Identification of novel variations in three cases with rare inherited neuromuscular disorder.

Inherited neuromuscular disorder (IND) is a broad-spectrum, clinically diverse group of diseases that are caused due to defects in the neurosystem, muscles and related tissue. Since IND may originate from mutations in hundreds of different genes, the resulting heterogeneity of IND is a great challenge for accurate diagnosis and subsequent management. Three pediatric cases with IND were enrolled in the present study and subjected to a thorough clinical examination. Next, a genetic investigation was conducted using whole-exome sequencing (WES). The suspected variants were validated through Sanger sequencing or quantitative fluorescence PCR assay. A new missense variant of the Spastin (SPAST) gene was found and analyzed at the structural level using molecular dynamics (MD) simulations. All three cases presented with respective specific clinical manifestations, which reflected the diversity of IND. WES detected the diagnostic variants in all 3 cases: A compound variation comprising collagen type VI α3 chain (COL6A3) (NM_004369; exon19):c.6322G>T(p.E1208*) and a one-copy loss of COL6A3:exon19 in Case 1, which are being reported for the first time; a de novo SPAST (NM_014946; exon8):c.1166C>A(p.T389K) variant in Case 2; and a de novo Duchenne muscular dystrophy (NM_004006; exon11):c.1150-17_1160delACTTCCTTCTTTGTCAGGGGTACATGATinsC variant in Case 3. The structural and MD analyses revealed that the detected novel SPAST: c.1166C>A(p.T389K) variant mainly altered the intramolecular hydrogen bonding status and the protein segment's secondary structure. In conclusion, the present study expanded the IND mutation spectrum. The study not only detailed the precise diagnoses of these cases but also furnished substantial grounds for informed consultations. The approach involving the genetic evaluation strategy using WES for variation screening followed by validation using appropriate methods is beneficial due to the considerable heterogeneity of IND.

Functional assessment of a novel biallelic MYH3 variation causing CPSKF1B (contractures, pterygia, and spondylocarpotarsal fusion syndrome1B).

BACKGROUND: The MYH3-associated myosinopathies comprise a spectrum of rare neuromuscular disorders mainly characterized by distal arthrogryposis with or without other features like pterygia and vertebrae fusion. CPSKF1B (contractures, pterygia, and spondylocarpotarsal fusion syndrome1B) is the only known autosomal recessiveMYH3-associated myosinopathy so far, with no more than two dozen cases being reported. MATERIALS AND METHODS: A boy with CPSKF1B was recruited and subjected to a comprehensive clinical and imaging evaluation. Genetic detection with whole-exome sequencing (WES) was performed on the patient and extended family members to identify the causative variation. A series of in silico and in vitro investigations were carried out to verify the pathogenicity of the two variants of the identified compound heterozygous variation. RESULTS: The patient exhibited moderate CPSKF1B symptoms including multiarticular contractures, webbed neck, and spondylocarpotarsal fusion. WES detected a compound heterozygous MYH3 variation consisting of two variants, namely NM_002470.4: c.3377A>G; p. (E1126G) and NM_002470.4: c.5161-2A>C. It was indicated that the NM_002470.4: c.3377A>G; p. (E1126G) variant mainly impaired the local hydrogen bond formation and impacted the TGF-B pathway, while the NM_002470.4: c.5161-2A>C variant could affect the normal splicing of pre-mRNA, resulting in the appearance of multiple abnormal transcripts. CONCLUSIONS: The findings of this study expanded the mutation spectrum of CPSKF1B, provided an important basis for the counseling of the affected family, and also laid a foundation for the functional study of MYH3 mutations.

RBM25 induces trophoblast epithelial-mesenchymal transition and preeclampsia disorder by enhancing the positive feedback loop between Grhl2 and RBM25.

Defects in migration and invasion caused by dysregulation of trophoblast epithelial-mesenchymal transformation (EMT) are one of the key factors in the pathogenesis of preeclampsia (PE). RNA-binding motif protein 25 (RBM25) is an RNA-binding protein involved in a variety of cellular processes, including cell proliferation, apoptosis, cell migration and invasion, and EMT. However, the expression and function of RBM25 in placental of PE remain unclear. In this study, we reveal that the expression of RBM25 is significantly elevated in PE placental tissue. RBM25 depletion and over-expression in trophoblast cells increase and decrease, respectively, cell migration and invasion by regulating EMT marker E-cadherin and Vimentin expression. Mechanistically, Grhl2 is involved in RBM25-regulated trophoblast cell migration, invasion, and EMT through RBM25-facilitated mRNA stabilization. Furthermore, the upregulation of Grhl2 enhances the expression of RBM25 through transcription and forms a positive feedback regulation in the progression of PE. These findings suggest that upregulation of RBM25 induces dysregulation of trophoblast EMT by enhancing positive feedback regulation of Grhl2 and RBM25, leading to defects in cell migration and invasion. Targeting this newly identified regulatory axis may provide benefits in the prevention and treatment of PE.

Association of vascular endothelial growth factor gene polymorphisms with susceptibility to epithelial ovarian cancer.

BACKGROUND: Vascular endothelial growth factor (VEGF) is a major angiogenic factor involved in a number of pathological processes, including neovascularization, a crucial step in the development of solid malignancies. The aim of this study was to investigate the association of polymorphisms in the VEGF gene with susceptibility to epithelial ovarian cancer (EOC). METHODS: This case-control study included 303 EOC patients and 303 healthy controls. Genotyping of the VEGF gene polymorphisms at j460C/T, j1154G/A, j2578C/A, and +936C/T were performed by polymerase chain reaction and restriction fragment length polymorphism analysis. RESULTS: No significant difference was found in allele and genotype distributions of the -460C/T, +936C/T, and -2578C/A polymorphisms between patients and controls. However, the frequencies of -1154G/A genotype and allele were significantly different between the two groups (P = 0.037, P = 0.013). Compared with the G/A + A/A genotype, the G/G genotype could significantly increase the risk of developing EOC (odds ratio, 1.64; 95% confidence interval, 1.12Y2.39). The haplotype analysis suggested that the -460T/ -1154A/ -2578C haplotype exhibited a decrease in the risk of developing EOC compared with the -460T/ -1154G/ -2578C haplotype (odds ratio, 0.644; 95% confidence interval, 0.415-0.999). CONCLUSIONS: The study suggested a possible association between the VEGF -1154G/A polymorphism with susceptibility to EOC, but there is no support for an association of the VEGF -460C/T, +936C/T, and -2578C/A polymorphisms with the risk for EOC.

Polymorphisms in promoter region of FAS and FASL gene and risk of cardia gastric adenocarcinoma.

BACKGROUND AND AIM: The FAS and FASL system play an important role in regulating apoptotic cell death. This study was designed to investigate the correlation of FAS-1377 G/A, -670 A/G and FASL-844 T/C polymorphisms with susceptibility to gastric cardiac adenocarcinoma in a population of a high-incidence region of Hebei Province. METHODS: FAS-1377 G/A, -670 A/G and FASL-844 T/C polymorphisms were genotyped by polymerase chain reaction-restriction fragment length polymorphism analysis in 262 gastric cardiac carcinoma (GCA) patients and 524 healthy controls. RESULTS: Family history of upper gastrointestinal cancer (UGIC) might increase the risk of developing GCA (age- and sex-adjusted odds ratio [OR] = 1.38, 95% confidence interval [CI] = 1.02-1.86). The overall allelotype and genotype distributions of FAS-1377 G/A, and FASL-844 T/C polymorphisms in GCA patients did not significantly differ from that in healthy controls (P > 0.05). Compared with individuals with a FAS-670 A/A genotype, individuals with an A/G genotype in a smoker group had a lower risk of developing GCA (age, sex, and family history of UGIC adjusted OR = 0.55, 95% CI = 0.34-0.88). When the genotypes of FAS and FASL single nucleotide polymorphisms (SNP) were combined to analyze, no significant correlation was found between these SNP and the risk for GCA development. CONCLUSION: In the high-incidence region of Hebei Province, FAS-1377 G/A and FASL-844 T/C polymorphisms were not associated with the risk of GCA. However, the FAS-670 A/G genotype might decrease the risk of GCA for smoker individuals.

Association of functional polymorphisms in MMPs genes with gastric cardia adenocarcinoma and esophageal squamous cell carcinoma in high incidence region of North China.

The aim of the present study was to investigate the association of single nucleotide polymorphisms (SNPs) in matrix metalloproteinase (MMPs) with the risk of gastric cardia adenocarcinoma (GCA) and esophageal squamous cell carcinoma (ESCC). Genotypes were analyzed by polymerase chain reaction-restriction fragment-length polymorphism method in 592 patients and 624 healthy individuals. Significant differences in allele and genotype distributions of MMP-2 -1306C --> T SNP were observed between ESCC and controls (P = 0.02 and 0.01, respectively). Compared with the C/T + T/T genotypes, C/C genotype significantly increased the risk of ESCC (OR = 1.57, 95% CI = 1.10-2.23), especially in individuals in smoker group and in the group with positive family history. The stratification analysis showed there were risk changes of GCA for -735C/C genotype carrier in nonsmoker, for MMP-12 -82G allele and MMP-13 -77A/G genotype carrier in smoker. Our study indicated that these four functional polymorphisms might play roles in developing ESCC and GCA in high incidence region of North China.

[CDH1 polymorphism and its association with the risk of cervical cancer].

OBJECTIVE: To investigate the effect of CDH1 3'-UTR + 54C/T single nucleotide polymorphism (SNP) on expression of luciferase reporter gene and its association with susceptibility to cervical cancer. METHODS: The luciferase gene expression vectors containing CDH1 3'-UTR+54C/T SNP C or T allelotype were constructed. The effect of CDH1 3'-UTR+54C/T SNP on expression of luciferase reporter gene in 293 T cells were tested by daul luciferase reporter assay system. The CDH1 3'-UTR+54C/T SNP was genotyped by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis in 280 cervical cancer patients and 330 healthy controls. RESULTS: The luciferase activity analysis showed that the relative luciferase activity (RLA) of 293T cells with C allelotype was 1.46, which was significantly lower than that of the 293 T cells with T allelotype (3.01; t = 2.94, P = 0.042). There was no significant difference in age distribution between the cervical cancer patients and the healthy controls. The genotype frequency distribution of CDH1 3'-UTR+54C/T SNP in healthy controls did not significantly differ from that expected by Hardy-Weinberg equilibrium (P > 0.05). The C allelotype frequency of CDH1 in cervical cancer patients was 80.%, which was significantly higher than that in healthy controls (74.5%; chi2 = 6.59, P = 0.010). The T/T, T/C and C/C genotype frequencies of cervical cancer patients and healthy controls were 4.3%, 30.0%, 65.7% and 5.8%, 39.4%, 54.8%, respectively, which were significantly different (chi2 = 7.45, P = 0.024). Compared with individuals with T/T or T/C genotype, individuals with C/C genotype had significantly higher risks of developing cervical cancer (OR = 1.578, 95% CI = 1.136 - 2.191). CONCLUSION: The C allelotype of CDH1 3'-UTR + 54C/T SNP might decrease the expression of luciferase reporter gene and the C/C genotype might be a potential risk for cervical cancer development

Association of p73 and MDM2 polymorphisms with the risk of epithelial ovarian cancer in Chinese women.

OBJECTIVE: This study was to investigate the association of p73 G4C14-to-A4T14 and Murine Double Minute2 (MDM2) 309T/G, Del1518+/- single nucleotide polymorphisms with the risk of epithelial ovarian cancer (EOC) in Chinese. MATERIALS AND METHODS: This hospital-based case-control study included 257 ovarian cancer patients and 257 healthy women who were matched for age. p73 and MDM2 genotypes were determined by polymerase chain reaction-restriction fragment length polymorphism. RESULTS: There were no significant differences in allele frequencies and genotype distributions of the p73 G4C14-to-A4T14 polymorphism between cases and control women (P = 0.55 and 0.20, respectively). The frequencies of the G allele of the MDM2 309T/G polymorphism were significantly lower in ovarian cancer cases (46.7%) than those in healthy controls (54.7%), there was a statistical difference between the 2 groups (P = 0.01). Compared with the T/T genotype, the G allelotype (T/G+G/G genotype) significantly decreased the risk of developing EOC (odds ratio, 0.65; 95% confidence interval, 0.44-0.97). Although MDM2 Del1518+/- genotypes and allele frequencies did not differ between the case and the control groups (P = 0.68 and P = 0.45), Del1518 +/+ genotype tended to increase the risk of mucinous ovarian cancer or earlier ovarian cancer by stratification analysis according to histological subtypes or clinical stage. Besides, there was a significant interaction between p73 G4C14-to-A4T14 and MDM2 309T/G polymorphisms by the likelihood ratio test (P = 0.03; odds ratio, 0.89; 95% confidence interval, 0.80-0.99). CONCLUSION: The MDM2 SNP309G allele significantly decreased the risk of EOC and might be a potentially protective factor for EOC development in Chinese women.

Association of polymorphisms -1154G/A and -2578C/A in the vascular endothelial growth factor gene with decreased risk of endometriosis in Chinese women.

BACKGROUND: Vascular endothelial growth factor (VEGF) plays an important role in the development of endometriosis. The aim of this study was to investigate the association of polymorphisms in the VEGF gene with the susceptibility to endometriosis. METHODS: This study comprised 344 North Chinese women with endometriosis and 360 healthy women without endometriosis recruited as control. Genotyping of the VEGF gene polymorphisms at -460C/T, -1154G/A, -2578C/A and +936C/T were performed by PCR and restriction fragment length polymorphism analysis. RESULTS: No significant difference was found in allele and genotype distributions of the -460C/T, +936C/T polymorphisms between patients and controls. However, the frequencies of -1154G/A, -2578C/A genotype and allele were significantly different between the two groups (all P-value <0.013). The -2578A/A, -1154A/A genotypes were found less frequently in patients with endometriosis compared with controls. The haplotype distributions derived from three polymorphisms (-2578C/A, -1154G/A, -460C/T) differed between the two groups (P = 0.000). CONCLUSIONS: The VEGF-460/-1154/-2578 TGC, CAA, TAA and TAC haplotypes were associated with endometriosis. The -1154A and -2578A alleles may be protective against the development of endometriosis in North Chinese women.

[Association of single nucleotide polymorphisms in VEGF gene with the risk of endometriosis and adenomyosis].

OBJECTIVE: To investigate the association of single nucleotide polymorphisms (SNPs) in VEGF gene with the risk of endometriosis and adenomyosis. METHODS: Genotypes were analyzed by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method in 344 endometriosis patients, 174 adenomyosis patients, 360 frequency-matched control women of endometriosis and 199 frequency-matched control women of adenomyosis. RESULTS: No significant difference was found in allele frequencies and genotype distributions of the -460C/T polymorphism between patients (endometriosis and adenomyosis) and control women (all P value > 0.05). However, there were significant differences in genotype and allele distributions of the VEGF -1154G/A polymorphism between patients (endometriosis and adenomyosis) and control women (all P value < 0.05). The genotype frequencies of the VEGF -1154 AA, GA, and GG in endometriosis patients and control women were 1.7%, 28.8%, 69.5% and 5.8%, 32.8%, 61.4%, respectively; and the A and G allele frequencies in the two groups were 16.1%, 83.9% and 22.2%, 77.8%, respectively. The genotype frequencies of the VEGF -1154 AA, GA, and GG in adenomyosis patients and control women were 2.9%, 23.6%, 73.6% and 7.0%, 34.2%, 58.8%, respectively; and the A and G allele frequencies in the two groups were 14.7%, 85.3% and 24.1%, 75.9% respectively. Compared with GA+ AA genotype, GG genotypes could significantly increase the risk of endometriosis (OR:1.43,95%CI:1.05-1.96) and adenomyosis (OR:1.95,95%CI:1.26-3.03). CONCLUSION: The VEGF -1154G/A polymorphism was associated with susceptibility to endometriosis and adenomyosis, and the GG genotype could significantly increase the risk of developing endometriosis and adenomyosis. However, the VEGF -460C/T polymorphism was not associated with susceptibility to endometriosis and adenomyosis in the population studied.

The functional polymorphisms on promoter region of matrix metalloproteinase-12, -13 genes may alter the risk of epithelial ovarian carcinoma in Chinese.

BACKGROUNDS AND AIMS: Growing evidences indicate that single nucleotide polymorphisms (SNPs) of matrix metalloproteinases (MMPs) gene promoter may alter MMPs protein expression levels to influence malignant tumors developing and progressing. Our study was to assess the effects of the SNPs in the promoter region of MMP-12 and MMP-13 on the risk of epithelial ovarian carcinoma (EOC) developing and progressing. METHODS: MMP-12 A-82G and MMP-13 A-77G SNPs were genotyped by polymerase chain reaction-restriction fragment length polymorphism in 256 EOC patients and 329 controls. RESULTS: The A/G genotype frequency of MMP-12 was significantly higher in patients than in controls (7.0% vs 3.3%, P = 0.04); similarly, the frequency of MMP-12 82G allele was higher in patients too (P = 0.04). Compared with A/A genotype, A/G genotype significantly increased the risk of EOC (odds ratio, 2.19; 95% confidence interval, 1.01-4.72). Age-stratified analysis showed that individuals with A/G genotype had a higher risk in the final diagnosis aged younger than 50 years. We observed no overall association between MMP-13-77A/G polymorphism and EOC. However, an elevated positive association was observed for A/A versus G/G + A/G genotypes in mucinous ovarian cancer. Combining the analyzed 2 SNPs, the haplotype distributions in patients were not significantly different from that in controls. CONCLUSION: These results suggested that the G allele of the MMP-12 82A/G polymorphism might be a risk factor for the development and progression of EOC and that the A/A genotype of MMP-13-77A/G polymorphism was associated with special pathological subtype and clinical stage in EOC at least in Chinese women.