Semi-automatic computed tomography angiography quantification assessment is an alternative method to digital subtraction angiography in intracranial stenosis: a multicenter study.

Background: The recent randomized controlled trials studying intracranial atherosclerotic stenosis (ICAS) have used digital subtraction angiography (DSA) to quantify stenosis and enroll patients. However, some disadvantages of DSA such as invasive features, contrast agent overuse, and X-ray radiation overexposure, were not considered in these studies. This study aimed to explore whether computed tomography angiography (CTA) with semi-automatic analysis could be an alternative method to DSA in quantifying the absolute stenotic degree in clinical trials. Methods: Patients with 50-99% ICAS were consecutively screened, prospectively enrolled, and underwent CTA and DSA between March 2021 and December 2021 at 6 centers. This study was registered at www.chictr.org.cn (ChiCTR2100052925). The absolute stenotic degree of ICAS on CTA with semi-automatic analysis was calculated by several protocols using minimal/maximum/mean diameters of stenosis and reference site from a semi-automatic analysis software. Intraclass correlation coefficient (ICC) was used to evaluate the reliabilities of quantifying stenotic degree on CTA. The optimal protocol for quantifying ICAS on CTA was explored. The agreements of quantifying ICAS in calcified or non-calcified lesions and 50-69% or 70-99% stenosis on CTA and DSA were assessed. Results: A total of 191 participants (58.8±10.7 years; 148 men) with 202 lesions were enrolled. The optimal protocol for quantifying ICAS on CTA was calculated as (1 - the minimal diameter of stenosis/the mean diameter of reference) × 100% for its highest agreement with DSA [ICC, 0.955, 95% confidence interval (CI): 0.944-0.966, P<0.001]. Among the 202 lesions, 80.2% (162/202) exhibited severe stenosis on DSA. The accuracy of CTA in detecting severe ICAS was excellent (sensitivity =95.1%, positive predictive value =98.1%). The agreements between DSA and CTA in non-calcified lesions (ICC, 0.960 vs. 0.849) and severe stenosis (ICC, 0.918 vs. 0.841) were higher than those in calcified lesions and moderate stenosis. Conclusions: CTA with semi-automatic analysis demonstrated an excellent agreement with DSA in quantifying ICAS, making it promising to replace DSA for the measurement of absolute stenotic degree in clinical trials.

The Protective Role of Magnoliae Flos in Preventing Ovotoxicity and Managing Ovarian Function: An In Vitro and In Vivo Study.

Magnoliae Flos (MF) is a medicinal herb widely employed in traditional medicine for relieving sinusitis, allergic rhinitis, headaches, and toothaches. Here, we investigated the potential preventive effects of MF extract (MFE) against 4-vinylcyclohexene diepoxide (VCD)-induced ovotoxicity in ovarian cells and a mouse model of premature ovarian insufficiency (POI). The cytoprotective effects of MFE were assessed using CHO-K1 or COV434 cells. In vivo, B6C3F1 female mice were intraperitoneally injected with VCD for two weeks to induce POI, while MFE was orally administered for four weeks, beginning one week before VCD administration. VCD led to a significant decline in the viabilities of CHO-K1 and COV434 cells and triggered excessive reactive oxygen species (ROS) production and apoptosis specifically in CHO-K1 cells. However, pretreatment with MFE effectively prevented VCD-induced cell death and ROS generation, while also activating the Akt signaling pathway. In vivo, MFE increased relative ovary weights, follicle numbers, and serum estradiol and anti-Müllerian hormone levels versus controls under conditions of ovary failure. Collectively, our results demonstrate that MFE has a preventive effect on VCD-induced ovotoxicity through Akt activation. These results suggest that MFE may have the potential to prevent and manage conditions such as POI and diminished ovarian reserve.

TL1A Promotes Fibrogenesis in Colonic Fibroblasts via the TGF-ß1/Smad3 Signaling Pathway.

OBJECTIVE: Intestinal fibrosis is a refractory complication of inflammatory bowel disease (IBD). Tumor necrosis factor ligand-related molecule-1A (TL1A) is important for IBD-related intestinal fibrosis in a dextran sodium sulfate (DSS)-induced experimental colitis model. This study aimed to explore the effects of TL1A on human colonic fibroblasts. METHODS: A trinitrobenzene sulfonic acid (TNBS)-induced experimental colitis model of LCK-CD2-TL1A-GFP transgenic (Tg) or wild-type (WT) mice was established to determine the effect and mechanism of TL1A on intestinal fibrosis. The human colonic fibroblast CCD-18Co cell line was treated concurrently with TL1A and human peripheral blood mononuclear cell (PBMC) supernatant. The proliferation and activation of CCD-18Co cells were detected by BrdU assays, flow cytometry, immunocytochemistry and Western blotting. Collagen metabolism was tested by Western blotting and real-time quantitative polymerase chain reaction (RT-qPCR). RESULTS: The level of collagen metabolism in the TNBS+ethyl alcohol (EtOH)/Tg group was greater than that in the TNBS+EtOH/WT group. Transforming growth factor-ß1 (TGF-ß1) and p-Smad3 in the TNBS+EtOH/Tg group were upregulated as compared with those in the TNBS+EtOH/WT group. The proliferation of CCD-18Co cells was promoted by the addition of human PBMC supernatant supplemented with 20 ng/mL TL1A, and the addition of human PBMC supernatant and TL1A increased CCD-18Co proliferation by 24.4% at 24 h. TL1A promoted cell activation and increased the levels of COL1A2, COL3A1, and TIMP-1 in CCD-18Co cells. Treatment of CCD-18Co cells with TL1A increased the expression of TGF-ß1 and p-Smad3. CONCLUSION: TL1A promotes TGF-ß1-mediated intestinal fibroblast activation, proliferation, and collagen deposition and is likely related to an increase in the TGF-ß1/Smad3 signaling pathway.

Curved carbon-plated shoe may further reduce forefoot loads compared to flat plate during running.

Using a curved carbon-fiber plate (CFP) in running shoes may offer notable performance benefit over flat plates, yet there is a lack of research exploring the influence of CFP geometry on internal foot loading during running. The objective of this study was to investigate the effects of CFP mechanical characteristics on forefoot biomechanics in terms of plantar pressure, bone stress distribution, and contact force transmission during a simulated impact peak moment in forefoot strike running. We employed a finite element model of the foot-shoe system, wherein various CFP configurations, including three stiffnesses (stiff, stiffer, and stiffest) and two shapes (flat plate (FCFP) and curved plate (CCFP)), were integrated into the shoe sole. Comparing the shoes with no CFP (NCFP) to those with CFP, we consistently observed a reduction in peak forefoot plantar pressure with increasing CFP stiffness. This decrease in pressure was even more notable in a CCFP demonstrating a further reduction in peak pressure ranging from 5.51 to 12.62%, compared to FCFP models. Both FCFP and CCFP designs had a negligible impact on reducing the maximum stress experienced by the 2nd and 3rd metatarsals. However, they greatly influenced the stress distribution in other metatarsal bones. These CFP designs seem to optimize the load transfer pathway, enabling a more uniform force transmission by mainly reducing contact force on the medial columns (the first three rays, measuring 0.333 times body weight for FCFP and 0.335 for CCFP in stiffest condition, compared to 0.373 in NCFP). We concluded that employing a curved CFP in running shoes could be more beneficial from an injury prevention perspective by inducing less peak pressure under the metatarsal heads while not worsening their stress state compared to flat plates.

Performance analysis of a liquid lens for laser ablation using OCT imaging.

Laser ablation has been used in different surgical procedures to perform precise treatments. Compared with previous free-beam laser delivery systems, flexible-optical-fiber-based systems can deliver laser energy to a curved space, avoiding the requirement of a straight working path to the target. However, the fiber tip maintains direct contact with the tissue to prevent laser divergence, resulting in fiber damage, uneven ablation, and tissue carbonization. Here, a liquid lens is used to address the problem of laser defocusing when radiating targets at different depths for flexible-optical-fiber-based systems. The liquid lens focuses a laser with a maximum power of 3 W onto a medium-density fiberboard at a focal length of 40-180 mm. The relationships between the ablation crater diameter and depth with the radiation time and laser power have been quantitatively evaluated through OCT (optical coherence tomography) imaging. Experiments demonstrate that the liquid lens can continuously focus the high-power laser to different depths, with the advantages of compact size, fast response, light weight, and easy operation. This study explores liquid-lens-based focused laser ablation, which can potentially improve the performance of future medical image-guided laser ablation.

Retracted: Osteoprotegerin (OPG) Promotes Recruitment of Endothelial Progenitor Cells (EPCs) via CXCR4 Signaling Pathway to Improve Bone Defect Repair.

The Editors of Medical Science Monitor wish to inform you that the above manuscript has been retracted from publication due to concerns with the credibility and originality of the study, the manuscript content, and the Figure images. Reference: Rongfeng Zhang, Jianwei Liu, Shengpeng Yu, Dong Sun, Xiaohua Wang, Jingshu Fu, Jie Shen, Zhao Xie. Osteoprotegerin (OPG) Promotes Recruitment of Endothelial Progenitor Cells (EPCs) via CXCR4 Signaling Pathway to Improve Bone Defect Repair. Med Sci Monit, 2019; 25: 5572-5579. DOI: 10.12659/MSM.916838.

Liposomal nanocarriers of preassembled glycocalyx restore normal venular permeability in sepsis: assessed quantitatively with a novel microchamber system.

BACKGROUND: The endothelial glycocalyx (EG), covering the luminal side of endothelial cells, regulates vascular permeability and senses wall shear stress. In sepsis, EG undergoes degradation leading to increased permeability and edema formation. We hypothesized that restoring EG integrity using liposomal nanocarriers of preassembled glycocalyx (LNPG) will restore normal venular permeability in a lipopolysaccharide (LPS)-induced sepsis model of mice. METHODS: To test this hypothesis, we designed a unique perfusion microchamber in which permeability of isolated venules could be assessed by measuring the concentration of Evans blue dye (EBD) in microliter-samples of extravascular solution (ES). RESULTS: Histamine-induced time- and dose-dependent increases in EBD in the ES could be measured, confirming the sensitivity of the microchamber system. Notably, the histamine-induced increase in permeability was significantly attenuated by histamine receptor (H1) antagonist, triprolidine hydrochloride. Subsequently, mice were treated with LPS, or LPS + LNPG. Compared to control mice, venules from LPS-treated mice showed a significant increased permeability, which was significantly reduced by LNPG administration. Moreover, in the presence of wall shear stress, intraluminal administration of LNPG significantly reduced the permeability in isolated venules from LPS-treated mice. We have found no sex differences. CONCLUSION: Our newly developed microchamber system allows us to quantitatively measure the permeability of isolated mesenteric venules. LPS-induced sepsis increases permeability of venules that is attenuated by in vivo LNPG administration, which is also reestablished endothelial responses to shear stress. Thus, LNPG presents a promising therapeutic potential for restoring EG function and thereby mitigating vasogenic edema due to increased permeability in sepsis.

Ocular surface changes in moderate-to-severe acne vulgaris.

AIM: To investigate ocular surface disorders and tear function changes in patients with acne vulgaris and explore the potential relationship between acne vulgaris and dry eye. METHODS: This cross-sectional study included right eyes of 53 patients with acne vulgaris and 54 healthy controls. The participants completed the Ocular Surface Disease Index (OSDI) questionnaire. The following ocular surface-related parameters were measured: tear meniscus height (TMH), noninvasive tear breakup time (NIBUT), Schirmer I test (SIT), lipid layer thickness (LLT) score of the tear film, meibum score, meibomian gland orifice obstruction score, the ratio of meibomian gland loss, conjunctival hyperemia score, and corneal fluorescein staining (CFS) score. RESULTS: The stability of the tear film decreased in acne vulgaris patients. In the acne group, the TMH and NIBUT were lower, whereas the OSDI, meibum score, meibomian gland orifice obstruction score, ratio of meibomian gland loss, and conjunctival hyperemia score were higher compared with controls (P<0.05). There were no significant differences in the CFS score, SIT, or LLT score between the groups (P>0.05). In two dry eye groups, the TMH, NIBUT, and LLT score were lower in the acne with dry eye (acne-DE) group, and the meibum score, meibomian gland orifice obstruction score, ratio of meibomian gland loss and conjunctival hyperemia score in the acne-DE group were higher (P<0.05). There were no significant differences between OSDI, SIT, and CFS score (P>0.05). CONCLUSION: Patients with moderate-to-severe acne vulgaris are more likely to experience dry eye than those without acne vulgaris. Reduced tear film stability and meibomian gland structure dysfunction are more pronounced in patients with moderate-to-severe acne and dry eye.

Multi-sequence MRI-based radiomics: An objective method to diagnose early-stage osteonecrosis of the femoral head.

OBJECTIVES: This study investigated the use of radiomics for diagnosing early-stage osteonecrosis of the femoral head (ONFH) by extracting features from multiple MRI sequences and constructing predictive models. MATERIALS AND METHODS: We conducted a retrospective review, collected MR images of early-stage ONFH (102 from institution A and 20 from institution B) and healthy femoral heads (102 from institution A and 20 from institution B) from two institutions. We extracted radiomics features, handled batch effects using Combat, and normalized features using z-score. We employed the Least absolute shrinkage and selection operator (LASSO) algorithm, along with Max-Relevance and Min-Redundancy (mRMR), to select optimal features for constructing radiomics models based on single, double, and multi-sequence MRI data. We evaluated performance using receiver operating characteristic (ROC) and precision-recall (PR) curves, and compared area under curve of ROC (AUC-ROC) values with the DeLong test. Additionally, we studied the diagnostic performance of the multi-sequence radiomics model and radiologists, compared the diagnostic outcomes of the model and radiologists using the Fisher exact test. RESULTS: We studied 122 early-stage ONFH and 122 normal femoral heads. The multi-sequence model exhibited the best diagnostic performance among all models (AUC-ROC, PR-AUC for training set: 0.96, 0.961; validation set: 0.96, 0.97; test set: 0.94, 0.94), and it outperformed three resident radiologists on the external testing group with an accuracy of 87.5 %, sensitivity of 85.00 %, and specificity of 90.00 % (p < 0.01), highlighting the robustness of our findings. CONCLUSIONS: Our study underscored the novelty of the multi-sequence radiomics model in diagnosing early-stage ONFH. By leveraging features extracted from multiple imaging sequences, this approach demonstrated high efficacy, indicating its potential to advance early diagnosis for ONFH. These findings provided important guidance for enhancing early diagnosis of ONFH through radiomics methods, offering new avenues and possibilities for clinical practice and patient care.

Excellent capacitive storage performance of N-doped porous carbon derived from the orientation-guidance coupled with in-situ activation methodology.

The orientation-guidance coupled with in-situ activation methodology is developed to synthesize the N-doped porous carbon (NPC) with well-developed porosity and high specific surface area, using coal pitch as a carbon precursor. The orientation-guidance and activation are dedicated to generating microporous and mesoporous channels, respectively. The in-situ N incorporation into the carbon skeleton is realized along with the formation of porous carbon (PC), ensuring the uniformity of N doping. As an electrode material of supercapacitor, benefiting from the robust hexagon-like building block decorated with micro-mesoporous channels and N doping, NPC electrode affords a significant improvement in capacitive energy-storage performance, achieving a specific capacitance of up to 333F g-1 at 1 A/g, which far exceeds those of PC and activated carbon. Notably, even under high mass loading of 10 mg cm-2, the NPC maintains a satisfactory capacitance of 258F g-1 at 1 A/g. When employed as the anode in Li-ion capacitor (LIC), apart from exhibiting enhanced anode behavior compared to graphite anode, NPC also delivers exceptional cyclability. Furthermore, density functional theory calculations have validated the enhanced electrical conductivity and Li storage ability contributed by N doping, providing a theoretical foundation for the observed improvements in electrochemical performance. A full LIC configured with NPC anode delivers extraordinary Ragone performance and outstanding cyclability. This work also proposes a feasible way to realize the oriented conversion of coal pitch into high-performance electrode materials for electrochemical energy-storage devices.

Differences in insomnia-related self-reported outcomes among elderly hospitalized patients.

BACKGROUND: Insomnia is among the most common sleep disorders worldwide. Insomnia in older adults is a social and public health problem. Insomnia affects the physical and mental health of elderly hospitalized patients and can aggravate or induce physical illnesses. Understanding subjective feelings and providing reasonable and standardized care for elderly hospitalized patients with insomnia are urgent issues. AIM: To explore the differences in self-reported outcomes associated with insomnia among elderly hospitalized patients. METHODS: One hundred patients admitted to the geriatric unit of our hospital between June 2021 and December 2021 were included in this study. Self-reported symptoms were assessed using the Athens Insomnia Scale (AIS), Generalized Anxiety Disorder Scale-7 (GAD-7), Geriatric Depression Scale-15 (GDS-15), Memorial University of Newfoundland Scale of Happiness (MUNSH), Barthel Index Evaluation (BI), Morse Fall Scale (MFS), Mini-Mental State Examination, and the Short Form 36 Health Survey Questionnaire (SF-36). Correlation coefficients were used to analyze the correlation between sleep quality and self-reported symptoms. Effects of insomnia was analyzed using Logistic regression analysis. RESULTS: Nineteen patients with AIS ≥ 6 were included in the insomnia group, and the incidence of insomnia was 19% (19/100). The remaining 81 patients were assigned to the non-insomnia group. There were significant differences between the two groups in the GDA-7, GDS-15, MUNSH, BI, MFS, and SF-36 items (P < 0.05). Patients in the insomnia group were more likely to experience anxiety, depression, and other mental illnesses, as well as difficulties with everyday tasks and a greater risk of falling (P < 0.05). Subjective well-being and quality of life were poorer in the insomnia group than in the control group. The AIS scores positively correlated with the GAD-7, GDS-15, and MFS scores in elderly hospitalized patients with insomnia (P < 0.05). Logistic regression analysis showed that GDS-15 ≥ 5 was an independent risk factor for insomnia in elderly hospitalized patients (P < 0.05). CONCLUSION: The number of self-reported symptoms was higher among elderly hospitalized patients with insomnia. Therefore, we should focus on the main complaints of patients to meet their care needs.

Alzheimer-like behavior and synaptic dysfunction in 3 × Tg-AD mice are reversed with calcineurin inhibition.

Alzheimer's disease is a progressive neurodegenerative disorder characterized by impairments in synaptic plasticity and cognitive performance. Current treatments are unable to achieve satisfactory therapeutic effects or reverse the progression of the disease. Calcineurin has been implicated as part of a critical signaling pathway for learning and memory, and neuronal calcineurin may be hyperactivated in AD. To investigate the effects and underlying mechanisms of FK506, a calcineurin inhibitor, on Alzheimer-like behavior and synaptic dysfunction in the 3 × Tg-AD transgenic mouse model of Alzheimer's disease, we investigated the effect of FK506 on cognitive function and synaptic plasticity in the 3 × Tg-AD transgenic mouse model of Alzheimer's disease. The results showed that FK506 treatment ameliorated cognitive deficits, as indicated by the decreased latency in the water maze, and attenuated tau hyperphosphorylation in 3 × Tg-AD mice. Treatment with FK506 also reduced the levels of certain markers of postsynaptic deficits, including PSD-95 and NR2B, and reversed the long-term potentiation deficiency and dendritic spine impairments in 3 × Tg-AD mice. These findings suggest that treatment with calcineurin inhibitors such as FK506 can be an effective therapeutic strategy to rescue synaptic deficit and cognitive impairment in familial Alzheimer's disease and related tauopathies.

Duhamel and transanal endorectal pull-throughs for Hirschsprung disease: a Bayesian network meta-analysis.

BACKGROUND: To comprehensively compare the effects of open Duhamel (OD), laparoscopic-assisted Duhamel (LD), transanal endorectal pull-through (TEPT), and laparoscopic-assisted endorectal pull-through (LEPT) in Hirschsprung disease. METHODS: PubMed, Embase, Cochrane Library, Web of Science, CNKI, WanFang, and VIP were comprehensively searched up to August 4, 2022. The outcomes were operation-related indicators and complication-related indicators. The Grading of Recommendations Assessment, Development and Evaluation (GRADE) approach was used to evaluate the quality of evidence. Network plots, forest plots, league tables and rank probabilities were drawn for all outcomes. For measurement data, weighted mean differences (WMDs) and 95% credibility intervals (CrIs) were reported; for enumeration data, relative risks (RRs) and 95%CrIs were calculated. RESULTS: Sixty-two studies of 4781 patients were included, with 2039 TEPT patients, 1669 LEPT patients, 951 OD patients and 122 LD patients. Intraoperative blood loss in the OD group was more than that in the LEPT group (pooled WMD = 44.00, 95%CrI: 27.33, 60.94). Patients lost more blood during TEPT versus LEPT (pooled WMD = 13.08, 95%CrI: 1.80, 24.30). In terms of intraoperative blood loss, LEPT was most likely to be the optimal procedure (79.76%). Patients undergoing OD had significantly longer gastrointestinal function recovery time, as compared with those undergoing LEPT (pooled WMD = 30.39, 95%CrI: 16.08, 44.94). The TEPT group had significantly longer gastrointestinal function recovery time than the LEPT group (pooled WMD = 11.49, 95%CrI: 0.96, 22.05). LEPT was most likely to be the best operation regarding gastrointestinal function recovery time (98.28%). Longer hospital stay was observed in patients with OD versus LEPT (pooled WMD = 5.24, 95%CrI: 2.98, 7.47). Hospital stay in the TEPT group was significantly longer than that in the LEPT group (pooled WMD = 1.99, 95%CrI: 0.37, 3.58). LEPT had the highest possibility to be the most effective operation with respect to hospital stay. The significantly reduced incidence of complications was found in the LEPT group versus the LD group (pooled RR = 0.24, 95%CrI: 0.12, 0.48). Compared with LEPT, OD was associated with a significantly increased incidence of complications (pooled RR = 5.10, 95%CrI: 3.48, 7.45). Patients undergoing TEPT had a significantly greater incidence of complications than those undergoing LEPT (pooled RR = 1.98, 95%CrI: 1.63, 2.42). For complications, LEPT is most likely to have the best effect (99.99%). Compared with the LEPT group, the OD group had a significantly increased incidence of anastomotic leakage (pooled RR = 5.35, 95%CrI: 1.45, 27.68). LEPT had the highest likelihood to be the best operation regarding anastomotic leakage (63.57%). The incidence of infection in the OD group was significantly higher than that in the LEPT group (pooled RR = 4.52, 95%CrI: 2.45, 8.84). The TEPT group had a significantly increased incidence of infection than the LEPT group (pooled RR = 1.87, 95%CrI: 1.13, 3.18). LEPT is most likely to be the best operation concerning infection (66.32%). Compared with LEPT, OD was associated with a significantly higher incidence of soiling (pooled RR = 1.91, 95%CrI: 1.16, 3.17). Patients with LEPT had the greatest likelihood not to develop soiling (86.16%). In contrast to LD, LEPT was significantly more effective in reducing the incidence of constipation (pooled RR = 0.39, 95%CrI: 0.15, 0.97). LEPT was most likely not to result in constipation (97.81%). LEPT was associated with a significantly lower incidence of Hirschprung-associated enterocolitis (HAEC) than LD (pooled RR = 0.34, 95%CrI: 0.13, 0.85). The OD group had a significantly higher incidence of HAEC than the LEPT group (pooled RR = 2.29, 95%CrI: 1.31, 4.0). The incidence of HAEC was significantly greater in the TEPT group versus the LEPT group (pooled RR = 1.74, 95%CrI: 1.24, 2.45). LEPT was most likely to be the optimal operation in terms of HAEC (98.76%). CONCLUSION: LEPT may be a superior operation to OD, LD and TEPT in improving operation condition and complications, which might serve as a reference for Hirschsprung disease treatment.

Muscle ultrasound to identify prednisone-induced muscle damage in adults with nephrotic syndrome.

Steroid myopathy is a non-inflammatory toxic myopathy that primarily affects the proximal muscles of the lower limbs. Due to its non-specific symptoms, it is often overshadowed by patients' underlying conditions. Prolonged or high-dosage use of glucocorticoids leads to a gradual decline in muscle mass. There are no tools available to identify the course of steroid myopathy before the patient displays substantial clinical symptoms. In this study, we investigated individuals with nephrotic syndrome receiving prednisone who underwent muscle ultrasound to obtain cross-sectional and longitudinal pictures of three major proximal muscles in the lower limbs: the vastus lateralis, tibialis anterior, and medial gastrocnemius muscles. Our findings revealed that grip strength was impaired in the prednisolone group, creatine kinase levels were reduced within the normal range; echo intensity of the vastus lateralis and medial gastrocnemius muscles was enhanced, the pennation angle was reduced, and the tibialis anterior muscle exhibited increased echo intensity and decreased thickness. The total dose of prednisone and the total duration of treatment impacted the degree of muscle damage. Our findings indicate that muscle ultrasound effectively monitors muscle structure changes in steroid myopathy. Combining clinical symptoms, serum creatine kinase levels, and grip strength improves the accuracy of muscle injury evaluation.

Albumin-to-alkaline phosphatase ratio as a novel prognostic indicator in patients undergoing peritoneal dialysis: a propensity score matching analysis.

Background: Though the albumin-to-alkaline phosphatase ratio (AAPR) is used as a biomarker in various diseases, little is known about its effect on outcomes after peritoneal dialysis (PD). Methods: This multicenter retrospective study comprised 357 incident PD patients stratified according to the AAPR. Propensity score matching (PSM) was performed to identify 85 patients for a well-matched comparison of all-cause and cardiovascular mortality. Using Cox regression, we performed univariate and multivariate analyses to investigate the prognostic value of the AAPR and established a Kaplan-Meier curve-predicted nomogram to estimate expected overall survival (OS). We assessed the predictive accuracy using the concordance index (c-index). Results: We found that the optimal cut-off of the AAPR to predict mortality was 0.36. In the present cohort of patients undergoing PD, a low AAPR strongly correlated with worse OS. In the multivariate analysis, the AAPR was shown to be an independent marker predicting reduced OS both before [hazard ratio (HR) 1.68, 95% confidence interval (CI) 1.08-2.60, P = 0.020] and after PSM (HR 1.96, 95% CI 1.06-3.62, P = 0.020). We also observed significant differences in OS in several subgroups, but not the group of patients with comorbidities. A nomogram was established to predict overall survival, with a c-index for prediction accuracy was 0.71 after PSM. Conclusion: AAPR has potential as an independent prognostic biomarker in patients undergoing PD.

Identification of novel variations in three cases with rare inherited neuromuscular disorder.

Inherited neuromuscular disorder (IND) is a broad-spectrum, clinically diverse group of diseases that are caused due to defects in the neurosystem, muscles and related tissue. Since IND may originate from mutations in hundreds of different genes, the resulting heterogeneity of IND is a great challenge for accurate diagnosis and subsequent management. Three pediatric cases with IND were enrolled in the present study and subjected to a thorough clinical examination. Next, a genetic investigation was conducted using whole-exome sequencing (WES). The suspected variants were validated through Sanger sequencing or quantitative fluorescence PCR assay. A new missense variant of the Spastin (SPAST) gene was found and analyzed at the structural level using molecular dynamics (MD) simulations. All three cases presented with respective specific clinical manifestations, which reflected the diversity of IND. WES detected the diagnostic variants in all 3 cases: A compound variation comprising collagen type VI α3 chain (COL6A3) (NM_004369; exon19):c.6322G>T(p.E1208*) and a one-copy loss of COL6A3:exon19 in Case 1, which are being reported for the first time; a de novo SPAST (NM_014946; exon8):c.1166C>A(p.T389K) variant in Case 2; and a de novo Duchenne muscular dystrophy (NM_004006; exon11):c.1150-17_1160delACTTCCTTCTTTGTCAGGGGTACATGATinsC variant in Case 3. The structural and MD analyses revealed that the detected novel SPAST: c.1166C>A(p.T389K) variant mainly altered the intramolecular hydrogen bonding status and the protein segment's secondary structure. In conclusion, the present study expanded the IND mutation spectrum. The study not only detailed the precise diagnoses of these cases but also furnished substantial grounds for informed consultations. The approach involving the genetic evaluation strategy using WES for variation screening followed by validation using appropriate methods is beneficial due to the considerable heterogeneity of IND.

Noninvasive therapy of brain cancer using a unique systemic delivery methodology with a cancer terminator virus.

Primary, glioblastoma, and secondary brain tumors, from metastases outside the brain, are among the most aggressive and therapeutically resistant cancers. A physiological barrier protecting the brain, the blood-brain barrier (BBB), functions as a deterrent to effective therapies. To enhance cancer therapy, we developed a cancer terminator virus (CTV), a unique tropism-modified adenovirus consisting of serotype 3 fiber knob on an otherwise Ad5 capsid that replicates in a cancer-selective manner and simultaneously produces a potent therapeutic cytokine, melanoma differentiation-associated gene-7/interleukin-24 (MDA-7/IL-24). A limitation of the CTV and most other viruses, including adenoviruses, is an inability to deliver systemically to treat brain tumors because of the BBB, nonspecific virus trapping, and immune clearance. These obstacles to effective viral therapy of brain cancer have now been overcome using focused ultrasound with a dual microbubble treatment, the focused ultrasound-double microbubble (FUS-DMB) approach. Proof-of-principle is now provided indicating that the BBB can be safely and transiently opened, and the CTV can then be administered in a second set of complement-treated microbubbles and released in the brain using focused ultrasound. Moreover, the FUS-DMB can be used to deliver the CTV multiple times in animals with glioblastoma  growing in their brain thereby resulting in a further enhancement in survival. This strategy permits efficient therapy of primary and secondary brain tumors enhancing animal survival without promoting harmful toxic or behavioral side effects. Additionally, when combined with a standard of care therapy, Temozolomide, a further increase in survival is achieved. The FUS-DMB approach with the CTV highlights a noninvasive strategy to treat brain cancers without surgery. This innovative delivery scheme combined with the therapeutic efficacy of the CTV provides a novel potential translational therapeutic approach for brain cancers.

Pharmacokinetic/Pharmacodynamic Assessment of the Structural Refinement of Clopidogrel Focusing on the Balance between Bioactivation and Deactivation.

The delicate balance between ischemic and bleeding risks is a critical factor in antiplatelet therapy administration. Clopidogrel and prasugrel, belonging to the thienopyridine class of antiplatelet drugs, are known for their variability in individual responsiveness and high incidence of bleeding events, respectively. The present study is centered on the development and assessment of a range of deuterated thienopyridine derivatives, leveraging insights from structure-pharmacokinetic relationships of clopidogrel and prasugrel. Our approaches were grounded in the molecular framework of clopidogrel and incorporated the C2-pharmacophore design from prasugrel. The selection of ester or carbamate substituents at the C2-position facilitated the generation of the 2-oxointermediate through hydrolysis, akin to prasugrel, thereby bypassing the issue of CYP2C19 dependency. The bulky C2-pharmacophore in our approach distinguishes itself from prasugrel's acetyloxy substituent by exhibiting a moderated hydrolysis rate, resulting in a more gradual formation of the active metabolite. Excessive and rapid release of the active metabolite, believed to be linked with an elevated risk of bleeding, is thus mitigated. Our proposed structural modification retains the hydrolysis-sensitive methyl ester of clopidogrel but substitutes it with a deuterated methyl group, shown to effectively reduce metabolic deactivation. Three promising compounds demonstrated a pharmacokinetic profile similar to that of clopidogrel at four times the dose, while also augmenting its antiplatelet activity. SIGNIFICANCE STATEMENT: Inspired by the structure-pharmacokinetic relationship of clopidogrel and prasugrel, a range of clopidogrel derivatives were designed, synthesized, and assessed. Among them, three promising compounds have been identified, striking a delicate balance between efficacy and safety for antiplatelet therapy. Additionally, the ozagrel prodrug conjugate was discovered to exert a synergistic therapeutic effect alongside clopidogrel.

Molecular Characterization of Non-H5 and Non-H7 Avian Influenza Viruses from Non-Mallard Migratory Waterbirds of the North American Flyways, 2006-2011.

The surveillance of migratory waterbirds (MWs) for avian influenza virus (AIV) is indispensable for the early detection of a potential AIV incursion into poultry. Surveying AIV infections and virus subtypes in understudied MW species could elucidate their role in AIV ecology. Oropharyngeal-cloacal (OPC) swabs were collected from non-mallard MWs between 2006 and 2011. OPC swabs (n = 1158) that molecularly tested positive for AIV (Cts ≤ 32) but tested negative for H5 and H7 subtypes were selected for virus isolation (VI). The selected samples evenly represented birds from all four North American flyways (Pacific, Central, Mississippi, and Atlantic). Eighty-seven low pathogenic AIV isolates, representing 31 sites in 17 states, were recovered from the samples. All isolates belonged to the North American lineage. The samples representing birds from the Central Flyway had the highest VI positive rate (57.5%) compared to those from the other flyways (10.3-17.2%), suggesting that future surveillance can focus on the Central Flyway. Of the isolates, 43.7%, 12.6%, and 10.3% were obtained from blue-winged teal, American wigeon, and American black duck species, respectively. Hatch-year MWs represented the majority of the isolates (70.1%). The most common H and N combinations were H3N8 (23.0%), H4N6 (18.4%), and H4N8 (18.4%). The HA gene between non-mallard and mallard MW isolates during the same time period shared 85.5-99.5% H3 identity and 89.3-99.7% H4 identity. Comparisons between MW (mallard and non-mallard) and poultry H3 and H4 isolates also revealed high similarity (79.0-99.0% and 88.7-98.4%), emphasizing the need for continued AIV surveillance in MWs.

Gut microbially produced tryptophan metabolite melatonin ameliorates osteoporosis via modulating SCFA and TMAO metabolism.

Osteoporosis (OP) is a severe global health issue that has significant implications for productivity and human lifespan. Gut microbiota dysbiosis has been demonstrated to be closely associated with OP progression. Melatonin (MLT) is an important endogenous hormone that modulates bone metabolism, maintains bone homeostasis, and improves OP progression. Multiple studies indicated that MLT participates in the regulation of intestinal microbiota and gut barrier function. However, the promising effects of gut microbiota-derived MLT in OP remain unclear. Here, we found that OP resulted in intestinal tryptophan disorder and decreased the production of gut microbiota-derived MLT, while administration with MLT could mitigate OP-related clinical symptoms and reverse gut microbiota dysbiosis, including the diversity of intestinal microbiota, the relative abundance of many probiotics such as Allobaculum and Parasutterella, and metabolic function of intestinal flora such as amino acid metabolism, nucleotide metabolism, and energy metabolism. Notably, MLT significantly increased the production of short-chain fatty acids and decreased trimethylamine N-oxide-related metabolites. Importantly, MLT could modulate the dynamic balance of M1/M2 macrophages, reduce the serum levels of pro-inflammatory cytokines, and restore gut-barrier function. Taken together, our results highlighted the important roles of gut microbially derived MLT in OP progression via the "gut-bone" axis associated with SCFA metabolism, which may provide novel insight into the development of MLT as a promising drug for treating OP.