 2 in a Chinese family with severe early-onset high myopia.

BACKGROUND: Rubinstein-Taybi syndrome (RSTS) is characterized by distinctive facial features, broad and often angulated thumbs and halluces, short stature, and moderate-to-severe intellectual disability, classified into two types RSTS1 (CREBBP-RSTS) and RSTS2 (EP300-RSTS). More often, the clinical features are inconclusive and the diagnosis of RSTS is established in a proband with identification of a heterozygous pathogenic variant in CREBBP or EP300 to confirm the diagnosis. METHODS: In this study, to describe an association between the clinical phenotype and the genotype of a RSTS2 patient who was initially diagnosed with severe early-onset high myopia (eoHM) from a healthy Chinese family, we tested the proband of this family by whole exome sequencing (WES) and further verified among other family members by Sanger sequencing. Real-time quantitative PCR was used to detect differences in the relative mRNA expression of candidate genes available in the proband and family members. Comprehensive ophthalmic tests as well as other systemic examinations were also performed on participants with various genotypes. RESULTS: Whole-exome sequencing revealed that the proband carried the heterozygous frameshift deletion variant c.3714_3715del (p.Leu1239Glyfs*3) in the EP300 gene, which was not carried by the normal parents and young sister as verified by Sanger sequencing, indicating that the variant was de novo. Real-time quantitative PCR showed that the mRNA expression of EP300 gene was lower in the proband than in other normal family members, indicating that such a variant caused an effect on gene function at the mRNA expression level. The variant was classified as pathogenic as assessed by the interpretation principles of HGMD sequence variants and ACMG guidelines. According to ACMG guidelines, the heterozygous frameshift deletion variant c.3714_3715del (p.Leu1239Glyfs*3) in the EP300 gene was more likely the pathogenic variant of this family with RSTS2. CONCLUSIONS: Therefore, in this paper, we first report de novo heterozygous variation in EP300 causing eoHM-RSTS. Our study extends the genotypic spectrums for EP300-RSTS and better assists physicians in predicting, diagnosis, genetic counseling, eugenics guidance and gene therapy for EP300-RSTS.

Two novel variations in LRP2 cause Donnai-Barrow syndrome in a Chinese family with severe early-onset high myopia.

Donnai-Barrow syndrome (DBS) is a rare autosomal recessive disorder caused by mutation in the low density lipoprotein receptor-related protein 2 gene (LRP2). Defects in this protein may lead to clinical multiple organ malformations by affecting the development of organs such as the nervous system, eyes, ears, and kidneys. Although some variations on LRP2 have been found to be associated with DBS, early diagnosis and prevention of patients with atypical DBS remains a challenge for many physicians because of their clinical heterogeneity. The objective of this study is to explore the association between the clinical presentation and the genotype of a DBS patient who was initially diagnosed with early-onset high myopia (eoHM) from a healthy Chinese family. To this end, we tested the patient of this family via whole exome sequencing and further verified the results among other family members by Sanger sequencing. Comprehensive ophthalmic tests as well as other systemic examinations were also performed on participants with various genotypes. Genetic assessment revealed that two novel variations in LRP2, a de novo missense variation (c.9032G>A; p.Arg3011Lys) and a novel splicing variation (c.2909-2A>T) inherited from the father, were both carried by the proband in this family, and they are strongly associated with the typical clinical features of DBS patients. Therefore, in this paper we are the first to report two novel compound heterozygous variations in LPR2 causing DBS. Our study extends the genotypic spectrums for LPR2-DBS and better assists physicians in predicting, diagnosing, and conducting gene therapy for DBS.

BEST1 novel mutation causes Bestrophinopathies in six families with distinct phenotypic diversity.

PURPOSE: To report novel BEST1 variants in six Chinese families with bestrophinopathies of two different inheritance modes and analyze the intrafamilial phenotypic diversity. METHOD: A total of 25 participants including 13 patients and 12 healthy family members from 6 Chinese families with bestrophinopathies were available for genetic and clinical analysis. All of the patients were subjected to comprehensive ophthalmic evaluations and exome sequencing was performed on the probands to detect the causative variants. The pathogenicity of gene variants was predicted using silico analysis and evaluated according to ACMG guidelines. All (likely) pathogenic variants were determined by Sanger sequencing and co-segregation analyses were performed on available family members. The relevant original literature previously reported was retrieved to explore the relationship between BEST1-related gene variants and clinical features. RESULTS: In the 6 families, 3 families (10 patients) were assigned as autosomal dominant bestrophinopathies (VMD) and 3 families (3 patients) were assigned as Autosomal recessive Bestrophinopathies (ARB). A total of 9 variants on the BEST1 gene were identified, containing 7 missense variants, 1 nonsense variant, and 1 frameshift variant, respectively, of which 3 variants c.88A > G (p.Lys30Glu), c.764G > A (p.Arg255Gln) and c.233dupT (p.Ser79Phefs*153) were novel variants. Three families with ARB were detected with heterozygous variants on the BEST1 gene.2 families (8 patients) with BVMD showed markedly irregular dominant inheritance, and the severity of macular lesions varies greatly among individuals of the same family. Among them, the probands showed typical vitelliform lesions in the macula, while the other six patients had no visible signs of the disease by fundus photography (ophthalmoscopy) and minor lesions could be detected on OCT in two patients, the continuity of the ellipsoidal band was interrupted with the chimeric band. The phenotypes of the patients in the three ARB families ranged from typical/atypical vitelliform lesions to extensive extramacular deposits (peripheral spots). CONCLUSION: This study provided evidence that the phenotype of BVMD manifested irregular dominant inheritance, with patients carrying a pathogenic heterozygous variant of BEST1 to develop obvious intrafamilial phenotypic diversity, and the patients who harbor two pathogenic alleles showed recessive inheritance bestrophinopathies with distinct phenotypic diversity. Our study also emphasized the importance of comprehensive genetic analysis in patients with bestrophinopathies, and in such challenging families with distinct intrafamilial phenotypic diversity, it shall provide novel insights into phenotypic assessments of bestrophinopathies, and contribute to better diagnosis, prognosis, and treatment for these patients.

New pathogenic variants of ALMS1 gene in two Chinese families with Alström Syndrome.

PURPOSE: Alström Syndrome (AS) is an autosomal recessive hereditary disease with the characteristics of multiorgan dysfunction. Due to the heterogeneity of clinical manifestations of AS, genetic testing is crucial for the diagnosis of AS. Herein, we used whole-exome sequencing (WES) to determine the genetic causes and characterize the clinical features of three affected patients in two Chinese families with Alström Syndrome. MATERIALS AND METHODS: Three affected patients (initially diagnosed as achromatopsia). and five asymptomatic members were recruited for both genetic and clinical tests. The complete ophthalmic examinations and systemic examinations were performed on all participants. Whole exome sequencing (WES) was performed for mutation detection. The silico analysis was also applied to predict the pathogenesis of identified pathogenic variants. RESULTS: In family 1, the proband showed low vision, hyperopia, photophobia, nystagmus, and total color blindness. DNA analysis revealed that she carried a compound heterozygote with two novel pathogenic variants in the ALMS1 gene NM_015120.4:c.10379del (NP_055935.4:p.(Asp2252Tyr)) and NM_015120.4:c.11641_11642del (NP_055935.4:p.(Val3881ThrfsTer11)). Further systemic examinations showed short stature, acanthosis nigricans, and sensorineural hearing loss. In family 2, two affected siblings presented the low vision, hyperopia, photophobia, nystagmus, and total color blindness. DNA analysis revealed that they carried a same compound heterozygote with two novel pathogenic variants in the ALMS1 gene NM_015120.4:c.10379del (NP_055935.4:p.(Asn3460IlefsTer49)), NM_015120.4:c.10819C > T (NP_055935.4:p.(Arg3607Trp)). Further systemic examinations showed obesity and mild abnormalities of lipid metabolism. According to the genetic testing results and further systemic analysis, the three affected patients were finally diagnosed as Alström Syndrome (AS). CONCLUSIONS: We found two new compound heterozygous pathogenic variants of the ALMS1 gene and determined the diagnosis as Alström Syndrome in three patients of two Chinese families. Our study extends the genotypic and phenotypic spectrums for ALMS1 -AS and emphasizes the importance of gene testing in assisting the clinical diagnosis for cases with phenotypic diversities, which would help the AS patients with early diagnosis and treatment to reduce future systemic damage.

Next-generation sequencing panel analysis in 24 Chinese patients with congenital ectopia lentis.

BACKGROUND: Congenital ectopia lentis (CEL) is a rare but serious disease. We use next-generation sequencing to detect genes associated with lens abnormalities in 24 patients with bilateral CEL and search for pathogenic genes and mutation sites. MATERIALS AND METHODS: A total of 24 patients diagnosed with CEL from January 2019 to November 2019 were enrolled in this study, and their clinical data were collected and genome-wide deoxyribonucleic acid was extracted from peripheral venous blood. Targeted gene capture technology was used to obtain 188 exons of lens abnormality-related genes, which were sequenced using a high-throughput method. The mutation sites were determined through data analysis and verified by the Sanger method. According to the data from previous studies, the association between the genotype and clinical phenotype was analysed. RESULT: Of the 24 patients, 23 had mutations in the fibrillin-1 (FBN1) gene, and 20 were diagnosed with Marfan syndrome. The 23 cases of FBN1 mutations were all heterozygous mutations, including 17 missense mutations, 3 splicing variants, 2 exon deletion mutations, 1 codon mutation, and 9 new mutations. A total of 17 mutations were located in the calcium-binding epidermal growth factor domain, including 16 mutations that contained missense mutations of cysteine. In addition, a heterozygous mutation of the gap junction protein alpha 8 (GJA8) gene was detected in one patient. CONCLUSION: In this study, we identified 23 FBN1 gene mutations and 1 GJA8 gene mutation in 24 patients with CEL. Of these, 9 new FBN1 mutations and 14 known mutations were found. The results expanded the mutation spectrum of the FBN1 gene, suggesting that FBN1 mutation may be the main cause of CEL in Chinese patients.

Identification of a novel FOXL2 mutation in a fourth-generation Chinese family with blepharophimosis-ptosis-epicanthus inversus syndrome.

AIM: To characterize the genetic causes and clinical features in a four-generation Chinese family with blepharophimosis-ptosis-epicanthus inversus syndrome (BPES). METHODS: Thirteen patients with BPES and eight healthy family members were included in this study. All participants received routine ophthalmic examinations. The target next-generation sequencing (NGS) was performed to determine the causative mutation for this family. The silico analysis was also applied to predict the pathogenesis of identified mutations. RESULTS: All patients had severe ptosis, normal intelligence, female patients have normal fertility. Genetic assessments revealed a heterozygous insertion variation in FOXL2 gene, c.672_701insGCGGCTGCCGC CGCAGCTGCTG CAGGCGCT (p.Ala234_Gly235linsAAAAAAAAGA), carried by 13 patient but absent in all unaffected members. In silico analysis supported the pathogenic nature of this highly conserved variant. This mutation resulted in the insertion of 10 amino acids into the encoded polyala nine chain, which increased the number of original polyalanine chains from 14 to 24, resulting in an extended protein. CONCLUSION: A novel FOXL2 mutation c.672_701ins GCGGCTGCCGCCGCAGCTGCTGC AGGCGCT (p.Ala234_Gly235linsAAAAAAAAGA) was identified in a large Chinese family with BPES. This study amplified the genotypic spectrum of FOXL2-BPES and better illustrates its genotype-phenotype correlations, which provided a basis for elucidating the pathogenesis of BPES and genetic counseling.

CCT2 Mutations Evoke Leber Congenital Amaurosis due to Chaperone Complex Instability.

Leber congenital amaurosis (LCA) is a hereditary early-onset retinal dystrophy that is accompanied by severe macular degeneration. In this study, novel compound heterozygous mutations were identified as LCA-causative in chaperonin-containing TCP-1, subunit 2 (CCT2), a gene that encodes the molecular chaperone protein, CCTß. The zebrafish mutants of CCTß are known to exhibit the eye phenotype while its mutation and association with human disease have been unknown. The CCT proteins (CCT α-θ) forms ring complex for its chaperon function. The LCA mutants of CCTß, T400P and R516H, are biochemically instable and the affinity for the adjacent subunit, CCTγ, was affected distinctly in both mutants. The patient-derived induced pluripotent stem cells (iPSCs), carrying these CCTß mutants, were less proliferative than the control iPSCs. Decreased proliferation under Cct2 knockdown in 661W cells was significantly rescued by wild-type CCTß expression. However, the expression of T400P and R516H didn't exhibit the significant effect. In mouse retina, both CCTß and CCTγ are expressed in the retinal ganglion cells and connecting cilium of photoreceptor cells. The Cct2 knockdown decreased its major client protein, transducing ß1 (Gß1). Here we report the novel LCA mutations in CCTß and the impact of chaperon disability by these mutations in cellular biology.

Prognostic value of legumain in uveal melanoma.

The present study aimed to assess the expression of legumain in uveal melanoma (UM) cell lines and primary UM specimens, and to determine the possible association between legumain expression and clinical as well as pathological characteristics to reveal its impact on the prognosis of patients with UM. Records of primary UM cases treated at Beijing Tongren Hospital and Tianjin Eye Hospital between 1996 and 2005 were retrieved for analysis and a total of 82 patients with uveal melanoma were included in the study. The expression of legumain in the formalin­fixed and paraffin­embedded surgical specimens of these 82 patients was determined using immunohistochemical analysis. In addition, the expression of legumain was examined in two uveal melanoma cell lines using polymerase chain reaction and western blot analyses. The association of legumain expression with clinical/pathological characteristics was analyzed using the χ2 and Fisher's exact test. In addition, the impact of legumain on the prognosis of patients with uveal melanoma was examined. Upregulation of legumain was more predominant in the highly invasive uveal melanoma cell line MUM­2B compared with that in the MUM­2C with low invasiveness. Of 82 primary uveal melanoma tissues, 35 exhibited high expression of legumain, while the other 47 specimens exhibited low or negative expression of legumain. High legumain expression was primarily associated with local invasion of UM. Overall survival analysis revealed that the patients with high legumain expression exhibited poorer survival than patients with low/negative legumain expression. These findings suggested that upregulation of legumain is associated with malignant behavior of UM and that legumain may be used as an negative prognostic factor as well as a therapeutic target.

Whole exome sequencing confirms the clinical diagnosis of Marfan syndrome combined with X-linked hypophosphatemia.

BACKGROUND: To determine the genetic lesions and to modify the clinical diagnosis for a Chinese family with significant intrafamilial phenotypic diversities and unusual presentations. METHODS: Three affected patients and the asymptomatic father were included and received comprehensive systemic examinations. Whole exome sequencing (WES) was performed for mutation detection. Structural modeling test was applied to analyze the potential structural changes caused by the missense substitution. RESULTS: The proband showed a wide spectrum of systemic anomalies, including bilateral ectopia lentis, atrial septal defect, ventricular septal defect, widening of tibial metaphysis with medial bowing, and dolichostenomelia in digits, while her mother and elder brother only demonstrated similar skeletal changes. A recurrent mutation, PHEX p.R291*, was found in all patients, while a de novo mutation, FBN1 p.C792F, was only detected in the proband. The FBN1 substitution was also predicted to cause significant conformational change in fibrillin-1 protein, thus changing its physical and biological properties. CONCLUSIONS: Taken together, we finalized the diagnosis for this family as X-linked hypophosphatemia (XLH), and diagnosed this girl as Marfan syndrome combined with XLH, and congenital heart disease. Our study also emphasizes the importance of WES in assisting the clinical diagnosis for complicated cases when the original diagnoses are challenged.

Targeted next-generation sequencing reveals novel EYS mutations in Chinese families with autosomal recessive retinitis pigmentosa.

EYS mutations demonstrate great genotypic and phenotypic varieties, and are one of the major causes for patients with autosomal recessive retinitis pigmentosa (ARRP). Here, we aim to determine the genetic lesions with phenotypic correlations in two Chinese families with ARRP. Medical histories and ophthalmic documentations were obtained from all participants from the two pedigrees. Targeted next-generation sequencing (NGS) on 189 genes was performed to screen for RP causative mutations in the two families. Two biallelic mutations in EYS, p.[R164*];[C2139Y] and p.[W2640*];[F2954S], were identified in the two families, respectively. EYS p.R164* and p.F2954S are novel alleles associated with RP, while p.C2139Y and p.W2640* are known mutations. Crystal structure modeling on the protein eyes shut homolog encoded by the EYS gene revealed abnormal hydrogen bonds generated by p.C2139Y and p.F2954S, which would likely affect the solubility and cause significant structural changes of the two mutated proteins. In conclusion, our study expands the genotypic spectrums for EYS mutations, and may provide novel insights into the relevant pathogenesis for RP. We also demonstrate targeted NGS approach as a valuable tool for genetic diagnosis.

[Using exon combined target region capture sequencing chip to detect the disease-causing genes of retinitis pigmentosa].

OBJECTIVE: To detect the disease-causing genes of 10 retinitis pigmentosa pedigrees by using exon combined target region capture sequencing chip. METHODS: Pedigree investigation study. From October 2010 to December 2013, 10 RP pedigrees were recruited for this study in Ningxia Eye Hospital. All the patients and family members received complete ophthalmic examinations. DNA was abstracted from patients, family members and controls. Using exon combined target region capture sequencing chip to screen the candidate disease-causing mutations. Polymerase chain reaction (PCR) and direct sequencing were used to confirm the disease-causing mutations. RESULTS: Seventy patients and 23 normal family members were recruited from 10 pedigrees. Among 10 RP pedigrees, 1 was autosomal dominant pedigrees and 9 were autosomal recessive pedigrees. 7 mutations related to 5 genes of 5 pedigrees were detected. A frameshift mutation on BBS7 gene was detected in No.2 pedigree, the patients of this pedigree combined with central obesity, polydactyly and mental handicap. No.2 pedigree was diagnosed as Bardet-Biedl syndrome finally. A missense mutation was detected in No.7 and No.10 pedigrees respectively. Because the patients suffered deafness meanwhile, the final diagnosis was Usher syndrome. A missense mutation on C3 gene related to age-related macular degeneration was also detected in No. 7 pedigrees. A nonsense mutation and a missense mutation on CRB1 gene were detected in No. 1 pedigree and a splicesite mutation on PROM1 gene was detected in No. 5 pedigree. CONCLUSIONS: Retinitis pigmentosa is a kind of genetic eye disease with diversity clinical phenotypes. Rapid and effective genetic diagnosis technology combined with clinical characteristics analysis is helpful to improve the level of clinical diagnosis of RP.

Targeted next-generation sequencing reveals novel USH2A mutations associated with diverse disease phenotypes: implications for clinical and molecular diagnosis.

USH2A mutations have been implicated in the disease etiology of several inherited diseases, including Usher syndrome type 2 (USH2), nonsyndromic retinitis pigmentosa (RP), and nonsyndromic deafness. The complex genetic and phenotypic spectrums relevant to USH2A defects make it difficult to manage patients with such mutations. In the present study, we aim to determine the genetic etiology and to characterize the correlated clinical phenotypes for three Chinese pedigrees with nonsyndromic RP, one with RP sine pigmento (RPSP), and one with USH2. Family histories and clinical details for all included patients were reviewed. Ophthalmic examinations included best corrected visual acuities, visual field measurements, funduscopy, and electroretinography. Targeted next-generation sequencing (NGS) was applied using two sequence capture arrays to reveal the disease causative mutations for each family. Genotype-phenotype correlations were also annotated. Seven USH2A mutations, including four missense substitutions (p.P2762A, p.G3320C, p.R3719H, and p.G4763R), two splice site variants (c.8223+1G>A and c.8559-2T>C), and a nonsense mutation (p.Y3745*), were identified as disease causative in the five investigated families, of which three reported to have consanguineous marriage. Among all seven mutations, six were novel, and one was recurrent. Two homozygous missense mutations (p.P2762A and p.G3320C) were found in one individual family suggesting a potential double hit effect. Significant phenotypic divergences were revealed among the five families. Three families of the five families were affected with early, moderated, or late onset RP, one with RPSP, and the other one with USH2. Our study expands the genotypic and phenotypic variability relevant to USH2A mutations, which would help with a clear insight into the complex genetic and phenotypic spectrums relevant to USH2A defects, and is complementary for a better management of patients with such mutations. We have also demonstrated that a targeted NGS approach is a valuable tool for the genetic diagnosis of USH2 and RP.

Prevalence and associated factors of corneal blindness in Ningxia in northwest China.

AIM: To describe the prevalence and demographic characteristics of corneal blindness in an urban and rural region of Ningxia, located in the northwest part of China. METHODS: A stratified, randomized sampling procedure was employed in the study, including urban and rural area of all age group. Visual acuity, anterior segment and ocular fundus were checked. Related factor of corneal disease, including age, gender, education status, ethnic group, location and occupation, were identified according to uniform customized protocol. An eye was defined to be corneal blindness if the visual acuity was <20/400 due to a corneal disease. RESULTS: Three thousand individuals (1290 from urban area and 1710 from rural area) participated in the investigation, with a response rate of 80.380%. The prevalence of corneal blindness was 0.023% in both eyes and 0.733% in at least one eye. The blindness in at least one eye with varied causes was present in 106 participants (3.533%) and in bilateral eyes in 34 participants (1.133%). The corneal diseases accounted for 20.754% of blindness in at least one eye and 20.588% of bilateral blindness. The prevalence of corneal disease was higher in older and Han ethnic group, especially those who occupied in agriculture and outdoor work. People with corneal blindness were more likely to be older and lower education. Rural population were more likely to suffer from bilateral corneal blindness than the urban population in ≥59-year group (χ (2)=6.716, P=0.019). Infectious, trauma and immune corneal disease were the three leading causes of corneal disease. Trauma corneal disease was more likely leading to blindness in one eye. However, infectious and immune corneal diseases make more contribution to the bilateral corneal blindness. CONCLUSION: Corneal blindness is a significant burden of in Ningxia population, encompassing a variety of corneal infections and trauma; the majority of those were avoidable. Health promotion strategies and good hygienic conditions have to be developed.

Novel and recurrent MYO7A mutations in Usher syndrome type 1 and type 2.

Usher syndrome (USH) is a group of disorders manifested as retinitis pigmentosa and bilateral sensorineural hearing loss, with or without vestibular dysfunction. Here, we recruited three Chinese families affected with autosomal recessive USH for detailed clinical evaluations and for mutation screening in the genes associated with inherited retinal diseases. Using targeted next-generation sequencing (NGS) approach, three new alleles and one known mutation in MYO7A gene were identified in the three families. In two families with USH type 1, novel homozygous frameshift variant p.Pro194Hisfs*13 and recurrent missense variant p.Thr165Met were demonstrated as the causative mutations respectively. Crystal structural analysis denoted that p.Thr165Met would very likely change the tertiary structure of the protein encoded by MYO7A. In another family affected with USH type 2, novel biallelic mutations in MYO7A, c.[1343+1G>A];[2837T>G] or p.[?];[Met946Arg], were identified with clinical significance. Because MYO7A, to our knowledge, has rarely been correlated with USH type 2, our findings therefore reveal distinguished clinical phenotypes associated with MYO7A. We also conclude that targeted NGS is an effective approach for genetic diagnosis for USH, which can further provide better understanding of genotype-phenotype relationship of the disease.

PRPF4 mutations cause autosomal dominant retinitis pigmentosa.

Retinitis pigmentosa (RP), a disease characterized by progressive loss of photoreceptors, exhibits significant genetic heterogeneity. Several genes associated with U4/U6-U5 triple small nuclear ribonucleoprotein (tri-snRNP) complex of the spliceosome have been implicated in autosomal dominant RP (adRP). HPrp4, encoded by PRPF4, regulates the stability of U4/U6 di-snRNP, which is essential for continuous splicing. Here, we identified two heterozygous variants in PRPF4, including c.-114_-97del in a simplex RP patient and c.C944T (p.Pro315Leu), which co-segregates with disease phenotype in a family with adRP. Both variants were absent in 400 unrelated controls. The c.-114_-97del, predicted to affect two transcription factor binding sites, was shown to down-regulate the promoter activity of PRPF4 by a luciferase assay, and was associated with a significant reduction of PRPF4 expression in the blood cells of the patient. In fibroblasts from an affected individual with the p.Pro315Leu variant, the expression levels of several tri-snRNP components, including PRPF4 itself, were up-regulated, with altered expression pattern of SC35, a spliceosome marker. The same alterations were also observed in cells over expressing hPrp4(Pro315Leu), suggesting that they arose as a compensatory response to a compromised splicing mechanism caused by hPrp4 dysfunction. Further, over expression of hPrp4(Pro315Leu), but not hPrp4(WT), triggered systemic deformities in wild-type zebrafish embryos with the retina primarily affected, and dramatically augmented death rates in morphant embryos, in which orthologous zebrafish prpf4 gene was silenced. We conclude that mutations of PRPF4 cause RP via haploinsufficiency and dominant-negative effects, and establish PRPF4 as a new U4/U6-U5 snRNP component associated with adRP.

Identification of a novel p.R1443W mutation in RP1 gene associated with retinitis pigmentosa sine pigmento.

AIM: To screen mutations in the retinitis pigmentosa 1 (RP1) gene and the rhodopsin (RHO) gene in Chinese patients with retinitis pigmentosa sine pigmento (RPSP) and describe the genotype-phenotype relationship of the mutations. METHODS: Twenty affected, unrelated Chinese individuals with RPSP (4 autosomal dominant RPSP, 12 autosomal recessive RPSP and 4 unknown inheritance pattern) were recruited between 2009 and 2012. The clinical features were determined by complete ophthalmologic examinations. Polymerase chain reaction (PCR) and direct DNA sequencing were used to screen the entire coding region and splice junctions of the RP1 gene and the RHO gene. The cosegregation analysis and population frequency studies were performed for patients with identified mutations. RESULTS: Five variants in the RP1 gene and one in the RHO gene were detected in 20 probands. Four missense changes (rs444772, rs446227, rs414352, rs441800) and one non-coding variant (rs56340615) were common SNPs and none of them showed a significant relationship with RPSP. A missense mutation p.R1443W was identified in the RP1 gene in three affected individuals from a family with autosomal dominant RPSP and was found to cosegregate with the phenotype in this family, suggestive of pathogenic. In addition, population frequency analysis showed the p.R1443W mutation was absent in 300 healthy controls. CONCLUSION: The identification of p.R1443W mutation cosegregating in a family with autosomal dominant RPSP highlights an atypical phenotype of the RP1 gene mutation, while RHO gene is not associated with the pathogenesis of RPSP in this study. To our knowledge, this is the fist mutation identified to associate with RPSP.

Targeted sequencing of 179 genes associated with hereditary retinal dystrophies and 10 candidate genes identifies novel and known mutations in patients with various retinal diseases.

PURPOSE: Hereditary retinal dystrophies (HRDs) are a group of monogenic diseases characterized by an irreversible loss of photoreceptors. HRDs exhibit significant genetic and clinical heterogeneities challenging traditional techniques for determining disease-causal mutations. This study aims to develop an efficient molecular diagnostic platform for HRDs, and to determine the genetic basis for 25 randomly collected Chinese families with a variety of HRDs. METHODS: We designed a high throughput sequence capture microarray targeting 179 genes associated with HRDs and 10 candidate genes. We combined sequence capture with next-generation sequencing (NGS) to screen for mutations in the cohort of Chinese families. Variants detected by NGS were filtered, validated, and prioritized by pathogenicity analysis. Genotypes and phenotypes were correlated. RESULTS: We identified four recurrent single mutations, two compound mutations, and eight novel putative causative mutations, including five putative pathogenic alleles (e.g., premature stop codons and frame shifts) and three novel missense variants that are very likely pathogenic. These findings provided specific genetic diagnoses in 14 of 25 families (56%). Among these, identification of a mutation in VCAN in a family with a complicated phenotype helped to finalize the clinical diagnosis as Wagner syndrome. In another five families, 11 potential novel pathogenic variants were identified. CONCLUSIONS: A substantial number of potential new genes and new mutations associated with HRDs remain to be discovered. Identification of the novel HRDs-causing mutations in our study not only provides a better understanding of genotype-phenotype relationships in these diseases, but also demonstrates that the approach described herein is an effective method for large scale mutation detection among diverse and complicated HRDs cases.

Outcomes and possible risk factors associated with axis alignment and rotational stability after implantation of the Toric implantable collamer lens for high myopic astigmatism.

AIM: To assess the visual outcomes and possible risk factors associated with axis alignment and rotational stability after implantation of Toric implantable collamer lens (TICL) for the correction of high myopic astigmatism. METHODS: In this prospective, nonrandomized clinical study, 54 consecutive eyes of 29 patients with high myopic astigmatism received TICL implantation. To evaluate postoperative axis deviation from the intended axis, a digital anterior segment photograph was taken. The ultrasound biomicroscopy(UBM) was used to observe footplate-position. RESULTS: After mean follow-up of 8.6 months, mean manifest refractive cylinder (MRC) decreased 79.3% from (-1.88±1.49)D preoperatively to (0.39±0.61)D postoperatively. MRC within 1.00 D occurred in 68.5% (37/54) of eyes, whereas 48.1% (26/54) had MRC within 0.50 D. Mean manifest refraction spherical equivalent (MRSE) changed from (-12.08±4.22)D preoperatively to (-0.41±0.61)D postoperatively. Uncorrected binocular vision of 20/20 or better occurred in 72.2% (39/54) of patients compared with binocular best-corrected visual acuity (BCVA) of 20/20 or better in 44.4% (24/54) preoperatively. The mean difference between intended and achieved TICL axes was (6.96±8.37)°. Footplates of TICLs were in the ciliary sulcus in 22 eyes (46.3%), below the ciliary sulcus in 32 eyes (53.7%). The angle of TICL rotation had significant correlation with the footplates-position (t=2.127; P=0.045) and the postoperative TICL vaulting (r=-0.516; P=0.000). CONCLUSION: The results of our study further support the safety, efficacy and predictability of TICL for the correct high myopic astigmatism. The footplate-position of TICL and vault value should be taken into consideration as two possible risks factors for TICL rotation.