RESUMO
In this study, Delonix regia seed pods (DRSPs) as a locally available material were refluxed in 90% H2SO4 to yield a novel D. regia seed pods biochar-sulfur oxide (DRB-SO). FTIR, BET, BJH, SEM, EDX, XRD, DSC and TGA were applied to investigate the characterizations of the prepared DRB-SO. Various adsorption parameters like pH effect, dye concentration effect, adsorbent dose, reaction time isotherm and kinetic study were carried out to explain the process of adsorption of methyl orange (MO) and methyl red (MR) onto DRB-SO. Langmuir's adsorption model perfectly explained the adsorption process onto the surface of DRB-SO as a monolayer. The maximum adsorption efficiency of DRB-SO was (98%) and (99.6%) for MO and MR respectively which attained after 150 min with an adsorbent dose of 0.75 g/L. The pseudo-second-order kinetic model best explained the process of adsorption of MO and MR dyes by DRB-SO. The highest observed adsorption amount was as high as 144.9 mg/g for MO dye and 285.7 mg/g for MR dye, comparable with other reported materials based on activated carbon materials. All of the outcomes signposted a prodigious perspective of the fabricated biochar composite material in wastewater treatment. Using the regenerating DRB-SO through an acid-base regeneration process, six cycles of adsorption/desorption were examined. Over the course of the cycles, there was a minor decrease in the adsorption and desorption processes. Also, it was revealed what the most plausible mechanism was for DRB-SO to absorb the ions of the MO and MR dyes.
RESUMO
RET proto-oncogene encodes receptor tyrosine kinase. Selpercatinib and pralsetinib are the only RET-specific tyrosine kinase inhibitors approved by FDA in RET-altered tumors. We searched PubMed, Embase, Cochrane, WOS, and Clinicaltrials.gov. Objective-response, complete-response, and partial-response were 60-89%, 0-11%, and 55-89%, respectively, with the use of RET-specific drugs. ≥Grade 3 adverse events were seen in 28-53% of the patients, with hypertension, change in ALT, QT prolongation, neutropenia, and pneumonitis among the common side effects. Hence, selpercatinib and pralsetinib were effective and well tolerated by most of the patients with RET-altered tumors.
Assuntos
Efeitos Colaterais e Reações Adversas Relacionados a Medicamentos , Hipertensão , Neoplasias Pulmonares , Neoplasias , Neutropenia , Humanos , Neoplasias/tratamento farmacológico , Inibidores de Proteínas Quinases/efeitos adversos , Proteínas Proto-Oncogênicas c-ret/genéticaRESUMO
The incidence and prevalence of neuroendocrine neoplasms (NENs) has increased in the US in recent decades. These are well-vascularized tumors, but no antiangiogenic drug has been approved for treatment of extra-pancreatic NENs. The aim is to assess efficacy and safety of surufatinib in pancreatic and extra-pancreatic NETs. We searched PubMed, Embase, Cochrane Library, Web of Science and Clinicaltrials.gov. Clinical trials and observational studies that provided safety and efficacy data in clinical terms were included. Characteristics of the study, baseline characteristics of participants, treatment drugs, measures of efficacy, and toxicity (≥grade 3 adverse effects) were extracted. The meta-analysis was performed using the "R" programming language. Risk ratio (RR) of objective response (OR)/partial response (PR) was 8.55 (95% CI: 1.68-43.66, I2 = 0) in favor of surufatinib. The hazard ratio (HR) of progression-free survival (PFS) was 0.48 (95% CI: 0.25-0.92, I2 = 77%) in favor of surufatinib. The risk of ≥grade 3 adverse effects: diarrhea, hypertension, hypertriglyceridemia, proteinuria, and vomiting were high with the use of surufatinib. Quality of life (QoL) was similar in surufatinib and placebo groups except for the diarrhea that was high with surufatinib. Lack of randomized clinical trials in non-Chinese population. Surufatinib is well tolerated and is more effective than placebo in both pancreatic and extra-pancreatic NETs. More multicenter randomized, double-blinded clinical trials are needed to confirm these results.
Assuntos
Tumores Neuroendócrinos , Diarreia/induzido quimicamente , Humanos , Indóis , Estudos Multicêntricos como Assunto , Tumores Neuroendócrinos/tratamento farmacológico , Tumores Neuroendócrinos/epidemiologia , Tumores Neuroendócrinos/patologia , Pirimidinas , Qualidade de Vida , SulfonamidasRESUMO
The distinctive flavours in hard cheeses are attributed largely to the activity of nonstarter lactic acid bacteria (NSLAB) which dominate the cheese matrix during maturation after lactose is consumed. Understanding how different strains of NSLAB survive, compete, and scavenge available nutrients is fundamental to selecting strains as potential adjunct starters which may influence product traits. Three Lacticaseibacillus paracasei isolates which dominated at different stages over 63-week maturation periods of Australian Cheddar cheeses had the same molecular biotype. They shared many phenotypic traits, including salt tolerance, optimum growth temperature, growth on N-acetylglucosamine and N-acetylgalactosamine plus delayed growth on D-ribose, carbon sources likely present in cheese due to bacterial autolysis. However, strains 124 and 163 (later named GCRL163) survived longer at low pH and grew on D-tagatose and D-mannitol, differentiating this phenotype from strain 122. When cultured on growth-limiting lactose (0.2%, wt/vol) in the presence of high concentrations of L-leucine and other amino acids, GCRL163 produced, and subsequently consumed lactate, forming acetic and formic acids, and demonstrated temporal accumulation of intermediates in pyruvate metabolism in long-term cultures. Strain GCRL163 grew in Tween 80-tryptone broths, a trait not shared by all L. casei-group dairy isolates screened in this study. Including citrate in this medium stimulated growth of GCRL163 above citrate alone, suggesting cometabolism of citrate and Tween 80. Proteomic analysis of cytosolic proteins indicated that growth in Tween 80 produced a higher stress state and increased relative abundance of three cell envelope proteinases (CEPs) (including PrtP and Dumpy), amongst over 230 differentially expressed proteins.
Assuntos
Queijo , Lactobacillales , Austrália , Ácido Láctico , Lactobacillales/genética , ProteômicaRESUMO
Breast cancer is the most common cause of cancer-related deaths among women. There are a limited number of targeted therapies available for triple-negative breast cancer (TNBC), and chemotherapy is the mainstay of treatment. Among checkpoint inhibitors, atezolizumab is the only drug approved for PD-L1+ TNBC patients. We performed a systematic review to assess the efficacy and safety of PD-1 inhibitor pembrolizumab in triple-negative breast cancer. We included 15 clinical trials in this review. Pembrolizumab was well tolerated by all patients with triple-negative breast cancer. Pembrolizumab was more effective in the treatment of early-stage TNBC patients as compared to placebo, regardless of PD-L1 status. In advanced-stage breast cancer, pembrolizumab was as effective as single-agent chemotherapy with a better safety profile. Pembrolizumab with chemotherapy showed significantly better median progression free survival as compared to chemotherapy in advanced TNBC.
Assuntos
Neoplasias de Mama Triplo Negativas , Anticorpos Monoclonais Humanizados , Protocolos de Quimioterapia Combinada Antineoplásica , Feminino , Humanos , Neoplasias de Mama Triplo Negativas/tratamento farmacológicoRESUMO
The objective of this study was to evaluate the effects of quantitative feed restriction, along with dietary supplementation with a probiotic blend (Protexin) as a natural growth promoter, on the performance, water consumption, mortality rate and carcass traits of meat-type quails. A total of 250 1-day unsexed quails were randomly allocated to five equal groups in a completely randomized design. The first group (A) fed a basal diet without any restriction (24 hr/day); the second group (B1) fed the basal diet for 20 hr/day; the third group (B2) fed the basal diet enriched with probiotic (0.1 g/kg diet) for 20 hr/day; the fourth group (C1) fed the basal diet for 16 hr/day; and the fifth group (C2) fed the basal diet enriched with probiotic (0.1 g/kg diet) for 16 hr/day. Birds were fed ad-libitum from 0-14 days of age, and then the feed restriction regimes started from 14 till 28 days of age. Results showed that quails in the control-group consumed more feed and water than the other treatment groups (p < .01), however their body weights did not differ (p > .05) compared with the other treated groups. The best feed conversion values were achieved in quails supplemented with probiotic blend (B2 and C2) in comparison with the other groups (p < .01). Feeding probiotic had a positive effect on bird health which reduced the mortality rate. Further, mortality rate was significantly reduced (p < .05) by feed restriction, with or without probiotic supplementation. No carcass parameters were significantly affected (p > .05) by treatments. Our results show that quail could be reared under a feed restriction system, for 4-8 hr daily, along with dietary supplementation of probiotic as growth promoter for better growth performance.
Assuntos
Dieta/veterinária , Métodos de Alimentação/veterinária , Probióticos/uso terapêutico , Fenômenos Fisiológicos da Nutrição Animal , Animais , Peso Corporal/efeitos dos fármacos , Suplementos Nutricionais , Carne/análise , Mortalidade , CodornizRESUMO
Bacteriophages (phages/viruses) need host bacteria to replicate and propagate. Primarily, a bacteriophage contains a head/capsid to encapsidate the genetic material. Some phages contain tails. Phages encode endolysins to hydrolyze bacterial cell wall. The two main classes of phages are lytic or virulent and lysogenic or temperate. In comparison with antibiotics, to deal with bacterial infections, phage therapy is thought to be more effective. In 1921, the use of phages against bacterial infections was first demonstrated. Later on, in humans, phage therapy was used to treat skin infections caused by Pseudomonas species. Furthermore, phages were successfully employed against infections in animals - calves, lambs, and pigs infected with Escherichia coli. In agriculture, for instance, phages have successfully been used e.g., Apple blossom infection, caused by Erwinia amylovora, was effectively catered with the use of bacteriophages. Bacteriophages were also used to control E. coli, Salmonella, Listeria, and Campylobacter contamination in food. Comparatively, phage display is a recently discovered technology, whereby, bacteriophages play a significant role. This review is an effort to collect almost recent and relevant information regarding applications and complications associated with the use of bacteriophages.
Assuntos
Infecções Bacterianas/terapia , Bacteriófagos/fisiologia , Terapia por Fagos , Agricultura , Doenças dos Animais/microbiologia , Doenças dos Animais/terapia , Animais , Antibacterianos/uso terapêutico , Bactérias/patogenicidade , Bactérias/virologia , Bacteriófagos/ultraestrutura , Bovinos , DNA Viral , Contaminação de Alimentos/prevenção & controle , Inocuidade dos Alimentos , História do Século XX , História do Século XXI , Humanos , Lisogenia/fisiologia , Terapia por Fagos/história , Terapia por Fagos/métodos , Terapia por Fagos/tendências , Doenças das Plantas/microbiologia , Doenças das Plantas/terapia , Ovinos , SuínosRESUMO
OBJECTIVES: To identify the underlying gene mutation in a large consanguineous Pakistani family. Methods: This is an observational descriptive study carried out at the Department of Biochemistry, Shifa International Hospital, Quaid-i-Azam University, and Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, Pakistan from 2013-2016. Genomic DNA of all recruited family members was extracted and the Trusight one sequencing panel was used to assess genes associated with a neuro-muscular phenotype. Comparative modeling of mutated and wild-type protein was carried out by PyMOL tool. Results: Clinical investigations of an affected individual showed typical features of Miyoshi myopathy (MM) like elevated serum creatine kinase (CK) levels, distal muscle weakness, myopathic changes in electromyography (EMG) and muscle histopathology. Sequencing with the Ilumina Trusight one sequencing panel revealed a novel 22 nucleotide duplication (CTTCAACTTGTTTGACTCTCCT) in the DYSF gene (NM_001130987.1_c.897-918dup; p.Gly307Leufs5X), which results in a truncating frameshift mutation and perfectly segregated with the disease in this family. Protein modeling studies suggested a disruption in spatial configuration of the putative mutant protein. Conclusion: A novel duplication of 22 bases (c.897_918dup; p.Gly307Leufs5X) in the DYSF gene was identified in a family suffering from Miyoshi myopathy. Protein homology analysis proposes a disruptive impact of this mutation on protein function.
Assuntos
Miopatias Distais/genética , Disferlina/genética , Duplicação Gênica , Atrofia Muscular/genética , Mutação , Adulto , Feminino , Humanos , Masculino , Paquistão , Linhagem , Adulto JovemRESUMO
The interaction of anticancer chalcone [AMC, 1-(4'-aminophenyl)-3-(4-N,N-dimethylphenyl)-2-propen-1-one] with DNA has been explored using electrochemical, spectroscopic and viscometric techniques. A shift in peak potential and decrease in peak current were observed in cyclic voltammetry and hypochromism accompanied with bathochromic shift were noticed in UV-Vis absorption spectroscopy. These findings were taken as evidence for AMC -DNA intercalation. A binding constant (K) with a value of 6.15 x 10(5) M(-1) was obtained from CV data, which was also confirmed by UV-Vis absorption titration. Moreover, the diffusion coefficient of the drug with and without DNA (D(b) and D(u)), heterogeneous electron transfer rate constant (k(o)) and electron affinity (A) were also calculated from electrochemical data.