Activation of PPARδ in bone marrow endothelial progenitor cells improves their hematopoiesis-supporting ability after myelosuppressive injury.

Dysfunctional bone marrow (BM) endothelial progenitor cells (EPCs) with high levels of reactive oxygen species (ROS) are responsible for defective hematopoiesis in poor graft function (PGF) patients with acute leukemia or myelodysplastic neoplasms post-allotransplant. However, the underlying mechanism by which BM EPCs regulate their intracellular ROS levels and the capacity to support hematopoiesis have not been well clarified. Herein, we demonstrated decreased levels of peroxisome proliferator-activated receptor delta (PPARδ), a lipid-activated nuclear receptor, in BM EPCs of PGF patients compared with those with good graft function (GGF). In vitro assays further identified that PPARδ knockdown contributed to reduced and dysfunctional BM EPCs, characterized by the impaired ability to support hematopoiesis, which were restored by PPARδ overexpression. Moreover, GW501516, an agonist of PPARδ, repaired the damaged BM EPCs triggered by 5-fluorouracil (5FU) in vitro and in vivo. Clinically, activation of PPARδ by GW501516 benefited the damaged BM EPCs from PGF patients or acute leukemia patients in complete remission (CR) post-chemotherapy. Mechanistically, we found that increased expression of NADPH oxidases (NOXs), the main ROS-generating enzymes, may lead to elevated ROS level in BM EPCs, and insufficient PPARδ may trigger BM EPC damage via ROS/p53 pathway. Collectively, we found that defective PPARδ contributes to BM EPC dysfunction, whereas activation of PPARδ in BM EPCs improves their hematopoiesis-supporting ability after myelosuppressive therapy, which may provide a potential therapeutic target not only for patients with leukemia but also for those with other cancers.

RNAi efficiency is enhanced through knockdown of double-stranded RNA-degrading enzymes in butterfly Papilio xuthus.

The efficiency of RNA interference (RNAi) has always limited the research on the phenotype innovation of Lepidoptera insects. Previous studies have found that double-stranded RNA-degrading enzyme (dsRNase) is an important factor in RNAi efficiency, but there have been no relevant reports in butterflies (Papilionoidea). Papilio xuthus is one of the important models in butterflies with an extensive experimental application value. To explore the effect of dsRNase in the RNAi efficiency on butterflies, six dsRNase genes (PxdsRNase 1-6) were identified in P. xuthus genome, and their dsRNA-degrading activities were subsequently detected by ex vivo assays. The result shows that the dsRNA-degrading ability of gut content (<1 h) was higher than hemolymph content (>12 h). We then investigated the expression patterns of these PxdsRNase genes during different tissues and developmental stages, and related RNAi experiments were carried out. Our results show that different PxdsRNase genes had different expression levels at different developmental stages and tissues. The expression of PxdsRNase2, PxdsRNase3, and PxdsRNase6 were upregulated significantly through dsGFP injection, and PxdsRNase genes can be silenced effectively by injecting their corresponding dsRNA. RNAi-of-RNAi studies with PxEbony, which acts as a reporter gene, observed that silencing PxdsRNase genes can increase RNAi efficiency significantly. These results confirm that silencing dsRNase genes can improve RNAi efficiency in P. xuthus significantly, providing a reference for the functional study of insects such as butterflies with low RNAi efficiency.

Profound hypoxemia and hypotension during posterior spinal fusion in a spinal muscular atrophy child with severe scoliosis: a case report.

BACKGROUND: Anesthesia for spinal muscular atrophy (SMA) patients undergoing spinal deformity surgery is challenging. We report an unusual case of an SMA girl who developed severe intraoperative hypoxemia and hypotension during posterior spinal fusion related with surgical positioning. CASE PRESENTATION: A 13-yr-old girl diagnosed with SMA type 2, severe kyphoscoliosis and thoracic deformity was scheduled for elective posterior spinal fusion. She developed severe hypoxemia and profound hypotension intraoperatively in the prone position with surgical table tilted 45° to the right. Though transesophageal echocardiography (TEE) could not be performed due to limited mouth opening, her preoperative computed tomography revealed a severely distorted thoracic cavity with much reduced volume of the right side. A reasonable explanation was when the surgeons performed surgical procedure with the tilted surgical table, the pressure was directly put on the shortest diameter of the significantly deformed thoracic cavity, causing severe compression of the pulmonary artery, resulting in both hypoxemia and hypotension. The patient stabilized when the surgical table was tilted back and successfully went through the surgery in the leveled prone position. CONCLUSIONS: Spinal fusion surgery is beneficial for SMA patients in preventing scoliosis progression and improving ventilation. However, severe scoliosis and thoracic deformities put them at risk of both hemodynamic and respiratory instability during surgical positioning. When advanced monitoring like TEE is not practical intraoperatively, preoperative imaging may help with differential diagnosis, and guide the surgical positioning to minimize mechanical compression of the thoracic cavity, thereby helping the patient complete the surgery safely.

Predictive Ability of Hypertriglyceridemic Waist, Hypertriglyceridemic Waist-to-Height Ratio, and Waist-to-Hip Ratio for Cardiometabolic Risk Factors Clustering Screening among Chinese Children and Adolescents.

Objective: Hypertriglyceridemic waist (HW), hypertriglyceridemic waist-to-height ratio (HWHtR), and waist-to-hip ratio (WHR) have been shown to be indicators of cardiometabolic risk factors. However, it is not clear which indicator is more suitable for children and adolescents. We aimed to investigate the relationship between HW, HWHtR, WHR, and cardiovascular risk factors clustering to determine the best screening tools for cardiometabolic risk in children and adolescents. Methods: This was a national cross-sectional study. Anthropometric and biochemical variables were assessed in approximately 70,000 participants aged 6-18 years from seven provinces in China. Demographics, physical activity, dietary intake, and family history of chronic diseases were obtained through questionnaires. ANOVA, χ 2 and logistic regression analysis was conducted. Results: A significant sex difference was observed for HWHtR and WHR, but not for HW phenotype. The risk of cardiometabolic health risk factor clustering with HW phenotype or the HWHtR phenotype was significantly higher than that with the non-HW or non-HWHtR phenotypes among children and adolescents (HW: OR = 12.22, 95% CI: 9.54-15.67; HWHtR: OR = 9.70, 95% CI: 6.93-13.58). Compared with the HW and HWHtR phenotypes, the association between risk of cardiometabolic health risk factors (CHRF) clustering and high WHR was much weaker and not significant (WHR: OR = 1.14, 95% CI: 0.97-1.34). Conclusion: Compared with HWHtR and WHR, the HW phenotype is a more convenient indicator withhigher applicability to screen children and adolescents for cardiovascular risk factors.

Ganoderic acids alleviate atherosclerosis by inhibiting macrophage M1 polarization via TLR4/MyD88/NF-κB signaling pathway.

BACKGROUND AND AIMS: Atherosclerosis (AS) is a chronic inflammatory disease characterized by lipid infiltration and plaque formation in blood vessel walls. Ganoderic acids (GA), a class of major bioactive compounds isolated from the Chinese traditional medicine Ganoderma lucidum, have multiple pharmacological activities. This study aimed to determine the anti-atherosclerotic effect of GA and reveal the pharmacological mechanism. METHODS: ApoE-/- mice were fed a high-cholesterol diet and treated with GA for 16 weeks to induce AS and identify the effect of GA. Network pharmacological analysis was performed to predict the anti-atherosclerotic mechanisms. An invitro cell model was used to explore the effect of GA on macrophage polarization and the possible mechanism involved in bone marrow dereived macrophages (BMDMs) and RAW264.7 cells stimulated with lipopolysaccharide or oxidized low-density lipoprotein. RESULTS: It was found that GA at 5 and 25 mg/kg/d significantly inhibited the development of AS and increased plaque stability, as evidenced by decreased plaque in the aorta, reduced necrotic core size and increased collagen/lipid ratio in lesions. GA reduced the proportion of M1 macrophages in plaques, but had no effect on M2 macrophages. In vitro experiments showed that GA (1, 5, 25 µg/mL) significantly decreased the proportion of CD86+ macrophages and the mRNA levels of IL-6, IL-1ß, and MCP-1 in macrophages. Experimental results showed that GA inhibited M1 macrophage polarization by regulating TLR4/MyD88/NF-κB signaling pathway. CONCLUSIONS: This study demonstrated that GA play an important role in plaque stability and macrophage polarization. GA exert the anti-atherosclerotic effect partly by regulating TLR4/MyD88/NF-κB signaling pathways to inhibit M1 polarization of macrophages. Our study provides theoretical basis and experimental data for the pharmacological activity and mechanisms of GA against AS.

Mechanisms of Stem Cells and Their Secreted Exosomes in the Treatment of Autoimmune Diseases.

Stem cells play a therapeutic role in many diseases by virtue of their strong self-renewal and differentiation abilities, especially in the treatment of autoimmune diseases. At present, the mechanism of the stem cell treatment of autoimmune diseases mainly relies on their immune regulation ability, regulating the number and function of auxiliary cells, anti-inflammatory factors and proinflammatory factors in patients to reduce inflammation. On the other hand, the stem cell- derived secretory body has weak immunogenicity and low molecular weight, can target the site of injury, and can extend the length of its active time in the patient after combining it with the composite material. Therefore, the role of secretory bodies in the stem cell treatment of autoimmune diseases is increasingly important.

Cellular and molecular mechanisms of highly active mesenchymal stem cells in the treatment of senescence of rhesus monkey ovary.

BACKGROUND: Recent studies have shown that umbilical cord mesenchymal stem cells have an anti-aging effect in ovaries, but the cellular and molecular mechanisms of HA-MSC ovarian anti-aging remain to be studied. Therefore, we conducted a 10X Genomics single-nucleus transcriptome sequencing experiment on the ovaries of macaque monkeys after HA-MSC treatment. METHODS: The results of cell subgroup classification were visualized by 10X Genomics single nuclear transcriptome sequencing. The aging model of hGCs was established, and the migration ability of the cells was determined after coculture of HA-MSCs and aging hGCs. The genes screened by single nuclear transcriptional sequencing were verified in vitro by qPCR. RESULTS: Compared with the aging model group, the number of cell receptor pairs in each subgroup of the HA-MSC-treated group increased overall. Treatment with 200 µmol/L H2O2 for 48 h was used as the optimum condition for the induction of hGC senescence. After coculture of noncontact HA-MSCs with senescent hGCs, it was found that HA-MSCs can reverse the cell structure, proliferation ability, senescence condition, expression level of senescence-related genes, and expression level of key genes regulating the senescence pathway in normal hGCs. CONCLUSIONS: HA-MSC therapy can improve the tissue structure and secretion function of the ovary through multiple cellular and molecular mechanisms to resist ovarian aging. In vitro validation experiments further supported the results of single-cell sequencing, which provides evidence supporting a new option for stem cell treatment of ovarian senescence.

Structural characterization and anti-oxidative activity for a glycopeptide from Ganoderma lucidum fruiting body.

A water-soluble glycopeptide (named GL-PWQ3) with a molecular weight (Mw) of 2.40 × 104 g/mol was isolated from Ganoderma lucidum fruiting body by hot water extraction, membrane ultrafiltration, and gel column chromatography, which mainly consisted of glucose and galactose. Based on the methylation, FT-IR, 1D, and 2D NMR analysis, the polysaccharide portion of GL-PWQ3 was identified as a glucogalactan, which was comprised of unsubstituted (1,6-α-Galp, 1,6-ß-Glcp, 1,4-ß-Glcp) and monosubstituted (1,2,6-α-Galp and 1,3,6-ß-Glcp) in the backbone and possible branches that at the O-3 position of 1,3-Glcp and T-Glcp, and the O-2 position of T-Fucp, T-Manp or T-Glcp. The chain conformational study by SEC-MALLS-RI and AFM revealed that GL-PWQ3 was identified as a highly branched polysaccharide with a polydispersity index of 1.25, and might have compact sphere structures caused by stacked multiple chains. Moreover, the GL-PWQ3 shows strong anti-oxidative activity in NRK-52E cells. This study provides a theoretical basis for further elucidating the structure-functionality relationships of GL-PWQ3 and its potential application as a natural antioxidant in pharmacotherapy as well as functional food additives.

Whole-brain in vivo base editing reverses behavioral changes in Mef2c-mutant mice.

Whole-brain genome editing to correct single-base mutations and reduce or reverse behavioral changes in animal models of autism spectrum disorder (ASD) has not yet been achieved. We developed an apolipoprotein B messenger RNA-editing enzyme, catalytic polypeptide-embedded cytosine base editor (AeCBE) system for converting C·G to T·A base pairs. We demonstrate its effectiveness by targeting AeCBE to an ASD-associated mutation of the MEF2C gene (c.104T>C, p.L35P) in vivo in mice. We first constructed Mef2cL35P heterozygous mice. Male heterozygous mice exhibited hyperactivity, repetitive behavior and social abnormalities. We then programmed AeCBE to edit the mutated C·G base pairs of Mef2c in the mouse brain through the intravenous injection of blood-brain barrier-crossing adeno-associated virus. This treatment successfully restored Mef2c protein levels in several brain regions and reversed the behavioral abnormalities in Mef2c-mutant mice. Our work presents an in vivo base-editing paradigm that could potentially correct single-base genetic mutations in the brain.

Effectiveness of single-lead ECG devices for detecting atrial fibrillation: An overview of systematic reviews.

BACKGROUND: Individuals with atrial fibrillation (AF) are at an increased risk for stroke. Early detection of undiagnosed AF by screening is recommended. Single-lead electrocardiogram (ECG) is the most widely used technology in AF detection. Several systematic reviews on the diagnostic accuracy of single-lead ECG devices for AF detection have been performed but have yielded inconclusive results. AIMS: The aim of this study was to synthesize the available evidence on the effectiveness of single-lead ECG devices in detecting AF. METHODS: An overview of systematic reviews was conducted. Five English databases (Cochrane Database of Systematic Reviews, PubMed, Embase, Ovid, and Web of Science) and two Chinese databases (Wanfang and CNKI) were searched from inception to July 31, 2021. Systematic reviews that examined the accuracy of tools based on single-lead ECG technology for detecting AF were included. A narrative data synthesis was performed. RESULTS: Eight systematic reviews were finally included. Systematic reviews with meta-analysis showed that single-lead ECG-based devices had good sensitivity and specificity (both ≥90%) in detecting AF. According to subgroup analysis, the sensitivities of tools used in populations with a history of AF were all >90%. However, among handheld and thoracic placed single-lead ECG devices, large variations in diagnostic performance were observed. LINKING EVIDENCE TO ACTION: Single-lead ECG devices can potentially be used for AF detection. Due to the heterogeneity in the study population and tools, future studies are warranted to explore the suitable circumstances in which each tool could be applied for AF screening in an effective and cost-effective manner.

NEXMIF variants are associated with epilepsy with or without intellectual disability.

OBJECTIVES: Variants in NEXMIF had been reported associated with intellectual disability (ID) without epilepsy or developmental epileptic encephalopathy (DEE). It is unkown whether NEXMIF variants are associated with epilepsy without ID. This study aims to explore the phenotypic spectrum of NEXMIF and the genotype-phenotype correlations. MATERIALS AND METHODS: Trio-based whole-exome sequencing was performed in patients with epilepsy. Previously reported NEXMIF variants were systematically reviewed to analyze the genotype-phenotype correlations. RESULTS: Six variants were identified in seven unrelated cases with epilepsy, including two de novo null variants and four hemizygous missense variants. The two de novo variants were absent in all populations of gnomAD and four hemizygous missense variants were absent in male controls of gnomAD. The two patients with de novo null variants exhibited severe developmental epileptic encephalopathy. While, the patients with hemizygous missense variants had mild focal epilepsy with favorable outcome. Analysis of previously reported cases revealed that males with missense variants presented significantly higher percentage of normal intellectual development and later onset age of seizure than those with null variants, indicating a genotype-phenotype correlation. CONCLUSION: This study suggested that NEXMIF variants were potentially associated with pure epilepsy with or without intellectual disability. The spectrum of epileptic phenotypes ranged from the mild epilepsy to severe developmental epileptic encephalopathy, where the epileptic phenotypes variability are potentially associated with patients' gender and variant type.

PCV-VG combined individualized PEEP determination in one-lung ventilated patients with PEEP step change direction: A randomized controlled trial.

INTRODUCTION: The efficacy of pressure-controlled volume-guaranteed ventilation (PCV-VG) combined with a gradient-directional change in positive end-expiratory pressure (PEEP) during one-lung ventilation (OLV) in patients who underwent thoracoscopic surgery was investigated. METHODS: Ninety patients were randomly divided into the PC (PCV-VG + 5 cm H2 O fixed PEEP), PI (PCV-VG + incremental PEEP titration), and PD (PCV-VG + decremental PEEP titration) groups. Hemodynamic (heart rate [HR] and mean arterial pressure [MAP]), respiratory mechanics (Ppeak , Pmean, and Cdyn), and arterial blood gas (pH, PaCO2 , PaO2 , and PaO2 /FiO2 ) indices were evaluated at T1 (10 min of two-lung ventilation [TLV]), T2 (10 min of OLV), and T3 (10 min of recovery, TLV). Enzyme-linked immunosorbent assay was performed to detect neutrophil elastase (NE), clara cell secretory protein (CC16), and interleukin-8 (IL-8) levels at T1 and T3. RESULTS: At T2 and T3 , Ppeak was lower in the PI and PD groups than in the PC group, while Pmean and Cdyn were higher than in the PC group. Ppeak in the PD group was lower than that in the PI group; however, Pmean was higher at T2 and T3 (P < 0.05). At T2 , PaO2 and PaO2 /FiO2 were higher, but PaO2 /FiO2 and VD /VT were lower in the PD and PI groups than in the PC group (P < 0.05). NE, CC16, IL-6, and IL-8 levels were elevated in all three groups at T3 , but the PI and PD groups had lower levels than the PC group (P < 0.05). The incidences of postoperative pulmonary complications (PPCs) and surgical intensive care unit hospitalizations in the PD and PI groups were much lower. CONCLUSION: Gradient-directed altered PEEP titration could improve respiratory mechanics, arterial blood gases, and inflammatory responses and reduce the incidence of PPCs in patients undergoing thoracoscopic surgery.

The Odorant-Binding Protein 1 Mediates the Foraging Behavior of Grapholita molesta Larvae.

Since eggs are laid directly on fruit skin, it is typically believed that food odor has little impact on the foraging of Grapholita molesta larvae. It is crucial to note that larvae that hatch on twigs and leaves could need some sort of identification system when foraging. Here, 22 GmolOBP genes were identified from the G. molesta larval transcriptome via the comparison of conserved domain and homology in the protein level. GmolOBP1 had strong affinities for important pear-fruit volatiles, which caused larvae strong behavioral responses. However, after GmolOBP1 silencing, the larvae lost their attraction to methyl salicylate, α-farnesene, butyl acetate, ethyl butanoate, and ethyl hexanoate, and the effects of larvae seeking various pears were significantly reduced. Consequently, GmolOBP1 was required for the reception of pear volatiles and was involved in mediating how G. molesta larvae foraged. Our research revealed the GmolOBP1 foraging signal recognition mechanism as well as potential molecular targets for field pest management.

Photochemical model assessment of single source NO2 and O3 plumes using field study data.

Single source contribution to ambient O3 and PM2.5 has been estimated with photochemical grid models to support policy demonstrations for National Ambient Air Quality Standards, regional haze, and permit related programs. Limited field data exists to evaluate model representation of the spatial extent and chemical composition of plumes emitted by specific facilities. New tropospheric column measurements of NO2 and in-plume chemical measurements downwind of specific facilities allows for photochemical model evaluation of downwind plume extent, grid resolution impacts on plume concentration gradients, and source attribution methods. Here, photochemical models were applied with source sensitivity and source apportionment approaches to differentiate single source impacts on NO2 and O3 and compare with field study measurements. Source sensitivity approaches (e.g., brute-force difference method and decoupled direct method (DDM)) captured the spatial extent of NO2 plumes downwind of three facilities and the transition of near-source O3 titration to downwind production. Source apportionment approaches showed variability in terms of attributing the spatial extent of NO2 plumes and downwind O3 production. Each of the Community Multiscale Air Quality (CMAQ) source apportionment options predicted large O3 contribution from a large industrial facility in the flight transects nearest the facility when measurements and source sensitivity approaches suggest titration was outpacing production. In general, CMAQ DDM tends to attribute more O3 to boundary inflow and less to within-domain NOX and VOC sources compared to CMAQ source apportionment. The photochemical modeling system was able to capture single source plumes using 1 to 12 km grid resolution with best representation of plume extent and magnitude at the finer resolutions. When modeled at 1 to 12 km grid resolution, primary and secondary PM2.5 impacts were highest at the source location and decrease as distance increases downwind. The use of coarser grid resolution for single source attribution resulted in predicted impacts highest near the source but lower peak source specific concentrations compared to finer grid resolution simulations because impacts were spread out over a larger area.

Repair of dysfunctional bone marrow endothelial cells alleviates aplastic anemia.

Aplastic anemia (AA) is a life-threatening disease characterized by bone marrow (BM) failure and pancytopenia. As an important component of the BM microenvironment, endothelial cells (ECs) play a crucial role in supporting hematopoiesis and regulating immunity. However, whether impaired BM ECs are involved in the occurrence of AA and whether repairing BM ECs could improve hematopoiesis and immune status in AA remain unknown. In this study, a classical AA mouse model and VE-cadherin blocking antibody that could antagonize the function of ECs were used to validate the role of BM ECs in the occurrence of AA. N-acetyl-L-cysteine (NAC, a reactive oxygen species scavenger) or exogenous EC infusion was administered to AA mice. Furthermore, the frequency and functions of BM ECs from AA patients and healthy donors were evaluated. BM ECs from AA patients were treated with NAC in vitro, and then the functions of BM ECs were evaluated. We found that BM ECs were significantly decreased and damaged in AA mice. Hematopoietic failure and immune imbalance became more severe when the function of BM ECs was antagonized, whereas NAC or EC infusion improved hematopoietic and immunological status by repairing BM ECs in AA mice. Consistently, BM ECs in AA patients were decreased and dysfunctional. Furthermore, dysfunctional BM ECs in AA patients led to their impaired ability to support hematopoiesis and dysregulate T cell differentiation toward proinflammatory phenotypes, which could be repaired by NAC in vitro. The reactive oxygen species pathway was activated, and hematopoiesis- and immune-related signaling pathways were enriched in BM ECs of AA patients. In conclusion, our data indicate that dysfunctional BM ECs with impaired hematopoiesis-supporting and immunomodulatory abilities are involved in the occurrence of AA, suggesting that repairing dysfunctional BM ECs may be a potential therapeutic approach for AA patients.

Upregulation of TMEM40 is associated with the malignant behavior and promotes tumor progression in cervical cancer.

OBJECTIVE: Recent studies indicated that transmembrane protein 40 (TMEM40) is associated with several types of cancers but is not clear in cervical cancer (CC). The study aimed to examine the role of TMEM40 in CC and related mechanisms. METHODS: The expression of TMEM40 in CC tissues and cell lines was studied with western blot and real-time quantitative RT-PCR. The effect of TMEM40 on proliferation was evaluated by CCK-8, EdU and colony formation assay. The migration, invasion, cell cycle and apoptosis of CC cells were studied with wound healing, transwell assays and flow cytometry. Tumor growth was evaluated in vivo using a xenogenous subcutaneously implant model. RESULTS: The results revealed that the TMEM40 elevation in CC tissues and cell lines was closely correlated with tumor size and lymph node metastasis in clinical patients. Upregulation of TMEM40 with OE-TMEM40 vector promoted the invasion, migration and proliferation, inhibited the apoptosis and led to distinct S cell cycle arrest in CC cell lines. Silencing TMEM40 with shRNA inhibited the invasion, migration and proliferation, promoted apoptosis and led to a G0/G1 cell cycle arrest in CC cell lines. Silence of TMEM40 downregulated the expression of c-MYC, Cyclin D1, matrix metalloproteinase-1 (MMP-1) and matrix metalloproteinase-9 (MMP-9), but in contrast, activated p53 and several apoptosis related proteins such as p53, Caspase-3, Caspase-9 and PARP1. In addition, TMEM40 silencing dramatically decreased tumor growth in mice models. CONCLUSION: The present study demonstrates that TMEM40 upregulation can be a potential prognostic biomarker and contribute to CC development.

Increased Expression of Pluripotent Factors in Human Umbilical Cord Mesenchymal Stem Cells Transfected with Three tRF Molecules.

tRFs and tiRNAs are small noncoding RNA molecules that are widespread in eukaryotic and prokaryotic transcriptomes with extremely powerful functions. We screened three tRF molecules whose expression was stably elevated in reprogrammed cells by tRF and tiRNA sequencing, synthesized these three molecules and transfected them into human umbilical cord mesenchymal stem cells. We detected the pluripotent factor OCT4 by Western Blot (WB) after transfection. The gene and protein expression of the pluripotent genes OCT4 and NANOG increased significantly, and telomere (TEL) expression increased significantly. Cell activity was increased, apoptosis was decreased, and the cell cycle had also changed to some extent. These results showed that the three tRF molecules, tRF-16-K87965D (sequence: CCCGGGTTTCGGCACC), tRF-17-K879652 (sequence: CCCGGGTTTCGGCACCA), and tRF-22-WD8YQ84V2 (sequence: TCGACTCCTGGCTGGCTCGCCA), can promote cell rejuvenation and increase pluripotency.

The genus Eurymeros Bhat (Hymenoptera, Braconidae, Alysiinae) newly recorded from China.

Background: Alysiinae Leach is a species-rich subfamily in Braconidae, of which several species play an important role in biological control. The monotypic genus Eurymerostumespiraculum Bhat, 1980 was discovered in Tibet and Yunnan provinces for the first time, representing the first record of the genus Eurymeros Bhat, 1980 (Braconidae, Alysiinae) in China. New information: The rare genus Eurymeros Bhat, 1980 (Braconidae, Alysiinae) and its only known species, E.tumespiraculum Bhat, 1980, are newly recorded from China. The morphological variation of the Chinese specimens is described and illustrated.

Dry Deposition Methods Based on Turbulence Kinetic Energy: Part 2. Extension to Particle Deposition Using a Single-Point Model.

Magnitude of atmospheric turbulence, a key driver of several processes that contribute to aerosol (i.e., particle) deposition, is underrepresented in current models. Various formulations have been developed to model particle dry deposition; all these formulations typically rely on friction velocity and some use additional ad hoc factors to represent enhanced impacts of turbulence. However, none were formally linked with the three-dimensional (3-D) turbulence. Here, we propose a set of 3-D turbulence-dependent resistance formulations for particle dry deposition simulation and intercompare the performance of new resistance formulations with that obtained from using the existing formulations and measured dry deposition velocity. Turbulence parameters such as turbulence velocity scale, turbulence factor, intensity of turbulence, effective sedimentation velocity, and effective Stokes number are newly introduced into two different particle deposition schemes to improve turbulence strength representation. For an assumed particle size distribution, the newly proposed schemes predict stronger diurnal variation of particle dry deposition velocity and are comparable to corresponding measurements while existing formulations indicate large underpredictions. We also find that the incorporation of new turbulence parameters either introduced or added stronger diurnal variability to sedimentation velocity and collection efficiencies values, making the new schemes predict higher deposition values during daytime and nighttime when compared to existing schemes. The findings from this research may help improve the capability of dry deposition schemes in regional and global models.

Response of physiological characteristics of ecological restoration plants to substrate cement content under exogenous arbuscular mycorrhizal fungal inoculation.

Introduction: In order to solve the inhibition of alkaline environment on plants growth at the initial stage of Eco-restoration of vegetation concrete technology, introducing AMF into vegetation concrete substrate is an effective solution. Methods: In this study, Glomus mosseae (GM), Glomus intraradices (GI) and a mixture of two AMF (MI) were used as exogenous inoculation agents. Festuca elata and Cassia glauca were selected as host plants to explore the relationship between the physiological characteristics of plants and the content of substrate cement under exogenous inoculation of AMF. Results: The experiment showed that, for festuca elata, the maximum mycorrhizal infection rates of inoculation with GM, MI were when the cement contents ranged 5-8% and that of GI inoculation was with the cement contents ranging 5-10%. Adversely, for Cassia glauca, substrate cement content had little effect on the root system with the exogenous inoculation of AMF. Compared with CK, the effects of AMF inoculation on the physiological characteristics of the two plants were different. When the cement content was the highest (10% and 8% respectively), AMF could significantly increase(p<0.05) the intercellular CO2 concentration (Ci) of Festuca elata. Moreover, for both plants, single inoculation was more effective than mixed inoculation. When the cement content was relatively low, the physiological characteristics of Cassia glauca were promoted more obviously by the inoculation of GI. At higher cement content level, inoculation of GM had a better effect on the physiological characteristics of the two plants. Conclusion: The results suggest that single inoculation of GM should be selected to promote the growth of Festuca elata and Cassia glauca in higher alkaline environment.