Antibacterial Activities and Life Cycle Stages of Asparagopsis armata: Implications of the Metabolome and Microbiome.

The red alga Asparagopsis armata is a species with a haplodiplophasic life cycle alternating between morphologically distinct stages. The species is known for its various biological activities linked to the production of halogenated compounds, which are described as having several roles for the algae such as the control of epiphytic bacterial communities. Several studies have reported differences in targeted halogenated compounds (using gas chromatography-mass spectrometry analysis (GC-MS)) and antibacterial activities between the tetrasporophyte and the gametophyte stages. To enlarge this picture, we analysed the metabolome (using liquid chromatography-mass spectrometry (LC-MS)), the antibacterial activity and the bacterial communities associated with several stages of the life cycle of A. armata: gametophytes, tetrasporophytes and female gametophytes with developed cystocarps. Our results revealed that the relative abundance of several halogenated molecules including dibromoacetic acid and some more halogenated molecules fluctuated depending on the different stages of the algae. The antibacterial activity of the tetrasporophyte extract was significantly higher than that of the extracts of the other two stages. Several highly halogenated compounds, which discriminate algal stages, were identified as candidate molecules responsible for the observed variation in antibacterial activity. The tetrasporophyte also harboured a significantly higher specific bacterial diversity, which is associated with a different bacterial community composition than the other two stages. This study provides elements that could help in understanding the processes that take place throughout the life cycle of A. armata with different potential energy investments between the development of reproductive elements, the production of halogenated molecules and the dynamics of bacterial communities.

Anguilla sp. diseases diagnoses and treatments: The ideal methods at the crossroads of conservation and aquaculture purposes.

Anguilla anguilla, A. japonica and A. rostrata are the most fished and consumed eel species. However, these species are Critically Endangered, Endangered and Endangered, respectively. A combination of factors is thought to be responsible for their decline including fisheries, climate change, habitat destruction, barriers to migration, pollution and pathogens. Among them, viruses, bacteria and parasites are causing weakening of wild eels and serious economic losses for fishermen and eel farmers. Early detection of pathogens is essential to provide appropriate responses both for conservation reasons and to limit economic losses. Classic diagnosis approaches are time consuming and invasive and usual treatments, for example, antipathogenic substances are becoming obsolete because of pathogen resistance and environmental impact problems. The need for early and non-invasive diagnostic methods as well as effective and environmentally friendly treatments has increased. Vaccine development and diet supplementation have known a growing interest since their use could allow prevention of diseases. In this review, we summarize the main pathogens-viruses, bacteria and parasites-of the three northern temperate eel species, the methods used to detect these pathogens and the different treatments used. We discussed and highlighted the need for non-invasive, rapid and efficient detection methods, as well as effective and environmentally friendly treatments for both conservation and aquaculture purposes.

A world of taxonomic pain: cryptic species, inexplicable host-specificity, and host-induced morphological variation among species of Bivesicula Yamaguti, 1934 (Trematoda: Bivesiculidae) from Indo-Pacific Holocentridae, Muraenidae and Serranidae.

The taxonomy of species of Bivesicula Yamaguti, 1934 is analysed for samples from holocentrid, muraenid and serranid fishes from Japan, Ningaloo Reef (Western Australia), the Great Barrier Reef (Queensland), New Caledonia and French Polynesia. Analysis of three genetic markers (cox1 mtDNA, ITS2 and 28S rDNA) identifies three strongly supported clades of species and suggests that Bivesicula as presently recognized is not monophyletic. On the basis of combined morphological, molecular and biological data, 10 species are distinguished of which five are proposed as new. Bivesicula Clade 1 comprises seven species of which three are effectively morphologically cryptic relative to each other; all seven infect serranids and four also infect holocentrids. Bivesicula Clade 2 comprises three species of which two are effectively morphologically cryptic relative to each other; all three infect serranids and one also infects a muraenid. Bivesicula Clade 3 comprises two known species from apogonids and a pomacentrid, and forms a clade with species of Paucivitellosus Coil, Reid & Kuntz, 1965 to the exclusion of other Bivesicula species. Taxonomy in this genus is made challenging by the combination of low resolving power of ribosomal markers, the existence of regional cox1 mtDNA populations, exceptional and unpredictable host-specificity and geographical distribution, and significant host-induced morphological variation.

Prevalence and identification of Anisakis nematodes in fish consumed in Marrakesh, Morocco.

Morocco is considered as an important producer of fish with more than one million tons of small pelagic fish caught per year, along more than 3400 km of coastline. Otherwise, few studies have investigated the zoonotic parasites of fish. The purpose of this study is to determine the prevalence of Anisakis nematodes larvae in two fish species, namely sardines Sardina pilchardus and mackerel Scomber scombrus. These two species are widely consumed in Marrakesh due to their availability and their affordable prices. A total of 948 fish, including 546 sardines and 402 mackerel, were purchased from the wholesale market of Marrakesh, from January 2016 to December 2018. Sampling was performed on the days of fish arrival from the fishing areas (Dakhla, Essaouira, Safi and Sidi Ifni). The samples were examined visually for the presence of Anisakis larvae. We obtained a prevalence of 8.4% in mackerel with different rates depending on their origins (Safi: 13.23%; Essaouira: 11.66%; Sidi Ifni: 2.5%; Dakhla: 0%) and the seasons. However, no larvae were detected in the sardines after meticulous visual inspection. The detected larvae were morphologically and genetically identified. We identified the larvae by the PCR-RFLP technique using the primers LSU5-F (TAGGTCGACCCGCTGAAYTTAAGCA) and IR16-R (ATTCACACCCATTGACTCGCG) from the 28S rDNA region. The analysis showed that all larvae belong to Anisakis simplex sensu-stricto (s.s.). According to our results mackerel presents a higher risk of contamination than sardine, while statistical studies show that there is no impact of season and fishing origin on the prevalence.

Isotopic discrimination in helminths infecting coral reef fishes depends on parasite group, habitat within host, and host stable isotope value.

Stable isotopes of carbon and nitrogen characterize trophic relationships in predator-prey relationships, with clear differences between consumer and diet (discrimination factor Δ13C and Δ15N). However, parasite-host isotopic relationships remain unclear, with Δ13C and Δ15N remaining incompletely characterized, especially for helminths. In this study, we used stable isotopes to determine discrimination factors for 13 parasite-host pairings of helminths in coral reef fish. Differences in Δ15N values grouped according to parasite groups and habitat within the host with positive Δ15N values observed for trematodes and nematodes from the digestive tract and variable Δ15N values observed for cestodes and nematodes from the general cavity. Furthermore, Δ13C values showed more complex patterns with no effect of parasite group or habitat within host. A negative relationship was observed between Δ15N and host δ15N values among different host-parasite pairings as well as within 7 out of the 13 pairings, indicating that host metabolic processing affects host-parasite discrimination values. In contrast, no relationships were observed for Δ13C values. Our results indicate that parasite group, habitat within host, and host stable isotope value drive Δ15N of helminths in coral reef fish while their effect on Δ13C is more idiosyncratic. These results call for use of taxon- or species-specific and scaled framework for bulk stable isotopes in the trophic ecology of parasites.

Distribution of anguillid leptocephali and possible spawning areas in the South Pacific Ocean.

Seven South Pacific anguillid eel species live from New Guinea to French Polynesia, but their spawning areas and life histories are mostly unknown despite previous sampling surveys. A July-October 2016 research cruise was conducted to study the spawning areas and times, and larval distributions of South Pacific anguillid eels, which included a short 155°E station-line northeast of New Guinea and five long transects (5-25°S, 160°E-140°W) crossing the South Equatorial (SEC) and other currents. This survey collected nearly 4000 anguilliform leptocephali at 179 stations using an Isaacs-Kidd Midwater Trawl accompanied by 104 CTD casts. Based on mor-phometric observations and DNA sequencing, 74 anguillid leptocephali were collected, which in the southern areas included 29 larvae of six species: Anguilla bicolor pacifica, A. marmorata, A. australis, A. reinhardtii, A. megastoma, and A. obscura (all anguillid species of the region were caught except A. dieffenbachii). Small A. australis (9.0-16.8 mm) and A. reinhardtii (12.4, 12.5 mm) leptocephali were collected south of the Solomon Islands, other A. australis (10.8-12.0 mm) larvae were caught northwest of Fiji along with an A. obscura (20.0 mm) larva, and an A. marmorata (7.8 mm) larva was collected near Samoa. Considering collection sites, larval ages from otolith analysis, and westward SEC drift, multiple spawning locations occurred from south of the Solomon Islands and the Fiji area (16-20 days old larvae) to near Samoa (19 days old larva) during June and July in areas where high-salinity Subtropical Underwater (STUW, ~150 m depth) and the warm, low-salinity surface Fresh Pool were present. Five long hydrographic sections showed the strong Fresh Pool in the west and the STUW formation area in the east.

Individual back-calculated size-at-age based on otoliths from Pacific coral reef fish species.

Somatic growth is a critical biological trait for organismal, population, and ecosystem-level processes. Due to its direct link with energetic demands, growth also represents an important parameter to estimate energy and nutrient fluxes. For marine fishes, growth rate information is most frequently derived from sagittal otoliths, and most of the available data stems from studies on temperate species that are targeted by commercial fisheries. Although the analysis of otoliths is a powerful tool to estimate individual growth, the time-consuming nature of otolith processing is one barrier for collection of comprehensive datasets across multiple species. This is especially true for coral reef fishes, which are extremely diverse. Here, we provide back-calculated size-at-age estimates (including measures of uncertainty) based on sagittal otoliths from 710 individuals belonging to 45 coral reef fish species from French Polynesia. In addition, we provide Von Bertalanffy growth parameters which are useful to predict community level biomass production.

Insights into the Natural Defenses of a Coral Reef Fish Against Gill Ectoparasites: Integrated Metabolome and Microbiome Approach.

Understanding natural defense mechanisms against parasites can be a valuable tool for the development of innovative therapies. We have previously identified a butterflyfish species (Chaetodon lunulatus) that avoids gill monogenean parasites while living amongst closely related parasitized species. The metabolome and microbiome of several sympatric butterflyfish species from the island of Moorea (French Polynesia) were previously described. In this study, we used the previously generated datasets in an attempt to identify metabolites and bacteria potentially involved in parasite defense mechanisms. We investigated the interplay between the gill mucus metabolome and microbiome of the non-susceptible C. lunulatus versus sympatric butterflyfish species that were always found parasitized in the Central and Eastern Indo-Pacific. After observing significant differences between the metabolome and bacteria of susceptible versus non-susceptible fish, we obtained the discriminant metabolites and operational taxonomic units (OTUs) using a supervised analysis. Some of the most important discriminant metabolites were identified as peptides, and three new peptides derived from ß-subunit hemoglobin from C. lunulatus (CLHbß-1, CLHbß-2, and CLHbß-3) were purified, characterized and synthesized to confirm their structures. We also identified specific bacterial families and OTUs typical from low-oxygen habitats in C. lunulatus gill mucus. By using a correlation network between the two datasets, we found a Fusobacteriaceae strain exclusively present in C. lunulatus and highly correlated to the peptides. Finally, we discuss the possible involvement of these peptides and Fusobacteriaceae in monogenean avoidance by this fish species.

A DNA barcode reference library of French Polynesian shore fishes.

The emergence of DNA barcoding and metabarcoding opened new ways to study biological diversity, however, the completion of DNA barcode libraries is fundamental for such approaches to succeed. This dataset is a DNA barcode reference library (fragment of Cytochrome Oxydase I gene) for 2,190 specimens representing at least 540 species of shore fishes collected over 10 years at 154 sites across the four volcanic archipelagos of French Polynesia; the Austral, Gambier, Marquesas and Society Islands, a 5,000,000 km2 area. At present, 65% of the known shore fish species of these archipelagoes possess a DNA barcode associated with preserved, photographed, tissue sampled and cataloged specimens, and extensive collection locality data. This dataset represents one of the most comprehensive DNA barcoding efforts for a vertebrate fauna to date. Considering the challenges associated with the conservation of coral reef fishes and the difficulties of accurately identifying species using morphological characters, this publicly available library is expected to be helpful for both authorities and academics in various fields.

Intermediate host switches drive diversification among the largest trematode family: evidence from the Polypipapiliotrematinae n. subf. (Opecoelidae), parasites transmitted to butterflyfishes via predation of coral polyps.

Podocotyloides stenometra Pritchard, 1966 (Digenea: Opecoelidae) is the only trematode known to infect anthozoan corals. It causes disease in coral polyps of the genus Porites Link (Scleractinia: Poritidae) and its life-cycle depends on ingestion of these polyps by butterflyfishes (Perciformes: Chaetodontidae). This species has been reported throughout the Indo-Pacific, from the Seychelles to the Galápagos, but no study has investigated whether multiple species are involved. Here, we recollect P. stenometra from its type-host and type-locality, in Hawaiian waters, and describe four new species from examination of 768 butterflyfishes from French Polynesia. On the basis of morphology, phylogeny and life-history, we propose Polypipapiliotrema Martin, Cutmore & Cribb n. gen. and the Polypipapiliotrematinae Martin, Cutmore & Cribb n. subf., for P. stenometra (Pritchard) n. comb., P. citerovarium Martin, Cutmore & Cribb n. sp., P. hadrometra Martin, Cutmore & Cribb n. sp., P. heniochi Martin, Cutmore & Cribb n. sp., and P. ovatheculum Martin, Cutmore & Cribb n. sp. Given the diversity uncovered here and the ubiquity, abundance and diversity of butterflyfishes on coral reefs, we predict that Polypipapiliotrema will prove to comprise a rich complex of species causing disease in corals across the Indo-Pacific. The unique life-cycle of these taxa is consistent with phylogenetic distinction of the group and provides evidence for a broader basis of diversification among the family. We argue that life-cycle specialisation, in terms of adoption of disparate second intermediate host groups, has been a key driver of the diversification and richness of the Opecoelidae, the largest of all trematode families and the group most frequently encountered in coral reef fishes.

A revision of the genus Aphalloides (Digenea: Cryptogonimidae), parasites of European brackish water fishes.

Trematodes of the genus Aphalloides Dollfus, Chabaud & Golvan, 1957 reach maturity in their second intermediate host, small fishes of the family Gobionellidae, genera Pomatoschistus and Knipowitschia. Two morphologically similar species have been described from European waters: Aphalloides coelomicola Dollfus et al., 1957 in the Mediterranean Sea (including the brackish Black Sea region) and Aphalloides timmi Reimer, 1970 in the Baltic Sea. There was no difference in morphology and morphometry for specimens corresponding to A. coelomicola and A. timmi and examination of the 28S rDNA sequence confirmed the similarity. Based on these results, these two species are synonymized and A. coelomicola redescribed.

Characterisation of the gill mucosal bacterial communities of four butterflyfish species: a reservoir of bacterial diversity in coral reef ecosystems.

While recent studies have suggested that fish mucus microbiota play an important role in homeostasis and prevention of infections, very few studies have investigated the bacterial communities of gill mucus. We characterised the gill mucus bacterial communities of four butterflyfish species and although the bacterial diversity of gill mucus varied significantly between species, Shannon diversities were high (H = 3.7-5.7) in all species. Microbiota composition differed between butterflyfishes, with Chaetodon lunulatus and C. ornatissimus having the most similar bacterial communities, which differed significantly from C. vagabundus and C. reticulatus. The core bacterial community of all species consisted of mainly Proteobacteria followed by Actinobacteria and Firmicutes. Chaetodonlunulatus and C. ornatissimus bacterial communities were mostly dominated by Gammaproteobacteria with Vibrio as the most abundant genus. Chaetodonvagabundus and C. reticulatus presented similar abundances of Gammaproteobacteria and Alphaproteobacteria, which were well represented by Acinetobacter and Paracoccus, respectively. In conclusion, our results indicate that different fish species present specific bacterial assemblages. Finally, as mucus layers are nutrient hotspots for heterotrophic bacteria living in oligotrophic environments, such as coral reef waters, the high bacterial diversity found in butterflyfish gill mucus might indicate external fish mucus surfaces act as a reservoir of coral reef bacterial diversity.

Effects of local Polynesian plants and algae on growth and expression of two immune-related genes in orbicular batfish (Platax orbicularis).

The emerging orbicular batfish (Platax orbicularis) aquaculture is the most important fish aquaculture industry in French Polynesia. However, bacterial infections are causing severe mortality episodes. Therefore, there is an urgent need to find an effective management solution. Besides the supplying difficulty and high costs of veterinary drugs in French Polynesia, batfish aquaculture takes place close to the coral reef, where use of synthetic persistent drugs should be restricted. Medicinal plants and bioactive algae are emerging as a cheaper and more sustainable alternative to chemical drugs. We have studied the effect of local Polynesian plants and the local opportunistic algae Asparagopsis taxiformis on batfish when orally administered. Weight gain and expression of two immune-related genes (lysozyme g - Lys G and transforming growth factor beta - TGF-ß1) were studied to analyze immunostimulant activity of plants on P. orbicularis. Results showed that several plants increased Lys G and TGF-ß1 expression on orbicular batfish after 2 and 3 weeks of oral administration. A. taxiformis was the plant displaying the most promising results, promoting a weight gain of 24% after 3 weeks of oral administration and significantly increasing the relative amount of both Lys G and TGF-ß1 transcripts in kidney and spleen of P. orbicularis.

Gill monogenean communities (Platyhelminthes, Monogenea, Dactylogyridae) of butterflyfishes from tropical Indo-West Pacific Islands.

We studied the monogenean communities of 34 species of butterflyfish from the tropical Indo-West Pacific, identifying 13 dactylogyrid species (including two species that are presently undescribed). Monogenean assemblages differed significantly between host species in terms of taxonomic structure, intensity and prevalence. Parasite richness ranged from 0 (Chaetodon lunulatus) to 11 (C. auriga, C. citrinellus and C. lunula). Host specificity varied between the dactylogyrids species, being found on 2-29 of the 34 chaetodontid species examined. Sympatric butterflyfish species were typically parasitized by different combinations of dactylogyrid species, suggesting the existence of complex host-parasite interactions. We identified six clusters of butterflyfish species based on the similarities of their dactylogyrid communities. Dactylogyrid richness and diversity were not related to host size, diet specialization, depth range or phylogeny of butterflyfish species. However, there was a weak positive correlation between monogenean richness and diversity and host geographical range. Most communities of dactylogyrids were dominated by Haliotrema aurigae and H. angelopterum, indicating the importance of the genus Haliotrema in shaping monogenean communities of butterflyfishes. This study casts light on the structure of the monogenean communities of butterflyfishes, suggesting that the diversity and complexity of community structures arises from a combination of host species-specific parameters.

A case of complete loss of gill parasites in the invasive cichlid Oreochromis mossambicus.

This study investigates the recent evolution of a rich parasite community associated with one of the world's most invasive species, the cichlid fish Oreochromis mossambicus. Populations from the species' native range (Mozambique) are compared to a population from New Caledonia (Wester Pacific), an island where the species was introduced in 1954. The results support the complete local extinction of the gill parasite community in the course of the invasion process. Up to six gill parasite species per locality were documented in the O. mossambicus native range, and previous surveys consistently reported at least one parasite species introduced along African cichlid species established out of Africa. The absence of parasites in New Caledonia is therefore exceptional. This can be attributed to local factors, such as a strong initial population bottleneck, the likely absence of multiple host introductions, and the frequent occurrence of brackish watersheds that might enhance the probability for natural deparasitation.

Links between parasitism, energy reserves and fecundity of European anchovy, Engraulis encrasicolus, in the northwestern Mediterranean Sea.

The European anchovy, Engraulis encrasicolus L. 1758, is one of the most sought-after target species in the northwestern Mediterranean Sea. However, this stock currently consists of small individuals, and landings are reported to have decreased considerably. The main purpose of this study was to assess, for the first time, the interrelationships between size, fecundity, energy reserves and parasitism in female anchovies, in order to analyse the potential implications for the health of northwestern Mediterranean anchovy stocks arising from the current shortage of large individuals. Results revealed that smaller individuals show lower fecundity, lower lipid content and a higher intensity of certain parasites. As it is known that smaller individuals now predominate in the population, the relationships found in this study indicate that the health of anchovies from the northwestern Mediterranean is currently impaired.

Biogeography of tropical Indo-West Pacific parasites: a cryptic species of Transversotrema and evidence for rarity of Transversotrematidae (Trematoda) in French Polynesia.

We sought transversotrematid trematodes from French Polynesian fishes by examining 304 individual scaled fishes of 53 species from seven families known to harbour the family elsewhere. A single species was found at two locations in the Tuamotus Archipelago on two species of Chaetodontidae (Chaetodon auriga and Chaetodon ephippium) and one species of Lutjanidae (Lutjanus gibbus). The species closely resembles Transversotrema borboleta Hunter & Cribb, 2012 from chaetodontids and lutjanids of the northern Great Barrier Reef (GBR) but differs from it consistently in 8 base positions of ITS2 rDNA. This level of variation exceeds that between some clearly morphologically distinct pairs of species of Transversotrema and the form from French Polynesia is thus interpreted as a distinct, though cryptic, species and named Transversotrema polynesiae n. sp. The new species forms part of a complex of species, here characterised as the T. borboleta complex, associated with chaetodontids and lutjanids in the tropical Indo-West Pacific. Most of the putative species within this complex are yet to be described. Comparison of identical numbers of matched samples of fishes from French Polynesia, Heron Island (southern GBR) and Lizard Island (northern GBR) revealed 1, 4 and 10 species of Transversotrema respectively suggesting that the French Polynesian fauna is depauperate for this family. In addition to those species apparently missing from suitable hosts in French Polynesia, several species from further west infect fishes (especially Nemipteridae) that are themselves absent from French Polynesia. This dramatic east-west decline in richness contrasts strongly with what is known for monogeneans, which appear to maintain their richness over the same scale, and is more precipitate than is known for other groups of trematodes. The decline might be explained in part by the absence of the as yet unknown first intermediate hosts in French Polynesia. However, we predict that it is explained by other life cycle traits. We hypothesise that the characters of large short-lived cercariae, short-lived miracidia, the absence in the life-cycle of second intermediate hosts that are capable of transporting the species, and definitive and first intermediate hosts that have limited vagility combine to give marine Transversotrematidae limited dispersal capacity and a propensity for localised speciation.

Henneguya mauritaniensis n. sp. (Myxozoa) from the arterial bulb of Pagrus caeruleostictus (Valenciennes, 1830) off Mauritania.

We describe a new species of myxozoan, Henneguya mauritaniensis n. sp., extracted from the arterial bulb of the bluespotted seabream, Pagrus caeruleostictus (Valenciennes, 1830), collected in Mauritanian waters. Out of the 209 individuals examined, 30.1 % were infected with this new taxon. Spore total length ranged from 15.0 to 20.5 µm with a mean of 17.9 µm. The two polar capsules were equal in size, and pyriform and caudal appendages joined until mid-length. Morphometric analysis revealed significant differences between H. mauritaniensis n. sp. and morphologically similar species from this region as well as congeners known from other sparid hosts. Phylogenetic analysis of 18 S rDNA indicated that this new species is closely related to Henneguya pagri, reported recently from Pagrus major off Japan. Bayesian inference and maximum likelihood analyses of the 18 S rDNA dataset also revealed that species of marine Henneguya reported forming pseudocysts in the hearts of their fish hosts were closely related. Histological analysis of the H. mauritaniensis n. sp. pseudocysts embedded in the arterial bulb of P. caeruleostictus suggests that these parasites may cause considerable pathology, which may impact negatively on the health of the fish host. Finally, we discussed the importance of a combination of morphological and molecular analysis for species description because of high variability in size within the same taxa.

Complete genomic sequence and taxonomic position of eel virus European X (EVEX), a rhabdovirus of European eel.

Eel virus European X (EVEX) was first isolated from diseased European eel Anguilla anguilla in Japan at the end of seventies. The virus was tentatively classified into the Rhabdoviridae family on the basis of morphology and serological cross reactivity. This family of viruses is organized into six genera and currently comprises approximately 200 members, many of which are still unassigned because of the lack of molecular data. This work presents the morphological, biochemical and genetic characterizations of EVEX, and proposes a taxonomic classification for this virus. We provide its complete genome sequence, plus a comprehensive sequence comparison between isolates from different geographical origins. The genome encodes the five classical structural proteins plus an overlapping open reading frame in the phosphoprotein gene, coding for a putative C protein. Phylogenic relationship with other rhabdoviruses indicates that EVEX is most closely related to the Vesiculovirus genus and shares the highest identity with trout rhabdovirus 903/87.

Swim bladder nematodes (Anguillicoloides crassus) disturb silvering in European eels (Anguilla anguilla).

The introduced parasite Anguillicoloides crassus is thought to play an important role in the decline of freshwater eel (Anguilla spp.) populations. These nematodes are known to negatively affect many fitness-related traits in eels. We used experimental infections to study the effect of A. crassus on the relative size or mass of organs, and the expression of functionally relevant genes (total of 12 parameters) that are involved in the silvering process of Anguilla anguilla. Our results showed that the liver mass, the hemoglobin α-chain, and androgen receptors α expression levels were significantly higher in infected eels, whereas the freshwater rod opsin expression level and the gut mass were significantly lower in infected eels. Our results suggested that infected eels were at a more advanced stage in the silvering process than uninfected counterparts of similar size. These results may be explained by 2 hypotheses. First, A. crassus could trigger physiological mechanisms involved in the silvering process as a side-effect of infection. Second, eels may adjust their life history traits in response to infection. The implications for eel migration and reproductive success may be either negative or positive, depending on whether the response to A. crassus infection results in an additional cost of the parasite or is due to the phenotypic plasticity of the host.