De novel heterozygous copy number deletion on 7q31.31-7q31.32 involving TSPAN12 gene with familial exudative vitreoretinopathy in a Chinese family.

AIM: To investigate the genetic and clinical characteristics of patients with a large heterozygous copy number deletion on 7q31.31-7q31.32. METHODS: A family with familial exudative vitreoretinopathy (FEVR) phenotype was included in the study. Whole-exome sequencing (WES) was initially used to locate copy number variations (CNVs) on 7q31.31-31.32, but failed to detect the precise breakpoint. The long-read sequencing, Oxford Nanopore sequencing Technology (ONT) was used to get the accurate breakpoint which is verified by quantitative real-time polymerase chain reaction (QPCR) and Sanger Sequencing. RESULTS: The proband, along with her father and younger brother, were found to have a heterozygous 4.5 Mb CNV deletion located on 7q31.31-31.32, which included the FEVR-related gene TSPAN12. The specific deletion was confirmed as del(7)(q31.31q31.32)chr7:g.119451239_123956818del. The proband exhibited a phase 2A FEVR phenotype, characterized by a falciform retinal fold, macular dragging, and peripheral neovascularization with leaking of fluorescence. These symptoms led to a significant decrease in visual acuity in both eyes. On the other hand, the affected father and younger brother showed a milder phenotype. CONCLUSION: The heterozygous CNV deletion located on 7q31.31-7q31.32 is associated with the FEVR phenotype. The use of long-read sequencing techniques is essential for accurate molecular diagnosis of genetic disorders.

Four different gene-related cone-rod dystrophy: clinical and genetic findings in six Chinese families with diverse modes of inheritance.

Purpose: To investigate pathogenic variants in six families with cone-rod dystrophy (CORD) presenting various inheritance patterns by using whole-exome sequencing (WES) and analyzing phenotypic features. Methods: A total of six families with CORD were enrolled in Ningxia Eye Hospital for this study. The probands and their family members received comprehensive ophthalmic examinations, and DNA was abstracted from patients and family members. Whole-exome sequencing was performed on probands to screen the causative variants, and all suspected pathogenic variants were determined via Sanger sequencing. Furthermore, co-segregation analysis was performed on available family members. The pathogenicity of novel variants was predicted using in silico analysis and evaluated according to the American College of Medical Genetics and Genomics (ACMG) guidelines. Results: Of the six families, two families were assigned as X-linked recessive (XL), two families were assigned as autosomal recessive (AR), and two families were assigned as autosomal dominant (AD). Pathogenic variants were detected in CACNA1F in two X-linked recessive probands, among which family 1 had a hemizygous frameshift variant c.2201del (p.Val734Glyfs*17) and family 2 had a hemizygous missense variant c.245G>A (p.Arg82Gln). Both probands had high myopia, with fundus tessellation accompanied by abnormalities in the outer structure of the macular area. The homozygous splice variant c.2373 + 5G>T in PROM1 and the homozygous nonsense variant c.604C>T (p.Arg202Ter) in ADAM9 were detected in two autosomal recessive families of the probands. Both probands showed different degrees of atrophy in the macular area, and the lesions showed hypofluorescence changes in autofluorescence. The heterozygous variation in CRX c.682C>T (p.Gln228Ter) was detected in two autosomal dominant families. The onset age of the two probands was late, with better vision and severe macular atrophy. According to ACMG guidelines and the analysis of online in silico tools, all variations were labeled as potentially harmful or pathogenic. Conclusion: Pathogenic variants in CACNA1F, PROM1, ADAM9, and CRX genes were identified in six families affected by the diverse inheritance patterns of CORD. Furthermore, the potential impact of the nonsense-mediated decay (NMD) mechanism on the manifestation of CORD phenotypes was examined and addressed. Simultaneously, the spectrum of pathogenic variants and clinical phenotypes associated with the CORD gene was extended.

Exome and genome sequencing to unravel the precise breakpoints of partial trisomy 6q and partial Monosomy 2q.

BACKGROUND: Patients with complex phenotypes and a chromosomal translocation are particularly challenging, since several potentially pathogenic mechanisms need to be investigated. CASE PRESENTATION: Here, we combined exome and genome sequencing techniques to identify the precise breakpoints of heterozygous microduplications in the 6q25.3-q27 region and microdeletions in the 2q37.1-q37.3 region in a proband. The 5-year-old girl exhibited a severe form of congenital cranial dysinnervation disorder (CCDD) in addition to skeletal dysmorphism anomalies and severe intellectual disability. This is the second case affecting chromosomes 2q and 6q. The individual's karyotype showed an unbalanced translocation 46,XX,del(2)t(2;6)(q37.1;q25.3), which was inherited from her unaffected father [46,XY,t(2;6)(q37.1;q25.3)]. We also obtained the precise breakpoints of a de novo heterozygous copy number deletion [del(2)(q37.1q37.3)chr2:g.232963568_24305260del] and a copy number duplication [dup(6)(q25.3q27)chr6:g.158730978_170930050dup]. The parental origin of the observed balanced translocation was not clear because the parents declined genetic testing. CONCLUSION: Patients with a 2q37 deletion and 6q25.3 duplication may exhibit severe significant neurological and skeletal dysmorphisms, and the utilization of exome and genome sequencing techniques has the potential to unveil the entire translocation of the CNV and the precise breakpoint.

Novel mutations of the X-linked genes associated with early-onset high myopia in five Chinese families.

PURPOSE: To report novel pathogenic variants of X-linked genes in five Chinese families with early-onset high myopia (eoHM) by using whole-exome sequencing and analyzing the phenotypic features. METHODS: 5 probands with X-linked recessive related eoHM were collected in Ningxia Eye Hospital from January 2021 to June 2022. The probands and their family members received comprehensive ophthalmic examinations,and DNA was abstracted from patients and family members. Whole-exome sequencing was performed on probands to screen the causative variants, and all suspected pathogenic variants were determined by Sanger sequencing and co-segregation analysis was performed on available family members. The pathogenicity of novel variants was predicted using silico analysis and evaluated according to ACMG guidelines. RT-qPCR was used to detect differences in the relative mRNAs expression of candidate gene in mRNAs available with the proband and family members in the pedigree 2. The relationship between genetic variants and clinical features was analyzed. RESULTS: All probands were male, and all pedigrees conformed to an X-linked recessive inheritance pattern. They were diagnosed with high myopia at their first visits between 4 and 7 years old. Spherical equivalent ranged between - 6.00D and - 11.00D.The five novel hemizygous variants were found in the probands, containing frameshift deletion variant c.797_801del (p.Val266Alafs*75) of OPN1LW gene in the pedigree 1, nonsense variant c.513G > A (p.Trp171Ter)of RP2 gene in the pedigree 2, missense variant c.98G > T (p.Cys33Phe) of GPR143 gene in the pedigree 3, frameshift deletion variant c.1876_1877del (p.Met626Valfs*22) of FRMD7 gene in the pedigree 4 and inframe deletion variant c.670_ 675del (p.Glu192_ Glu193del) of HMGB3 gene in the pedigree 5. All variants were classified as pathogenic or likely pathogenic by the interpretation principles of HGMD sequence variants and ACMG guidelines. In family 2, RT-qPCR showed that the mRNA expression of RP2 gene was lower in the proband than in other normal family members, indicating that such variant caused an effect on gene function at the mRNA expression level. Further clinical examination showed that pedigrees 1, 2, 3, and 4 were diagnosed as X-linked recessive hereditary eye disease with early-onset high myopia, including quiescent cone dysfunction, retinitis pigmentosa, ocular albinism, and idiopathic congenital nystagmus respectively. The pedigree 5 had eoHM in the right eye and ptosis in both eyes. CONCLUSION: In this paper,we are the first to report five novel hemizygous variants in OPN1LW, RP2, GPR143, FRMD7, HMGB3 genes are associated with eoHM. Our study extends the genotypic spectrums for eoHM and better assists ophthalmologists in assessing, diagnosing, and conducting genetic screening for eoHM.

De novo variation in EP300 gene cause Rubinstein-Taybi syndrome 2 in a Chinese family with severe early-onset high myopia.

BACKGROUND: Rubinstein-Taybi syndrome (RSTS) is characterized by distinctive facial features, broad and often angulated thumbs and halluces, short stature, and moderate-to-severe intellectual disability, classified into two types RSTS1 (CREBBP-RSTS) and RSTS2 (EP300-RSTS). More often, the clinical features are inconclusive and the diagnosis of RSTS is established in a proband with identification of a heterozygous pathogenic variant in CREBBP or EP300 to confirm the diagnosis. METHODS: In this study, to describe an association between the clinical phenotype and the genotype of a RSTS2 patient who was initially diagnosed with severe early-onset high myopia (eoHM) from a healthy Chinese family, we tested the proband of this family by whole exome sequencing (WES) and further verified among other family members by Sanger sequencing. Real-time quantitative PCR was used to detect differences in the relative mRNA expression of candidate genes available in the proband and family members. Comprehensive ophthalmic tests as well as other systemic examinations were also performed on participants with various genotypes. RESULTS: Whole-exome sequencing revealed that the proband carried the heterozygous frameshift deletion variant c.3714_3715del (p.Leu1239Glyfs*3) in the EP300 gene, which was not carried by the normal parents and young sister as verified by Sanger sequencing, indicating that the variant was de novo. Real-time quantitative PCR showed that the mRNA expression of EP300 gene was lower in the proband than in other normal family members, indicating that such a variant caused an effect on gene function at the mRNA expression level. The variant was classified as pathogenic as assessed by the interpretation principles of HGMD sequence variants and ACMG guidelines. According to ACMG guidelines, the heterozygous frameshift deletion variant c.3714_3715del (p.Leu1239Glyfs*3) in the EP300 gene was more likely the pathogenic variant of this family with RSTS2. CONCLUSIONS: Therefore, in this paper, we first report de novo heterozygous variation in EP300 causing eoHM-RSTS. Our study extends the genotypic spectrums for EP300-RSTS and better assists physicians in predicting, diagnosis, genetic counseling, eugenics guidance and gene therapy for EP300-RSTS.

Two novel variations in LRP2 cause Donnai-Barrow syndrome in a Chinese family with severe early-onset high myopia.

Donnai-Barrow syndrome (DBS) is a rare autosomal recessive disorder caused by mutation in the low density lipoprotein receptor-related protein 2 gene (LRP2). Defects in this protein may lead to clinical multiple organ malformations by affecting the development of organs such as the nervous system, eyes, ears, and kidneys. Although some variations on LRP2 have been found to be associated with DBS, early diagnosis and prevention of patients with atypical DBS remains a challenge for many physicians because of their clinical heterogeneity. The objective of this study is to explore the association between the clinical presentation and the genotype of a DBS patient who was initially diagnosed with early-onset high myopia (eoHM) from a healthy Chinese family. To this end, we tested the patient of this family via whole exome sequencing and further verified the results among other family members by Sanger sequencing. Comprehensive ophthalmic tests as well as other systemic examinations were also performed on participants with various genotypes. Genetic assessment revealed that two novel variations in LRP2, a de novo missense variation (c.9032G>A; p.Arg3011Lys) and a novel splicing variation (c.2909-2A>T) inherited from the father, were both carried by the proband in this family, and they are strongly associated with the typical clinical features of DBS patients. Therefore, in this paper we are the first to report two novel compound heterozygous variations in LPR2 causing DBS. Our study extends the genotypic spectrums for LPR2-DBS and better assists physicians in predicting, diagnosing, and conducting gene therapy for DBS.

Absence of CEP78 causes photoreceptor and sperm flagella impairments in mice and a human individual.

Cone-rod dystrophy (CRD) is a genetically inherited retinal disease that can be associated with male infertility, while the specific genetic mechanisms are not well known. Here, we report CEP78 as a causative gene of a particular syndrome including CRD and male infertility with multiple morphological abnormalities of sperm flagella (MMAF) both in human and mouse. Cep78 knockout mice exhibited impaired function and morphology of photoreceptors, typified by reduced ERG amplitudes, disrupted translocation of cone arrestin, attenuated and disorganized photoreceptor outer segments (OS) disks and widen OS bases, as well as interrupted connecting cilia elongation and abnormal structures. Cep78 deletion also caused male infertility and MMAF, with disordered '9+2' structure and triplet microtubules in sperm flagella. Intraflagellar transport (IFT) proteins IFT20 and TTC21A are identified as interacting proteins of CEP78. Furthermore, CEP78 regulated the interaction, stability, and centriolar localization of its interacting protein. Insufficiency of CEP78 or its interacting protein causes abnormal centriole elongation and cilia shortening. Absence of CEP78 protein in human caused similar phenotypes in vision and MMAF as Cep78-/- mice. Collectively, our study supports the important roles of CEP78 defects in centriole and ciliary dysfunctions and molecular pathogenesis of such multi-system syndrome.

BEST1 novel mutation causes Bestrophinopathies in six families with distinct phenotypic diversity.

PURPOSE: To report novel BEST1 variants in six Chinese families with bestrophinopathies of two different inheritance modes and analyze the intrafamilial phenotypic diversity. METHOD: A total of 25 participants including 13 patients and 12 healthy family members from 6 Chinese families with bestrophinopathies were available for genetic and clinical analysis. All of the patients were subjected to comprehensive ophthalmic evaluations and exome sequencing was performed on the probands to detect the causative variants. The pathogenicity of gene variants was predicted using silico analysis and evaluated according to ACMG guidelines. All (likely) pathogenic variants were determined by Sanger sequencing and co-segregation analyses were performed on available family members. The relevant original literature previously reported was retrieved to explore the relationship between BEST1-related gene variants and clinical features. RESULTS: In the 6 families, 3 families (10 patients) were assigned as autosomal dominant bestrophinopathies (VMD) and 3 families (3 patients) were assigned as Autosomal recessive Bestrophinopathies (ARB). A total of 9 variants on the BEST1 gene were identified, containing 7 missense variants, 1 nonsense variant, and 1 frameshift variant, respectively, of which 3 variants c.88A > G (p.Lys30Glu), c.764G > A (p.Arg255Gln) and c.233dupT (p.Ser79Phefs*153) were novel variants. Three families with ARB were detected with heterozygous variants on the BEST1 gene.2 families (8 patients) with BVMD showed markedly irregular dominant inheritance, and the severity of macular lesions varies greatly among individuals of the same family. Among them, the probands showed typical vitelliform lesions in the macula, while the other six patients had no visible signs of the disease by fundus photography (ophthalmoscopy) and minor lesions could be detected on OCT in two patients, the continuity of the ellipsoidal band was interrupted with the chimeric band. The phenotypes of the patients in the three ARB families ranged from typical/atypical vitelliform lesions to extensive extramacular deposits (peripheral spots). CONCLUSION: This study provided evidence that the phenotype of BVMD manifested irregular dominant inheritance, with patients carrying a pathogenic heterozygous variant of BEST1 to develop obvious intrafamilial phenotypic diversity, and the patients who harbor two pathogenic alleles showed recessive inheritance bestrophinopathies with distinct phenotypic diversity. Our study also emphasized the importance of comprehensive genetic analysis in patients with bestrophinopathies, and in such challenging families with distinct intrafamilial phenotypic diversity, it shall provide novel insights into phenotypic assessments of bestrophinopathies, and contribute to better diagnosis, prognosis, and treatment for these patients.

Xp21 DNA microdeletion syndrome in a Chinese family: clinical features show retinitis pigmentosa and chronic granuloma.

Xp21 DNA microdeletion syndrome is a very rare disease characterized by retinitis pigmentosa (RP), chronic granulomatous disease (CGD), and McLeod syndrome (MLS). Due to the complex and diverse clinical manifestations, early diagnosis remains a challenge for many physicians. In this study, for the purpose of determining the pathogenic gene variants and definitive diagnosis in a patient medically backgrounded with RP and CGD from a normal Chinese family, whole-exome sequencing (WES) was performed in this proband and copy number variation (CNV) was further verified in other family members by qPCR. A genetic evaluation revealed that the short arm of the X chromosome in the proband had a deletion CNV Xp21.1p11.4 (37431123-38186681) of approximately 0.755 Mb in size, and contained three contiguous OMIM genes as X-linked Kx blood group antigen (XK), cytochrome b-245 beta chain (CYBB), and RP GTPase regulator (RPGR). The qPCR results confirmed the copy number loss in Xp21.1p11.4 present in the proband and his unaffected mother. According to the American College of Medical Genetics and Genomics (ACMG) guidelines for the CNV interpretation, the deletion of this segment was a pathogenic variant. Our results provided evidence that CNV deletion of Xp21.1p11.4 in the short arm of the X chromosome was a pathogenic variant in such Chinese RP and CGD family, and the McLeod phenotype was not yet available. This study suggests that genetic testing is essential for a definitive diagnosis, which should better assist physicians in prediction, diagnosis, genetic counseling, and guidance for Xp21 DNA microdeletion syndrome.

Novel Compound Heterozygous Variations in MPDZ Gene Caused Isolated Bilateral Macular Coloboma in a Chinese Family.

Macular coloboma (MC) is a rare congenital retinochoroidal defect characterized by lesions of different sizes in the macular region. The pathological mechanism underlying congenital MC is unknown. Novel compound heterozygous variations, c.4301delA (p.Asp1434fs*3) and c.5255C>G (p.Ser1752Ter), in the multiple PDZ domain (MPDZ) proteins were identified via whole-exome analysis on the proband with isolated bilateral macular coloboma in a Chinese family. Segregation analysis revealed that each of the unaffected parents was heterozygous for one of the two variants. The results of the in silico and bioinformatics analysis were aligned with the experimental data. The knockdown of MPDZ in zebrafish caused a decrease in the ellipsoid zone, a destruction of the outer limiting membrane, and the subsequent RPE degeneration. Overall, the loss of MPDZ in zebrafish contributed to retinal development failure. These results indicate that MPDZ plays an essential role in the occurrence and maintenance of the macula, and the novel compound heterozygous variations were responsible for an autosomal recessive macular deficiency in this Chinese family.

Identification of genetic variants in five chinese families with keratoconus: Pathogenicity analysis and characteristics of parental corneal topography.

Purpose: The study aims to identify genetic variants in five Chinese families with Keratoconus (KC) and describe the characteristics of parental corneal topography. Methods: Fifteen participants, including five probands and ten parents from five Chinese families with KC, were recruited for genetic and clinical analyses. Targeted next-generation sequencing using a custom-designed panel for KC was applied on the probands for variant identification. Sanger sequencing and cosegregation analysis of the suspected pathogenic variants were performed on the family members. The pathogenicities of variants were evaluated according to the American College of Medical Genetics and Genomics guidelines (ACMG). Pentacam 3D anterior segment analysis system was applied for keratectasia detection and the Corvis ST for corneal biomechanics measurement. Fifteen parameters were recorded, including nine keratectasia indicators (BAD-D, TP, Kmax, Df, Db, Dp, Dt, Da, ARTH), six corneal biomechanical indicators (CBI, DA ratio, SP-A1, IR, bIOP, TBI). Results: A total of six novel variants, including five missense variants and one frameshift variant, were detected in the HMX1, SLC4A11, TGFBI, PIKFYVE, and ZEB1 genes in five probands, all of which showed co-segregation of genotype and clinical phenotype and were determined to be pathogenic. The genetic model was autosomal dominant (AD) in four families and autosomal recessive (AR) in 1 family. The analysis of keratectasia and corneal biomechanical indicators of the proband's parents (first-generation relatives) in AD families revealed that there were several abnormal indexes in BAD-D, TP, Kmax, Df, Db, Dp, Dt, Da, CBI, DA ratio, SP-A1, IR, bIOP and TBI test indexes, showing clinical characteristics of incipient KC. Conclusion: Our study shows that variants in HMX1, SLC4A11, TGFBI, PIKFYVE, and ZEB1 were associated with KC. Our study extends the gene spectrum associated with KC, provides novel insights into KC phenotypic assessments, and contributes to early diagnosis for these patients.

New pathogenic variants of ALMS1 gene in two Chinese families with Alström Syndrome.

PURPOSE: Alström Syndrome (AS) is an autosomal recessive hereditary disease with the characteristics of multiorgan dysfunction. Due to the heterogeneity of clinical manifestations of AS, genetic testing is crucial for the diagnosis of AS. Herein, we used whole-exome sequencing (WES) to determine the genetic causes and characterize the clinical features of three affected patients in two Chinese families with Alström Syndrome. MATERIALS AND METHODS: Three affected patients (initially diagnosed as achromatopsia). and five asymptomatic members were recruited for both genetic and clinical tests. The complete ophthalmic examinations and systemic examinations were performed on all participants. Whole exome sequencing (WES) was performed for mutation detection. The silico analysis was also applied to predict the pathogenesis of identified pathogenic variants. RESULTS: In family 1, the proband showed low vision, hyperopia, photophobia, nystagmus, and total color blindness. DNA analysis revealed that she carried a compound heterozygote with two novel pathogenic variants in the ALMS1 gene NM_015120.4:c.10379del (NP_055935.4:p.(Asp2252Tyr)) and NM_015120.4:c.11641_11642del (NP_055935.4:p.(Val3881ThrfsTer11)). Further systemic examinations showed short stature, acanthosis nigricans, and sensorineural hearing loss. In family 2, two affected siblings presented the low vision, hyperopia, photophobia, nystagmus, and total color blindness. DNA analysis revealed that they carried a same compound heterozygote with two novel pathogenic variants in the ALMS1 gene NM_015120.4:c.10379del (NP_055935.4:p.(Asn3460IlefsTer49)), NM_015120.4:c.10819C > T (NP_055935.4:p.(Arg3607Trp)). Further systemic examinations showed obesity and mild abnormalities of lipid metabolism. According to the genetic testing results and further systemic analysis, the three affected patients were finally diagnosed as Alström Syndrome (AS). CONCLUSIONS: We found two new compound heterozygous pathogenic variants of the ALMS1 gene and determined the diagnosis as Alström Syndrome in three patients of two Chinese families. Our study extends the genotypic and phenotypic spectrums for ALMS1 -AS and emphasizes the importance of gene testing in assisting the clinical diagnosis for cases with phenotypic diversities, which would help the AS patients with early diagnosis and treatment to reduce future systemic damage.

Evaluating the association between MPDZ-NF1B rs1324183 and keratoconus in an independent northwestern Chinese population.

BACKGROUND: Keratoconus (KC) is a complex, non-inflammatory corneal degenerative disease. Although numerous studies have analyzed the correlation of SNP rs1324183, which located in MPDZ-NF1B gene, and KC in different populations, only few findings were repeated. In this study, to evaluate the association between rs1324183 and KC in a new independent Chinese population, we performed a replication study of the significantly associated rs1324183. METHODS: In total of 114 unrelated KC patients and 88 unrelated controls were recruited from Ningxia, China. We detected the genotypes and alleles of rs1324183 using PCR technology and Sanger sequencing and also analyzed the association between this locus and KC, its clinical parameters by statistical methods. RESULTS: The frequency of genotype AA (11, 9.6%) and genotypes containing allele A (47, 41.2%) of rs1324183 in KC were both higher than those of the control group. And genotype AA of rs1324183 conferred a higher risk of KC (OR > 1). Moreover, corneal parameter Belin/Ambrósio enhanced ectasia display final D value (BAD-D) had significant correlation (p = 0.002) with AA genotype of rs1324183 in KC. CONCLUSIONS: Our replication study indicates that the results of rs1324183 associated with KC in our population is robust and further better illustrates the significance of BAD-D as a diagnostic indicator for KC. rs1324183 should be considered as the first genetic mark of KC risk in its future diagnosis.

Contemporary Update of Retinoblastoma in China: Three-Decade Changes in Epidemiology, Clinical Features, Treatments, and Outcomes.

PURPOSE: To report three-decade changes of clinical characteristics, progress of treatments, and risk factors associated with mortality and enucleation in patients with retinoblastoma in China. DESIGN: Retrospective cohort study. METHODS: This multicenter study included 2552 patients diagnosed with retinoblastoma in 38 medical centers in 31 provinces in China from 1989 to 2017, with follow-up data. Kendall's tau-b value was used to describe correlation coefficients between the three eras (between 1989 and 2008, between 2009 and 2013, and between 2014 and 2017) and clinical or demographic features. Hazard ratios and odds ratios were applied to measure risk factors. RESULTS: A total of 324 (13%) patients died and 1414 (42%) eyes were removed. The 1-year, 3-year, and 5-year overall survival rates were 95%, 86%, and 83%, respectively. Patients were diagnosed at a better stage by International Classification for Retinoblastoma over time (Kendall's tau-b value = -0.084, P < .001). Pathological risk factors were also observed less in recent eras. New conservative therapies were adopted and used in more patients. The eye removal rate gradually decreased (Kendall's tau-b value = -0.167, P < .001). The overall survival rates were 81%, 83%, and 91% in the three eras. By multivariate Cox regression, bilateral tumors and extraocular extension were identified as risk factors for death. Among intraocular disease, Group E indicated higher risk of mortality. By multivariate logistics regression, unilateral tumors, earlier era of diagnosis, and extraocular extension were risk factors for eye salvage failure. Among intraocular retinoblastoma, Groups D and E had higher risk of eye salvage failure. CONCLUSIONS: Patients were diagnosed at an earlier stage in recent eras. Conservative therapies, including intra-arterial chemotherapy, were increasingly being used. The above changes may contribute to the decreasing enucleation rate. Although no significant impact was identified on the mortality by the three eras, a decreasing trend was shown.

Eye-Preserving Therapies for Advanced Retinoblastoma: A Multicenter Cohort of 1678 Patients in China.

PURPOSE: This study attempted to estimate the impact of eye-preserving therapies for the long-term prognosis of patients with advanced retinoblastoma with regard to overall survival and ocular salvage. DESIGN: Retrospective cohort study covering all 31 provinces (38 retinoblastoma treating centers) of mainland China. PARTICIPANTS: One thousand six hundred seventy-eight patients diagnosed with group D or E retinoblastoma from January 2006 through May 2016. METHODS: Chart review was performed. The patients were divided into primary enucleation and eye-preserving groups, and they were followed up for survival status. The impact of initial treatment on survival was evaluated by Cox analyses. MAIN OUTCOME MEASURES: Overall survival and final eye preservation. RESULTS: After a median follow-up of 43.9 months, 196 patients (12%) died, and the 5-year overall survival was 86%. In total, the eyeball preservation rate was 48%. In this cohort, 1172 patients (70%) had unilateral retinoblastoma, whereas 506 patients (30%) had bilateral disease. For patients with unilateral disease, 570 eyes (49%) underwent primary enucleation, and 602 patients (51%) received eye-preserving therapies initially. During the follow-up (median, 45.6 months), 59 patients (10%) from the primary enucleation group and 56 patients (9.3%) from the eye-preserving group died. Multivariate Cox analyses indicated no significant difference in overall survival between the 2 groups (hazard ratio [HR], 1.25; 95% confidence interval [CI], 0.85-1.84; P = 0.250). For patients with bilateral disease, 95 eyes (19%) underwent primary enucleation, and 411 patients (81%) received eye-preserving therapies initially. During the follow-up (median, 40.1 months), 12 patients (13%) from the primary enucleation group and 69 patients (17%) from the eye-preserving group died. For bilateral retinoblastoma with the worse eye classified as group E, patients undergoing primary enucleation exhibited better overall survival (HR, 2.35; 95% CI, 1.10-5.01; P = 0.027); however, this survival advantage was not evident until passing 22.6 months after initial diagnosis. CONCLUSIONS: Eye-preserving therapies have been used widely for advanced retinoblastoma in China. Patients with bilateral disease whose worse eye was classified as group E and who initially underwent eye-preserving therapies exhibited a worse overall survival. The choice of primary treatment for advanced retinoblastoma should be weighed carefully.

A novel stop codon mutation of TSPAN12 gene in Chinese patients with familial exudative vitreoretinopathy.

BACKGROUND: Familial exudative vitreoretinopathy (FEVR) is a group of inherited eye diseases characterized by premature arrest of retinal vessel development. The purpose of our study was to characterize the genetic causes and clinical features in eight Chinese families with FEVR using next-generation sequencing (NGS) technology. MATERIALS AND METHODS: Eight families with FEVR were included in genetic and clinical analyses. We screened the proband and the parents in eight pedigrees with FEVR using targeted NGS approach and in silico analysis to determine the causative mutation for their family's phenotype. RESULTS: Four cases (4/8, 50.0%) were confirmed to harbor mutations in known genes, including 3 novel mutations and one previously reported mutation. Among the detected mutations, TSPAN12 accounted for 75% (3/4). We identified a novel stop codon of TSPAN12, a heterozygous missense mutation NM_012338.4:c.633T>A, NP_036470.1:p.Tyr211Ter involved in highly conserved residues in the proband. Retrospective analysis of its clinical manifestation showed that the mutant carrier presented mild clinical features. CONCLUSIONS: We found the novel stop codon mutation p.Tyr211Ter in the TSPAN12, which creates a milder phenotype. Discovery of this novel mutation expands the mutation spectrum of TSPAN12, and would be valuable for future genetic disease diagnosis.

Identification of a novel FOXL2 mutation in a fourth-generation Chinese family with blepharophimosis-ptosis-epicanthus inversus syndrome.

AIM: To characterize the genetic causes and clinical features in a four-generation Chinese family with blepharophimosis-ptosis-epicanthus inversus syndrome (BPES). METHODS: Thirteen patients with BPES and eight healthy family members were included in this study. All participants received routine ophthalmic examinations. The target next-generation sequencing (NGS) was performed to determine the causative mutation for this family. The silico analysis was also applied to predict the pathogenesis of identified mutations. RESULTS: All patients had severe ptosis, normal intelligence, female patients have normal fertility. Genetic assessments revealed a heterozygous insertion variation in FOXL2 gene, c.672_701insGCGGCTGCCGC CGCAGCTGCTG CAGGCGCT (p.Ala234_Gly235linsAAAAAAAAGA), carried by 13 patient but absent in all unaffected members. In silico analysis supported the pathogenic nature of this highly conserved variant. This mutation resulted in the insertion of 10 amino acids into the encoded polyala nine chain, which increased the number of original polyalanine chains from 14 to 24, resulting in an extended protein. CONCLUSION: A novel FOXL2 mutation c.672_701ins GCGGCTGCCGCCGCAGCTGCTGC AGGCGCT (p.Ala234_Gly235linsAAAAAAAAGA) was identified in a large Chinese family with BPES. This study amplified the genotypic spectrum of FOXL2-BPES and better illustrates its genotype-phenotype correlations, which provided a basis for elucidating the pathogenesis of BPES and genetic counseling.

Identification of Four Novel Variants and Determination of Genotype-Phenotype Correlations for ABCA4 Variants Associated With Inherited Retinal Degenerations.

PURPOSE: The purpose of the study is to describe the genetic and clinical features of 17 patients with ABCA4-related inherited retinal degenerations (IRDs) and define the phenotype-genotype correlations. METHODS: In this multicenter retrospective study, 17 patients from 16 families were enrolled, and ABCA4 gene variants were detected using targeted next-generation sequencing using a custom designed panel for IRDs. Sanger sequencing and co-segregation analysis of the suspected pathogenic variants were performed with the family members. The pathogenicities of variants were evaluated according to the American College of Medical Genetics and Genomics guidelines (ACMG). Protein structure modifications mediated by the variants were studied using bioinformatic analyses. RESULTS: The probands were diagnosed with Stargardt disease 1 (7), cone-rod dystrophy type 3 (8), cone dystrophy (1), and retinitis pigmentosa 19 (1). Onset of symptoms occurred between 5 and 27 years of age (median age = 12.4 years). A total of 30 unique ABCA4 suspicious pathogenic variations were observed, including 18 missense mutations, seven frameshift mutations, two nonsense mutations, one canonical splice site mutation, one small in-frame deletion, and one insertion. Four novel ABCA4 variants were identified. Two novel frameshift variants, c.1290dupC (p.W431fs), and c.2967dupT (G990fs), were determined to be pathogenic. A novel missense variant c.G5761T (p.V1921L) was likely pathogenic, and another novel missense c.C170G (p.P57R) variant was of undetermined significance. All ABCA4 variants tested in this study inordinately changed the physico-chemical parameters and structure of protein based on in silico analysis. CONCLUSION: ABCA4-related IRD is genetically and clinically highly heterogeneous. Four novel ABCA4 variants were identified. This study will expand the spectrum of disease-causing variants in ABCA4, which will further facilitate genetic counseling.

Two novel PDE6C gene mutations in Chinese family with achromatopsia.

Background: Achromatopsia (ACHM) is an inherited retinal disease affecting the cone cell function. To date, six pathogenic genes of ACHM have been identified. However, the diagnostic and therapeutic methods of this disorder remain limited. Herein, to characterize the clinical features and genetic causes of three affected siblings in a Chinese family with ACHM, we used target next-generation sequencing (NGS) and found new pathogenic factors associated with ACHM in this family. Materials and methods: Three patients with ACHM and three healthy family members were included in this study. All participants received comprehensive ophthalmic tests. NGS approach was performed on the patients to determine the causative mutation for this family. The silico analysis was also applied to predict the pathogenesis of identified mutations. Results: Genetic assessments revealed compound heterozygous mutations of the PDE6C gene (c.1413 + 1 G > C, c.305 G > A), carried by all three patients. Both mutations were novel and predicted to be deleterious by six types of online predictive software. The heterozygous PDE6C missense mutation (c.305 G > A) was found from the mother and the heterozygous PDE6C splice site mutation (c.1413 + 1 G > C) was found in the father and all the children. All patients in the family showed typical signs and symptoms of ACHM. Conclusions: We report novel compound heterozygous PDE6C mutations in causing ACHM and further confirm the clinical diagnosis. Our study extends the genotypic spectrums for PDE6C-ACHM and better illustrates its genotype-phenotype correlations, which would help the ACHM patients with better genetic diagnosis, prognosis, and gene treatment.

Myopia with X-linked retinitis pigmentosa results from a novel gross deletion of RPGR gene.

AIM: To identify mutations with whole exome sequencing (WES) in a Chinese X-linked retinitis pigmentosa (XLRP) family. METHODS: Patients received the comprehensive ophthalmic evaluation. Genomic DNA was extracted from peripheral blood and subjected to SureSelect Human All Exon 6+ UTR exon capture kit. The exons were sequenced as 100 base paired reads on Illumina HiSeq2500 system. Only mutations that resulted in a change in amino acid sequence were selected. A pattern of inheritance of the RP family was aligned to identified causal mutation. RESULTS: We analysed the data of WES information from XLRP family. The analysis revealed a hemizygous large genomic deletion of RPGR c.29_113del was responsible for this XLRP. The gross deletion lead to a frame-shift mutation and generate stop codon at 7 animo acid behind Asp (D10Afs*7), which would serious truncate RPGR protein. The novel frame-shift mutation was found to segregate with retinitis pigmentosa (RP) phenotype in this family. Bilateral myopia was present on the male patients, but carrier female showed unilateral myopia without RP. CONCLUSION: Our study identifies a novel frame-shift mutation of RPGR in a Chinese family, which would expand the spectrum of RPGR mutations. The geno-phenotypic analysis reveals a correlation between RP and myopia. Although exact mechanism of RP related myopia is still unknown, but the novel frame-shift mutation will give our hit on studying the molecular pathogenesis of RP and myopia.