Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 46
Filtrar
1.
PLoS One ; 18(5): e0286223, 2023.
Artigo em Inglês | MEDLINE | ID: mdl-37256859

RESUMO

Soil fertility management and crop productivity both are inter-related need extensive attention for sustainability. Industries are being built, which over time produces a lot of effluents containing heavy metal(s), which is then dumped on healthy soils and water bodies. Long-term discharge of lead (Pb)-containing wastewater resulted in significant Pb buildup as well as a decrease in soil biological activity. In this experiment, graded dose of Pb, i.e. 0, 100, 150 and 300 mg/kg and pressmud (PM) (0, 2.5, 5, 10 g/kg) were applied to monitor the Pb toxic effect on soil acid and alkaline phosphatase, dehydrogenase activity. Different treatment combinations were formulated and the experiment was conducted in a completely randomized design (CRD) with three replications. In this experiment, spinach crop was used as a test crop. According to the findings, increased Pb levels in the soil lowered dehydrogenase activity (DHA), acid and alkaline phosphatase. The addition of PM enhanced enzymatic activities by decreasing the labile fraction of Pb in the soil. Incorporation of PM improved the soil enzymatic activities as alkaline phosphatase activity > DHA > acid phosphatase activity in the study. This study suggested that the addition of 10 g/kg PM reduced Pb toxicity (contamination level 300 mg/kg) and improved the soil microbial properties in black soil. These findings are very useful for the remediation of Pb contaminated soil with the help of PM, particularly in peri-urban Pb effluent irrigated areas.


Assuntos
Metais Pesados , Saccharum , Poluentes do Solo , Fosfatase Alcalina , Saccharum/metabolismo , Resíduos Industriais , Chumbo/toxicidade , Poluentes do Solo/análise , Metais Pesados/análise , Solo , Oxirredutases
2.
Arch Orthop Trauma Surg ; 143(4): 2063-2071, 2023 Apr.
Artigo em Inglês | MEDLINE | ID: mdl-35779101

RESUMO

BACKGROUND: The anterior cruciate ligament (ACL) is a common knee ligament injury. Partial ACL tears are common, and at least 10-27% of isolated ACL tears are diagnosed as partial tears. Patients with partial tears have high risk of progression of tears to complete tears, which may require surgical reconstruction. The risk factors associated with the progression to a complete tear are poorly understood. METHODS: The present case-control study assessed the incidence and risk factors for the progression of conservatively treated partial ACL tears to complete tears in 351 patients younger than 45 years. The diagnosis of partial ACL tears was based on clinical evaluation, side-to-side difference on Rolimeter, and magnetic resonance imaging. These patients were managed conservatively and followed up for a mean of 17.5 months or until the progression of the tear into a complete tear, requiring surgery. The patients in whom the tear progressed to complete tear (group P) were compared with those in whom the tear remained stable for a minimum of 18-month follow-up period (group S). RESULTS: Of the 351 partial ACL tear patients, 166 (47.3%) patients progressed to a complete tear at a mean duration of 17.5 months, whereas the tear in 185 (52.7%) patients remained stable and did not progress to a complete tear. Group P had mean international knee documentation committee (IKDC) scores and Tegner scores of 95.7 ± 3.7 and 7.6 ± 1.6, respectively, before the injury, and scores decreased to 52.4 ± 4.1 and 5.7 ± 2.2, respectively, at the 24-month follow-up. CONCLUSION: Partial ACL tear progressed to a complete tear in 47.3% of evaluated patients. The associated risk factors were age less than 35 years, rigorous physical activities, high ACL-Return to Sport after Injury score during early rehabilitation days, early return to activity, and pivoting contact sports.


Assuntos
Lesões do Ligamento Cruzado Anterior , Traumatismos do Joelho , Humanos , Adulto , Lesões do Ligamento Cruzado Anterior/epidemiologia , Lesões do Ligamento Cruzado Anterior/cirurgia , Estudos Retrospectivos , Ligamento Cruzado Anterior , Articulação do Joelho/cirurgia , Traumatismos do Joelho/complicações , Ruptura
3.
Altern Ther Health Med ; 27(S1): 18-24, 2021 Jun.
Artigo em Inglês | MEDLINE | ID: mdl-33609349

RESUMO

CONTEXT: Inflammation is a significant factor driving the rise of multiple cases of viral pneumonia, including COVID-19 infection. Peripheral white blood cells (WBCs), the neutrophil (NEU)-to-lymphocyte (LYM) ratio (NLR), the platelet-to-lymphocyte (PLR) ratio, and hemoglobin (Hb) are markers of systematic inflammatory reaction and often predict disease severity. OBJECTIVE: The current study intended to examine the prognostic importance of hemoglobin (Hb), total leukocyte count (TLC), absolute neutrophile count (ANC), absolute lymphocyte count (ALC), NLR, d-NLR [derived NLR = ANC/(WBC-ANC)], absolute platelet count (APC), and PLR, based on complete blood counts (CBCs) for COVID-19 patients. DESIGN: The research team designed a retrospective that was conducted between March 27 and June 5, 2020, after the first COVID-19 case was reported in Ajmer, Rajasthan, India on March 27. SETTING: The study took place at Jawaharlal Nehru (JLN) Medical College in Ajmer, Rajasthan, India. PARTICIPANTS: The study included 364 participants who were all COVID-positive patients who came to the hospital during the study's period, including patients from various age groups and of both genders. OUTCOME MEASURES: Using the results of the CBC, the research team measured: (1) Hb in g/dl, (2) ANC, (3) ALC, and (4) APC. The neutrophil-lymphocyte ratio (NLR) and the platelet-lymphocyte ratio (PLR) were calculated from measurements of the levels of the circulating biomarkers, as cells × 103/µl. RESULT: For participants who were severely symptomatic, the mean age was 57.86 ± 8.92. Males were more likely to experience severe symptoms. Participants' Hb values were significantly different between groups, and TLC, ANC, NLR, d-NLR, and PLR were highest in the severely symptomatic group and lowest in the asymptomatic group. NLR was positively associated with a risk of COVID-19 pneumonia, while Hb was negatively associated with development of pneumonia. CONCLUSIONS: Disease severity and age are independent predictors of poor outcomes. The NLR should be used as a routine blood test that can help in the diagnosis of disease severity in COVID-19. NLR is very simple tool that can be used as a fast and low-cost test that is easily available, even in small centers where the facilities for other tests, such as tests of LDH, CRP, and IL-6, and high resolution CT scans aren't available. Thus, NLR can be used as single independent predictor of COVID-19 disease severity.


Assuntos
COVID-19 , Idoso , Contagem de Células Sanguíneas , Feminino , Humanos , Índia , Masculino , Pessoa de Meia-Idade , Estudos Retrospectivos , SARS-CoV-2 , Centros de Atenção Terciária
4.
Entropy (Basel) ; 21(1)2019 Jan 19.
Artigo em Inglês | MEDLINE | ID: mdl-33266807

RESUMO

A software bug is characterized by its attributes. Various prediction models have been developed using these attributes to enhance the quality of software products. The reporting of bugs leads to high irregular patterns. The repository size is also increasing with enormous rate, resulting in uncertainty and irregularities. These uncertainty and irregularities are termed as veracity in the context of big data. In order to quantify these irregular and uncertain patterns, the authors have appliedentropy-based measures of the terms reported in the summary and the comments submitted by the users. Both uncertainties and irregular patterns have been taken care of byentropy-based measures. In this paper, the authors considered that the bug fixing process does not only depend upon the calendar time, testing effort and testing coverage, but it also depends on the bug summary description and comments. The paper proposed bug dependency-based mathematical models by considering the summary description of bugs and comments submitted by users in terms of the entropy-based measures. The models were validated on different Eclipse project products. The models proposed in the literature have different types of growth curves. The models mainly follow exponential, S-shaped or mixtures of both types of curves. In this paper, the proposed models were compared with the modelsfollowingexponential, S-shaped and mixtures of both types of curves.

5.
Can J Microbiol ; 57(11): 934-42, 2011 Nov.
Artigo em Inglês | MEDLINE | ID: mdl-22017748

RESUMO

Spot blotch of wheat caused by Bipolaris sorokiniana is an important disease of wheat, especially in slightly warm (25 ± 1 °C) and humid weather conditions. A quick and reliable PCR-based diagnostic assay has been developed to detect B. sorokiniana using a pathogen-specific marker derived from genomic DNA. A PCR-amplified band of 650 bp obtained in B. sorokiniana isolates using universal rice primer (URP 1F) was cloned in pGEMT easy vector and sequenced. Based on sequences, six primers were designed, out of which a primer pair RABSF1 (GGTCCGAGACAACCAACAA) and RABSR2 (AAAGAAAGCGGTCGACGTAA) amplified a sequence of 600 bp in B. sorokiniana isolates. The specificity of the marker when tested against 40 isolates of B. sorokiniana, seven isolates of other species of Bipolaris, and 27 isolates of other pathogens infecting wheat and other crops showed a specific band of 600 bp only in B. sorokiniana. The detection limit was 50 pg of genomic DNA. The marker could detect the pathogen in soil and wheat leaves at presymptomatic stage. This sequence characterized amplified region (SCAR) marker designated as SCRABS(600) could clearly distinguish B. sorokiniana from other fungal plant pathogens, including Bipolaris spp. The utilization of this diagnostic PCR assay in analysis of field soil and wheat leaves will play a key role in effective management of the disease.


Assuntos
Agricultura/métodos , Ascomicetos/genética , Ascomicetos/isolamento & purificação , Reação em Cadeia da Polimerase , Microbiologia do Solo , Triticum/microbiologia , Primers do DNA , Dados de Sequência Molecular , Folhas de Planta/microbiologia , Técnica de Amplificação ao Acaso de DNA Polimórfico , Sensibilidade e Especificidade
6.
Arch Virol ; 155(8): 1343-7, 2010 Aug.
Artigo em Inglês | MEDLINE | ID: mdl-20526636

RESUMO

Genomic components of a begomovirus isolated from tomato plants showing leaf curl and stunting symptoms in farmer's fields at Hessarghatta village near Bangalore, India, were cloned by rolling-circle amplification. The virus was identified as a variant of strain C of the species Tomato leaf curl Bangalore virus and designated as Tomato leaf curl Bangalore virus-C[India:Hessarghatta:2008], ToLCBV-C[IN:Hess:08]. The betasatellite isolated from these samples belongs to the betasatellite species Tomato leaf curl Bangalore betasatellite. ToLCBV-C[IN:Hess:08] induced severe symptoms in Nicotiana benthamiana and Solanum lycopersicum plants when co-inoculated with the cognate betasatellite, Tomato leaf curl Bangalore betasatellite-[India:Hessarghatta:2008], ToLCBB-[IN:Hess:08] and with two other non-cognate betasatellites, Cotton leaf curl Multan betasatellite-[India:SriGanganagar:2002] and Luffa leaf distortion betasatellite-[India:Luffa:2004].


Assuntos
Begomovirus/patogenicidade , DNA Satélite/genética , Doenças das Plantas/virologia , Folhas de Planta/virologia , Solanum lycopersicum/virologia , Begomovirus/classificação , Begomovirus/genética , Clonagem Molecular , DNA Viral/genética , Genoma Viral , Índia , Solanum/virologia , Nicotiana/virologia
7.
Indian J Plast Surg ; 43(Suppl): S85-7, 2010 Sep.
Artigo em Inglês | MEDLINE | ID: mdl-21321663

RESUMO

A new method for release of severe mentosternal contractures has been described in this paper under central neuraxial blockade. The contracture release was performed under thoracic epidural analgesia. This technique can benefit patients with mentosternal contractures to avoid the problems of entubation and it can also assist in postoperative recovery and analgesia. The epidural catheter can be used to extend the height or duration of intraoperative block and is also useful to provide postoperative epidural analgesia.

8.
J Assoc Physicians India ; 55: 27-31, 2007 Jan.
Artigo em Inglês | MEDLINE | ID: mdl-17444341

RESUMO

BACKGROUND: Influence of habitual tobacco chewing on cardiovascular risk has not been well studied. To determine prevalence of major cardiovascular risk factors in subjects who habitually chew tobacco we performed a controlled study. METHODS: A population based case-control study was performed in Bikaner in North-western India where the prevalence of tobacco-chewing is high. Successive 200 subjects who agreed to participate in the evaluation and had a history of isolated tobacco-chewing (range 10-60 years) were enrolled (Group III). The prevalence of major coronary risk factors- obesity, truncal obesity, hypertension, fasting hyperglycemia, and lipid levels were estimated using current guidelines. Electrocardiogram was also performed in all subjects. Chest radiography and treadmill stress test was done in subjects when indicated by symptoms. 200 age- and gender-matched controls who did not use tobacco in any form (Group I) and 200 subjects who had history of smoking bidis or cigarettes for more than 10 years (range 10-55 years) (Group II) were also evaluated. RESULTS: The body-mass index and obesity were lowest in smoker group. Tobacco chewers had a significantly higher (p<0.001) systolic blood pressure (BP), diastolic BP, resting heart rate, total cholesterol, LDL cholesterol and triglycerides as compared to controls and was similar to smoker group. There was a significantly greater (p<0.01) prevalence of hypertension, hypercholesterolemia, hypertriglyceridemia, radiographic cardiomegaly and positive stress test in Group III as compared to controls. Prevalence of these risk factors was similar among Group II and Group III subjects. HDL cholesterol levels were the lowest in tobacco-chewing group (44.3+/-8.1 mg/dl) as compared to the Group I (48.4+/-7.8) and Group II (47.4+/-7.5) (p<0.001). CONCLUSIONS: There is a significantly greater prevalence of multiple cardiovascular risk factors obesity, resting tachycardia, hypertension, high total and LDL cholesterol, and low HDL cholesterol, and electrocardiographic changes in tobacco users, chewing or smoking, as compared-to tobacco non-users. Chewing tobacco is associated with similar cardiovascular risk as smoking.


Assuntos
Doenças Cardiovasculares/epidemiologia , Tabagismo/complicações , Tabaco sem Fumaça , Adulto , Idoso , Estudos de Casos e Controles , Feminino , Humanos , Índia/epidemiologia , Masculino , Pessoa de Meia-Idade , Prevalência , Fatores de Risco
9.
Int J Geriatr Psychiatry ; 22(11): 1101-5, 2007 Nov.
Artigo em Inglês | MEDLINE | ID: mdl-17357180

RESUMO

BACKGROUND: Morbidity among elderly people has an important influence on their psychological well-being. Evaluation of the morbidity profile and its determinants, which have implications for management of medical problems of elderly people, are scarce in developing countries. Even the physicians' detection rate of mental distress in elderly populations is low in medical outpatient clinics. This could be due to the large caseloads and also, importantly, underestimation of psychological concerns of the elderly. The objective of this study was to study the psychiatric co-morbidity and life events among elderly medical outpatients. METHODS: One hundred medically ill elderly (>60 years) patients attending the Geriatric Clinic at Bikaner (North India) constituted the study population. The physical diagnosis was made by a physician based on reported illness, clinical examination and medical records. Psychiatric diagnosis was made by detailed clinical psychiatric interview using ICD-10 guidelines. Life events were assessed by the Indian adaptation of Presumptive Stressful Life Events Scale. RESULTS: Hypertension was the most commonly reported physical diagnosis (50%), other specific medical illnesses were osteoarthritis (15%), diabetes (13%) and constipation (8%). The study found 18% subjects had depression and 11% had other mental disorders. Patients with mental disorders had suffered more recent stressful life events. Among life events, conflicts in family (16%); unemployment of self or children (9%) was reported by elderly psychiatric patients. Other reported life events in psychiatric diagnosed elderly were conflict in family (7%), illness of self (6%) or family members (5%) and death of family members (5%) or close relatives (4%). CONCLUSION: Mental disorders are common among medically ill elderly patients, but they are poorly recognized and treated. Assessment of the psychiatric morbidity will help in strengthening psycho-geriatric services and thus, improve the quality of life of the elderly.


Assuntos
Doença Crônica/psicologia , Países em Desenvolvimento , Acontecimentos que Mudam a Vida , Transtornos Mentais/etiologia , Idoso , Transtorno Depressivo/etiologia , Feminino , Avaliação Geriátrica/métodos , Humanos , Índia , Masculino , Ambulatório Hospitalar , Fatores de Risco , Fatores Socioeconômicos
10.
Spectrochim Acta A Mol Biomol Spectrosc ; 67(3-4): 687-93, 2007 Jul.
Artigo em Inglês | MEDLINE | ID: mdl-17045517

RESUMO

Raman and FTIR spectra of 2-phenyl-4-(4-methoxy benzylidene)-2-oxazolin-5-one were recorded in the regions, 100-3300 and 400-4000 cm(-1), respectively. Vibrational frequencies and intensities of the fundamental modes of this hetrocyclic organic molecule were computed using ab initio as well as AM1 semiempirical molecular orbital methods. Ab initio calculations were carried out with basis set up to RHF/6-311G. Conformational studies regarding the effect of moving the methoxy group in the 2-phenyl-4-(4-methoxy benzylidene)-2-oxazolin-5-one molecule to a different position on the ring was also carried out. Observed vibrational wavenumbers were found to be mostly consistent with ab initio values. The most intense mode of vibration observed at 1250 cm(-1) in Raman spectra, also observed as a strong band in FTIR, was assigned as C-O stretching vibration in the methoxy group. Asymmetric stretching vibrations between CC and CN bonds was predicted as most intense mode by our ab initio calculation.


Assuntos
Compostos de Benzilideno/análise , Oxazóis/análise , Espectroscopia de Infravermelho com Transformada de Fourier , Análise Espectral Raman , Compostos de Benzilideno/química , Modelos Químicos , Conformação Molecular , Oxazóis/química , Temperatura
11.
Spectrochim Acta A Mol Biomol Spectrosc ; 65(5): 1125-30, 2006 Dec.
Artigo em Inglês | MEDLINE | ID: mdl-16716650

RESUMO

The vibrational spectra of benzofuran and some of its derivatives have been systematically investigated by ab initio and density functional B3LYP methods. The harmonic vibrational wavenumbers and intensity of vibrational bands were calculated at ab initio and DFT levels invoking different basis sets up to 6-311++g**. Vibrational assignments have been made and it has been found that the calculated DFT frequencies agree well in most cases with the observed frequencies for each molecule. Conformational studies have also been carried out and it is evident from ab initio calculations that 2(3H) benzofuranone is more stable than 3(2H) benzofuranone in support to our earlier semiempirical results.


Assuntos
Benzofuranos/química , Modelos Moleculares , Modelos Teóricos , Conformação Molecular , Análise Espectral , Vibração
12.
Artigo em Inglês | MEDLINE | ID: mdl-16098806

RESUMO

FTIR and Raman spectra of a rubber vulcanization accelerator, 2-mercaptobenzothiazole (MBT), were recorded in the solid phase. The harmonic vibrational wavenumbers, for both the toutomeric forms of MBT, as well as for its dimeric complex, have been calculated, using ab initio RHF and density functional B3LYP methods invoking different basis sets upto RHF/6-31G** and B3LYP/6-31G** and the results were compared with the experimental values. Conformational studies have been also carried out regarding its toutomeric monomer forms and its dimer form. With all the basis sets the thione form of MBT (II) is predicted to be more stable than thiol form (I) and dimeric conformation (III) is predicted to be more stable with monomeric conformations (I) and (II). Vibrational assignments have been made, and it has been found that the calculated normal mode frequencies of dimeric conformation (III) are required for the analysis of IR and Raman bands of the MBT. The predicted shift in NH- stretching vibration towards the lower wave number side with the B3LYP/6-31G** calculations for the most stable dimer form (III), is in better agreement with experimental results. The intermolecular sulfur-nitrogen distance in N-H...S hydrogen bond was found to be 3.35 angstroms from these calculations, is also in agreement to the experimental value.


Assuntos
Modelos Químicos , Tiazóis/química , Benzotiazóis , Conformação Molecular , Espectroscopia de Infravermelho com Transformada de Fourier , Análise Espectral Raman , Vibração
13.
Spectrochim Acta A Mol Biomol Spectrosc ; 61(11-12): 2741-6, 2005 Sep.
Artigo em Inglês | MEDLINE | ID: mdl-16043073

RESUMO

The infrared and Raman spectra of glycine molecule has been studied in spectral region 400-4000 cm(-1) in solid form as well as in water. The vibrational frequencies for the fundamental modes of the glycine in neutral and its zwitterionic form have also been calculated using AM1 semiempirical method as well as ab initio method with minimal basis set. The reliability of the minimal basis set and AM1 method with higher basis sets, for IR spectra of the neutral glycine conformers were examined. We find that the 6-21G basis set calculation yields structural parameters, rotational constant and dipole moment of glycine conformers, which are very similar to those obtained from extended basis set calculation as well as experimental values. IR frequencies for glycine conformer I are also calculated in water using SCRF=PCM model and compared with experimental values. A comparison between calculated frequencies for neutral glycine, and its zwitterionic form with observed IR and Raman bands have been made. The total energies for gas phase glycine and its zwitterionic form along with those of hydrated forms were also calculated. It is found from the calculations that in the gas phase neutral glycine is more stable as compared to its zwitterionic form.


Assuntos
Glicina/química , Modelos Moleculares , Conformação Molecular , Espectrofotometria Infravermelho , Análise Espectral Raman , Termodinâmica , Vibração , Água/química
14.
Spectrochim Acta A Mol Biomol Spectrosc ; 59(2): 213-8, 2003 Jan 15.
Artigo em Inglês | MEDLINE | ID: mdl-12685893

RESUMO

Raman spectra of 2 (3H) benzofuranone have been recorded in the region 400-3200 cm(-1) and the IR spectra have been recorded in the region 200-4000 cm(-1). Vibrational frequencies for the fundamental modes of this bicyclic heteroatomic molecule have also been calculated using Austin method 1 (AM1) semiempirical molecular orbital method. Vibrational assignments have been made for the fundamental modes and the observed combination and overtone bands are also assigned. A splitting in the carbonyl group (C=O stretching) frequency observed at 1640-1660 cm(-1) in both Raman and IR spectra, is explained as Fermi-resonance. Net atomic charges for each atom of this molecule along with its heat of formation were also calculated. It is evident from the calculations that the 2 (3H) benzofuranone is more stable than the 3 (2H) benzofuranone in contrast to earlier estimates.


Assuntos
Benzofuranos/análise , Benzofuranos/química , Compostos de Benzilideno/química , Espectrofotometria Infravermelho/métodos , Análise Espectral Raman/métodos , Software
15.
Spectrochim Acta A Mol Biomol Spectrosc ; 58(10): 2145-52, 2002 Aug.
Artigo em Inglês | MEDLINE | ID: mdl-12212739

RESUMO

The infrared spectrum of bilirubin has been recorded in the spectral region 200-4000 cm(-1). The Raman spectrum has also been recorded using the second harmonic (530 nm) radiation of a 200 mW Nd-YAG laser. In order to confirm the vibrational assignment of the bands obtained from experimental observation, a normal coordinate analysis has been carried out using the semi-empirical AM1 method through MOPAC 5.1 computer program. Electronic absorption spectrum of bilirubin dissolved in CHCl3 has been recorded in the spectral region 300-600 nm. A broad spectrum is observed with peak maxima at 454.2 nm. The photoacoustic spectrum of this molecule (in the powder form) has also been recorded for the first time which shows certain discrete features.


Assuntos
Bilirrubina/química , Modelos Moleculares , Estrutura Molecular , Espectrofotometria/métodos , Espectrofotometria Infravermelho/métodos , Análise Espectral Raman/métodos
16.
Neurol India ; 50(1): 63-7, 2002 Mar.
Artigo em Inglês | MEDLINE | ID: mdl-11960154

RESUMO

Routine use of steroids in the treatment of bacterial meningitis remains controversial. A prospective placebo controlled double blind study of dexamethasone was carried out in 40 patients (age>10 years) of acute bacterial meningitis. The patients were randomly assigned to receive either placebo (n=20) or dexamethasone (n=20) in addition to injection ceftriaxone 100 mg/kg/day (maximum 4 gm/day) for 14 days. Dexamethasone sodium phosphate was given in dose of 0.6 mg/kg/day in 4 divided doses, for first 4 days of therapy. First dose of dexamethasone was given 15 minutes prior to first dose of ceftriaxone. Baseline demographics, clinical and laboratory features of the two groups were similar. Clinical improvement of signs of meningeal irritation was rapid in dexamethasone group than in the placebo group, but no significant difference was observed regarding resolution of fever, headache and vomiting. Secondary fever (mean+/-SD 15.00), gastrointestinal tract bleeding (mean+/-SD 15.00) and psychiatric manifestations (mean+/-SD 10.00) were more common in dexamethasone group. Neurological complications and hearing loss were more common and severe in placebo group as compared to the dexamethasone group (p<0.05). It is concluded that dexamethasone may be beneficial in some aspects of bacterial meningitis, in adults. A study with a larger number of cases in each group is recommended.


Assuntos
Anti-Inflamatórios/uso terapêutico , Dexametasona/uso terapêutico , Meningites Bacterianas/tratamento farmacológico , Adolescente , Adulto , Cefuroxima/uso terapêutico , Cefalosporinas/uso terapêutico , Método Duplo-Cego , Quimioterapia Combinada , Feminino , Humanos , Masculino , Placebos
17.
J Assoc Physicians India ; 49: 963-5, 2001 Oct.
Artigo em Inglês | MEDLINE | ID: mdl-11848326

RESUMO

AIM: To establish the etiology of recent out break of polyarthritis which occurred in Kanvari village of Churu district of Rajasthan in August, 1999. METHODOLOGY: Forty eight patients of polyarthritis were studied by Hb, TDLC, ESR, CRP, throat swab Gram's stain and culture, blood culture, ASO titer, rheumatoid factor, Rose Bengal plate agglutination test, standard tube agglutination test for brucellosis, widal test, urine examination, X-ray chest, ECG and X-ray of the affected joint. RESULTS: Forty eight patients presented with acute polyarthritis with low grade fever of 1-2 week duration. Most common joint involved was sacroiliac joint (52.08%). Most of patients had multiple joint involvement (93.75%). The Rose Bengal plate agglutination test and standard tube agglutination test for brucella were positive in high titres in 44 (91.60%) patients. All the patients were treated with therapy for brucellosis and followed up for 12 weeks and responded well without complications. CONCLUSION: In case of polyarthritis possibility of brucellosis should always be kept in mind.


Assuntos
Artrite/epidemiologia , Surtos de Doenças , Febre/etiologia , Doença Aguda , Adolescente , Adulto , Fatores Etários , Artrite/complicações , Artrite/diagnóstico , Artrite/etiologia , Brucelose/complicações , Brucelose/diagnóstico , Criança , Pré-Escolar , Feminino , Seguimentos , Humanos , Índia/epidemiologia , Masculino , Pessoa de Meia-Idade , Gravidez , Fatores Sexuais , Fatores de Tempo
18.
Indian Heart J ; 52(4): 421-6, 2000.
Artigo em Inglês | MEDLINE | ID: mdl-11084783

RESUMO

This study was conducted on 50 patients of diabetes mellitus type 2 and 20 healthy controls to correlate severity of diabetic cardiac autonomic neuropathy with QTc interval and QTc dispersion. Five standard cardiovascular response tests were carried out (i.e. Valsalva ratio, expiration-inspiration ratio, immediate heart rate response to standing, fall of systolic blood pressure on standing and sustained hand grip test) to determine the severity of cardiac autonomic neuropathy by scoring system. QTc dispersion was determined by subtracting heart rate-corrected minimum QTc interval (QTc min) from maximum QT interval (QTc max) from standard electrocardiogram. Severity of cardiac autonomic neuropathy strongly correlated with QTc dispersion (r = 0.760; p = 0.0001). Correlation of severity of cardiac autonomic neuropathy with QTc max and QTc mean was also found but weaker than with QTc dispersion (r = 0.663, r = 0.542, p = 0.0001 each) and no correlation was found with QTc min (r = 0.177; p = 0.17). This shows that QTc dispersion is a better predictor of cardiac autonomic neuropathy than any of above three QTc intervals. QTc max, QTc mean and QTc dispersion were significantly higher (p < 0.001) in diabetics with autonomic neuropathy (450 +/- 23, 423 +/- 22 and 57 +/- 12 msec; n = 30) than without neuropathy (407 +/- 14, 397 +/- 15 and 20 +/- 7 msec; n = 20) and control subjects (408 +/- 20, 399 +/- 19 and 19 +/- 7 msec; n = 20) but QTc min remained same in the three groups (393 +/- 21, 387 +/- 12, 388 +/- 19 msec, respectively) (p > 0.05). Correlation of QTc dispersion was stronger with QTc max (r = 0.781; p < 0.001) than QTc mean (r = 0.625; p = 0.001) but not with QTc min (r = 0.097; p = 1.0) which suggests that regional increase in QT interval due to regional autonomic denervation leads to increased QTc dispersion. Thus, QTc dispersion is a sensitive, non-invasive, simple and cost-effective predictor of cardiac dysautonomia.


Assuntos
Doenças do Sistema Nervoso Autônomo/diagnóstico , Doenças Cardiovasculares/diagnóstico , Diabetes Mellitus Tipo 2/complicações , Eletrocardiografia , Adulto , Idoso , Doenças do Sistema Nervoso Autônomo/etiologia , Doenças do Sistema Nervoso Autônomo/fisiopatologia , Doenças Cardiovasculares/etiologia , Diabetes Mellitus Tipo 2/diagnóstico , Feminino , Coração/inervação , Coração/fisiopatologia , Hemodinâmica/fisiologia , Humanos , Masculino , Pessoa de Meia-Idade , Análise Multivariada , Valores de Referência , Análise de Regressão , Medição de Risco , Índice de Gravidade de Doença
19.
Indian J Malariol ; 37(3-4): 61-7, 2000.
Artigo em Inglês | MEDLINE | ID: mdl-11820087

RESUMO

Hundred confirmed cases of malaria were included in the present study to determine the clinical and prognostic implications of hypocalcemia and corrected QT interval (QTc) prolongation in malaria. Peripheral blood smear examination was done to determine the parasite species and the parasite load. Serum calcium level and QTc measurements in electrocardiogram were done for each patient. Fifty patients were of P. falciparum malaria (38 complicated and 12 uncomplicated), 40 of vivax malaria and 10 patients were having mixed (P. falciparum and P. vivax) infection. Hypocalcemia was found in 26 cases in which QTc was prolonged. Ten patients who had convulsions, all of them were having QTc prolongation and eight had hypocalcemia. A total number of eight patients had muscle spasm, of which six had QTc prolongation and four had hypocalcemia. There were 34 cases of cerebral malaria, of which 18 had hypocalcemia as well as QTc prolongation, 12 of them developed renal failure and 14 had high parasitaemia. Four patients died who had hypocalcemia and QTc prolongation due to hepatorenal syndrome. The mean parasite load, QTc interval and serum calcium were 2.69 +/- 1.0, 0.468 +/- 0.055 sec and 8.16 +/- 0.86 mg/dl respectively in complicated falciparum malaria; 1.6 +/- 0.55, 0.442 +/- 0.043 sec and 8.72 +/- 0.97 mg/dl in complicated mixed (Pf + Pv) infection. 1.33 +/- 0.52, 0.435 +/- 0.035 sec and 9.77 +/- 1.34 mg/dl in uncomplicated falciparum malaria and 1.35 +/- 0.58, 0.403 +/- 0.019 sec and 9.68 +/- 0.99 mg/dl in vivax malaria. The difference was significant between complicated falciparum and mixed (Pf + Pv) infection when compared to uncomplicated falciparum and vivax malaria (p < 0.05).


Assuntos
Arritmias Cardíacas/fisiopatologia , Eletrocardiografia , Hipocalcemia/fisiopatologia , Malária Falciparum/fisiopatologia , Malária Vivax/fisiopatologia , Adolescente , Adulto , Idoso , Idoso de 80 Anos ou mais , Animais , Feminino , Humanos , Hipocalcemia/epidemiologia , Incidência , Malária Falciparum/complicações , Malária Falciparum/parasitologia , Malária Vivax/complicações , Malária Vivax/parasitologia , Masculino , Pessoa de Meia-Idade , Parasitemia/parasitologia , Plasmodium falciparum/isolamento & purificação , Plasmodium vivax/isolamento & purificação , Prognóstico
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA