Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 53
Filtrar
1.
Diagn Microbiol Infect Dis ; 110(2): 116435, 2024 Oct.
Artigo em Inglês | MEDLINE | ID: mdl-39032320

RESUMO

PURPOSE: Mycobacterium abscessus complex (MABC) infections are increasing worldwide. Furthermore, these infections have a low treatment success rate due to their resistance to many current antibiotics. This study aimed to determine the overall in vitro activity of the tetracyclines doxycycline (DOX), minocycline (MIN), and tigecycline (TGC) against MABC clinical isolates. PATIENTS AND METHODS: A systematic review of PubMed/MEDLINE, Web of Science, and Embase was conducted up to August 28, 2023. Studies applying the drug susceptibility testing standards of the Clinical and Laboratory Standards Institute were considered. A random effects model was used to assess the total in vitro resistance rates of the MABC clinical isolates to DOX, MIN, and TGC. The I2 and Cochran's Q statistics were employed to evaluate the origins of heterogeneity. All analyses were conducted using CMA V.3 software. RESULTS: Twenty-six publications (22, 12, and 11 studies on DOX, MIN, and TGC, respectively) were included. The pooled in vitro resistance rates of the MABC clinical isolates to DOX and MIN at the breakpoint of 8 µg/mL were 93.0 % (95 % CI, 89.2 %-95.5 %) and 87.2 % (95 % CI, 76.5 %-93.4 %), respectively. In the case of TGC, the breakpoints of 2, 4, and 8 µg/mL were associated with pooled resistance rates of 2.5 % (95 % CI, 0.5 %-11.6 %), 7.2 % (95 % CI, 4.0 %-12.5 %), and 16.8 % (95 % CI, 4.7 %-45.0 %), respectively. CONCLUSION: Among the three examined tetracyclines, MABC exhibited extremely high resistance rates to DOX and MIN, thereby limiting their use in treating MABC infections. Conversely, MABC showed an increased susceptibility rate to TGC, highlighting TGC administration as a viable treatment option for patients with MABC infections.


Assuntos
Antibacterianos , Doxiciclina , Testes de Sensibilidade Microbiana , Minociclina , Infecções por Mycobacterium não Tuberculosas , Mycobacterium abscessus , Tigeciclina , Minociclina/farmacologia , Minociclina/análogos & derivados , Tigeciclina/farmacologia , Humanos , Doxiciclina/farmacologia , Doxiciclina/uso terapêutico , Mycobacterium abscessus/efeitos dos fármacos , Antibacterianos/farmacologia , Infecções por Mycobacterium não Tuberculosas/tratamento farmacológico , Infecções por Mycobacterium não Tuberculosas/microbiologia , Farmacorresistência Bacteriana
3.
Phytopathology ; 114(5): 837-842, 2024 May.
Artigo em Inglês | MEDLINE | ID: mdl-38815216

RESUMO

Plant diseases significantly impact food security and food safety. It was estimated that food production needs to increase by 50% to feed the projected 9.3 billion people by 2050. Yet, plant pathogens and pests are documented to cause up to 40% yield losses in major crops, including maize, rice, and wheat, resulting in annual worldwide economic losses of approximately US$220 billion. Yield losses due to plant diseases and pests are estimated to be 21.5% (10.1 to 28.1%) in wheat, 30.3% (24.6 to 40.9%) in rice, and 22.6% (19.5 to 41.4%) in maize. In March 2023, The American Phytopathological Society (APS) conducted a survey to identify and rank key challenges in plant pathology in the next decade. Phytopathology subsequently invited papers that address those key challenges in plant pathology, and these were published as a special issue. The key challenges identified include climate change effect on the disease triangle and outbreaks, plant disease resistance mechanisms and its applications, and specific diseases including those caused by Candidatus Liberibacter spp. and Xylella fastidiosa. Additionally, disease detection, natural and man-made disasters, and plant disease control strategies were explored in issue articles. Finally, aspects of open access and how to publish articles to maximize the Findability, Accessibility, Interoperability, and Reuse of digital assets in plant pathology were described. Only by identifying the challenges and tracking progress in developing solutions for them will we be able to resolve the issues in plant pathology and ultimately ensure plant health, food security, and food safety.


Assuntos
Produtos Agrícolas , Doenças das Plantas , Patologia Vegetal , Doenças das Plantas/microbiologia , Produtos Agrícolas/microbiologia , Resistência à Doença , Mudança Climática , Xylella
4.
Int J Mol Sci ; 25(7)2024 Mar 22.
Artigo em Inglês | MEDLINE | ID: mdl-38612390

RESUMO

Dormancy release and reactivation in temperate trees are mainly controlled by temperature and are affected by age, but the underlying molecular mechanisms are still unclear. In this study, we explored the effects of low temperatures in winter and warm temperatures in spring on dormancy release and reactivation in Larix kaempferi. Further, we established the relationships between cell-cycle genes and cambium cell division. The results showed that chilling accelerated L. kaempferi bud break overall, and the longer the duration of chilling is, the shorter the bud break time is. After dormancy release, warm temperatures induced cell-cycle gene expression; when the configuration value of the cell-cycle genes reached 4.97, the cambium cells divided and L. kaempferi reactivated. This study helps to predict the impact of climate change on wood production and provides technical support for seedling cultivation in greenhouses.


Assuntos
Larix , Larix/genética , Câmbio , Genes cdc , Divisão Celular , Mudança Climática
5.
Phytopathology ; 114(7): 1612-1625, 2024 Jul.
Artigo em Inglês | MEDLINE | ID: mdl-38478699

RESUMO

Unraveling the intricacies of soybean cyst nematode (Heterodera glycines) race 4 resistance and susceptibility in soybean breeding lines-11-452 (highly resistant) and Dongsheng1 (DS1, highly susceptible)-was the focal point of this study. Employing cutting-edge N6-methyladenosine (m6A) and RNA sequencing techniques, we delved into the impact of m6A modification on gene expression and plant defense responses. Through the evaluation of nematode development in both resistant and susceptible roots, a pivotal time point (3 days postinoculation) for m6A methylation sequencing was identified. Our sequencing data exhibited robust statistics, successful soybean genome mapping, and prevalent m6A peak distributions, primarily in the 3' untranslated region and stop codon regions. Analysis of differential methylation peaks and differentially expressed genes revealed distinctive patterns between resistant and susceptible genotypes. In the highly resistant line (11-452), key resistance and defense-associated genes displayed increased expression coupled with inhibited methylation, encompassing crucial players such as R genes, receptor kinases, and transcription factors. Conversely, the highly susceptible DS1 line exhibited heightened expression correlated with decreased methylation in genes linked to susceptibility pathways, including Mildew Locus O-like proteins and regulatory elements affecting defense mechanisms. Genome-wide assessments, Gene Ontology and Kyoto Encyclopedia of Genes and Genomes analyses, and differential methylation peak/differentially expressed gene overlap emphasized the intricate interplay of m6A modifications, alternative splicing, microRNA, and gene regulation in plant defense. Protein-protein interaction networks illuminated defense-pivotal genes, delineating divergent mechanisms in resistant and susceptible responses. This study sheds light on the dynamic correlation between methylation, splicing, and gene expression, providing profound insights into plant responses to nematode infection.


Assuntos
Adenosina , Glycine max , Doenças das Plantas , Tylenchoidea , Glycine max/genética , Glycine max/parasitologia , Glycine max/imunologia , Tylenchoidea/fisiologia , Doenças das Plantas/parasitologia , Doenças das Plantas/imunologia , Doenças das Plantas/genética , Adenosina/análogos & derivados , Adenosina/metabolismo , Animais , Metilação , Resistência à Doença/genética , Regulação da Expressão Gênica de Plantas , Análise de Sequência de RNA , Raízes de Plantas/parasitologia , Raízes de Plantas/genética , Raízes de Plantas/imunologia
6.
Dalton Trans ; 53(12): 5427-5434, 2024 Mar 19.
Artigo em Inglês | MEDLINE | ID: mdl-38411626

RESUMO

Nitrogen-doped molybdenum trioxide (MoO3/NC) has drawbacks such as volume expansion during long-term charging and discharging cycles, which severely limit its further application. This work proposes the addition of titanium dioxide nanoparticles (TiO2 NPs) for performance improvement of MoO3/NC. TiO2 NPs embedded on the surface of a MoO3/NC nanosheet can alleviate its volume expansion and the accumulation of lithiated products and improve the conductivity of the electrode material. The results show that the MoO3/NC nanosheet decorated with TiO2 NPs (TiO2@MoO3/NC), when used as an electrode material, exhibited a discharge specific capacity of 419 mA h g-1 at a current density of 0.05 A g-1 and retained a discharge specific capacity of 517 mA h g-1 after 600 cycles at a current density of 1 A g-1.

7.
Clin Chim Acta ; 553: 117697, 2024 Jan 15.
Artigo em Inglês | MEDLINE | ID: mdl-38145644

RESUMO

BACKGROUND: Existing diagnostic approaches for paucibacillary tuberculosis (TB) are limited by the low sensitivity of testing methods and difficulty in obtaining suitable samples. METHODS: An ultrasensitive TB diagnostic strategy was established, integrating efficient and specific TB targeted next-generation sequencing and machine learning models, and validated in clinical cohorts to test plasma cfDNA, cerebrospinal fluid (CSF) DNA collected from tuberculous meningitis (TBM) and pediatric pulmonary TB (PPTB) patients. RESULTS: In the detection of 227 samples, application of the specific thresholds of CSF DNA (AUC = 0.974) and plasma cfDNA (AUC = 0.908) yielded sensitivity of 97.01 % and the specificity of 95.65 % in CSF samples and sensitivity of 82.61 % and specificity of 86.36 % in plasma samples, respectively. In the analysis of 44 paired samples from TBM patients, our strategy had a high concordance of 90.91 % (40/44) in plasma cfDNA and CSF DNA with both sensitivity of 95.45 % (42/44). In the PPTB patient, the sensitivity of the TB diagnostic strategy yielded higher sensitivity on plasma specimen than Xpert assay on gastric lavage (28.57 % VS. 15.38 %). CONCLUSIONS: Our TB diagnostic strategy provides greater detection sensitivity for paucibacillary TB, while plasma cfDNA as an easily collected specimen, could be an appropriate sample type for PTB and TBM diagnosis.


Assuntos
Ácidos Nucleicos Livres , Mycobacterium tuberculosis , Tuberculose Meníngea , Tuberculose Pulmonar , Humanos , Criança , Tuberculose Meníngea/diagnóstico , Mycobacterium tuberculosis/genética , Proteína de Ligação a Regiões Ricas em Polipirimidinas/genética , Sensibilidade e Especificidade , Tuberculose Pulmonar/diagnóstico , DNA , Sequenciamento de Nucleotídeos em Larga Escala
8.
Phys Chem Chem Phys ; 25(32): 21350-21357, 2023 Aug 16.
Artigo em Inglês | MEDLINE | ID: mdl-37529980

RESUMO

Bi2Se3 is a promising cathode material for aqueous zinc ion batteries (AZIBs), but its limited capacity and poor cycling stability deter its further use in the development of AZIBs. To solve this issue, Bi2Se3/NCD composites have been synthesized via a simple two-step solvothermal method. The introduction of nitrogen-doped carbon dots (NCDs) provides more active sites and makes the composite surface rich in functional groups, which facilitates contact with aqueous electrolytes. The results showed that Bi2Se3/NCDs improved the zinc storage properties of Bi2Se3 as a cathode material. The discharge specific capacity is 318 mA h g-1 at 0.1 A g-1. The cycling performance of Bi2Se3/NCDs was also relatively excellent compared to that of Bi2Se3. This work offers a productive and feasible strategy for metal chalcogenides (MCs) as cathode materials for AZIBs to improve the zinc storage capacity.

10.
J Agric Food Chem ; 71(23): 8778-8796, 2023 Jun 14.
Artigo em Inglês | MEDLINE | ID: mdl-37267587

RESUMO

Soybean cyst nematode (Heterodera glycines Ichinohe), a devastating pathogen in soybean, was chosen as a model system to investigate nematode behavior and gene expression changes in response to acidic and basic pH and salt signals (pH 4.5, 5.25, 8.6, and 10 and NaCl) through full-length transcriptome sequencing of 18 samples. An average of 4.36 Gbp of clean reads per sample were generated, and 3972 novel genes and 29,529 novel transcripts were identified. Sequence structural variation during or after transcription may be associated with the nematode's behavioral response. The functional analysis of 1817/4962 differentially expressed genes/transcripts showed that signal transduction pathways, including transmembrane receptors, ion channels, and Ca2+ transporters, were activated, but pathways involved in nematode development (e.g., ribosome) and energy production (e.g., oxidative phosphorylation) were inhibited. A corresponding model was established. Our findings suggest that these receptors and ion channels might be potential targets for nematicides or drug discovery.


Assuntos
Glycine max , Nematoides , Animais , Glycine max/genética , Perfilação da Expressão Gênica , Canais Iônicos/genética , Concentração de Íons de Hidrogênio
11.
Microbiol Spectr ; 11(1): e0323822, 2023 02 14.
Artigo em Inglês | MEDLINE | ID: mdl-36475850

RESUMO

Infections caused by rapidly growing mycobacteria (RGM) have increased globally. Chemotherapy against these infections is challenging due to the minimal antimicrobial choices available. The main aim of this study was to evaluate the in vitro susceptibilities of four tetracyclines against different RGM species. The MICs of eravacycline (ERC), omadacycline (OMC), sarecycline (SAC), and tigecycline (TGC) against the reference strains of 27 RGM species and 121 RGM clinical isolates were determined by microtiter plate assay. The minimum bactericidal concentrations (MBCs) and cytotoxicities of these antibiotics were also tested. Except for SAC, the other three tetracyclines had MICs of ≤0.5 µg/mL against all 27 RGM reference strains. ERC generally presented the lowest MICs, with MIC90s against the clinical isolates of Mycobacterium abscessus subsp. abscessus, Mycobacterium abscessus subsp. massiliense, and Mycobacterium fortuitum of 0.25 µg/mL, 0.25 µg/mL, and 0.06 µg/mL, respectively. TGC and OMC also showed equivalent in vitro inhibitory activities against the isolates, while the TGC MIC90s for M. abscessus subsp. abscessus, M. abscessus subsp. massiliense, and M. fortuitum were lower than or equal to the OMC MIC90s (1, 1, and 0.25 µg/mL versus 1, 2, and 2 µg/mL). In addition, the MIC50s of three of the antibiotics for each species were always 2-fold lower than the corresponding MIC90s. MBC and cytotoxicity assays indicated that all four tetracycline antibiotics tested were bacteriostatic agents with low toxicity to the THP-1 cell line. Tetracycline antibiotics are efficacious in RGM infection treatment, with omadacycline showing the best promise for clinical application due to its potent antimicrobial activity, safety, and convenient administration route. IMPORTANCE The global rise in antibiotic-resistant nontuberculous mycobacteria has prompted the urgent need for new antimicrobials, especially oral antibiotics. Currently, adverse effects have limited the use of tetracycline-class antibiotics, particularly tigecycline (TGC), in the treatment of rapidly growing mycobacteria (RGM). However, several new tetracycline-class antibiotics might overcome the limitations of TGC. We assessed the in vitro antibiotic susceptibilities of four tetracyclines (eravacycline, omadacycline, sarecycline, and tigecycline) against reference RGM strains and clinical isolates of different RGM species. We showed that three of these antibiotics (tigecycline, eravacycline, and omadacycline) might be efficacious in M. abscessus subsp. abscessus, M. abscessus subsp. massiliense, and M. fortuitum treatment. Furthermore, omadacycline was more promising for clinical application for M. abscessus infections as an oral drug, whereas sarecycline, which had the best safety parameters, should be considered a potential antibiotic for M. abscessus infections caused by susceptible strains. Our work underscores the possible clinical applications of tetracycline-class antibiotics in the treatment of RGM infections.


Assuntos
Infecções por Mycobacterium não Tuberculosas , Mycobacterium abscessus , Mycobacterium , Humanos , Tigeciclina/farmacologia , Tigeciclina/uso terapêutico , Tetraciclina/farmacologia , Tetraciclinas/farmacologia , Tetraciclinas/uso terapêutico , Antibacterianos/farmacologia , Antibacterianos/uso terapêutico , Testes de Sensibilidade Microbiana , Micobactérias não Tuberculosas , Infecções por Mycobacterium não Tuberculosas/tratamento farmacológico , Infecções por Mycobacterium não Tuberculosas/microbiologia
12.
Dalton Trans ; 51(43): 16733-16739, 2022 Nov 08.
Artigo em Inglês | MEDLINE | ID: mdl-36285824

RESUMO

Ni3N/Co4N nanosheet arrays on nickel foam were fabricated by using simple hydrothermal and nitriding two-step strategies. Their excellent performance is due to the synergistic effect between Ni3N and Co4N, the sufficient exposed active spots and the overall interaction of the three-dimensional cross-linking network formed by the nanosheet arrays and the porous nickel foam. Ni3N/Co4N exhibits high hydrogen evolution reaction activity. To yield a current density of 10 mA cm-2, Ni3N/Co4N requires overpotentials of 58 and 85 mV in alkaline fresh water and simulated seawater, respectively. This work provides new understanding of developing feasible heterostructured electrocatalysts based on transition metal nitrides.

13.
Opt Express ; 30(21): 37727-37735, 2022 Oct 10.
Artigo em Inglês | MEDLINE | ID: mdl-36258355

RESUMO

Computing wave propagation is of the utmost importance in computational optics, especially three-dimensional optical imaging and computer-generated hologram. The angular spectrum method, based on fast Fourier transforms, is one of the efficient approaches; however, it induces sampling issues. We report a Hybrid Taylor Rayleigh-Sommerfeld diffraction (HTRSD) that achieves more accurate and faster wave propagation than the widely used angular spectrum method.

14.
Dalton Trans ; 51(37): 14323-14328, 2022 Sep 26.
Artigo em Inglês | MEDLINE | ID: mdl-36069325

RESUMO

The development of catalysts which can substitute expensive metals to efficiently split water is currently a hot research topic. Here, a multi-layered NF/NiCo2O4/Co3S4 nanocomposite was prepared on 3D porous nickel foam by hydrothermal and annealing processes. The electrode is a multi-layered, highly conductive and high specific surface area network without a binder, which facilitates electron transport and exposure of active sites, enhances full contact of the electrolyte/electrode interface, and accelerates H2 and O2 diffusion during water electrolysis. As expected, NF/NiCo2O4/Co3S4 exhibits surprising electrocatalytic activity, and only required 71 and 170 mV to reach 10 mA cm-2 in the hydrogen and oxygen evolution reactions, respectively, and exhibited stability up to 36 h. This strategy provides an efficient, durable, and low-cost bifunctional catalyst.

15.
Front Plant Sci ; 13: 866322, 2022.
Artigo em Inglês | MEDLINE | ID: mdl-35665156

RESUMO

Full-length transcriptome sequencing with long reads is a powerful tool to analyze transcriptional and post-transcriptional events; however, it has not been applied on soybean (Glycine max). Here, a comparative full-length transcriptome analysis was performed on soybean genotype 09-138 infected with soybean cyst nematode (SCN, Heterodera glycines) race 4 (SCN4, incompatible reaction) and race 5 (SCN5, compatible reaction) using Oxford Nanopore Technology. Each of 9 full-length samples collected 8 days post inoculation with/without nematodes generated an average of 6.1 GB of clean data and a total of 65,038 transcript sequences. After redundant transcripts were removed, 1,117 novel genes and 41,096 novel transcripts were identified. By analyzing the sequence structure of the novel transcripts, a total of 28,759 complete open reading frame (ORF) sequences, 5,337 transcription factors, 288 long non-coding RNAs, and 40,090 novel transcripts with function annotation were predicted. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analyses of differentially expressed genes (DEGs) revealed that growth hormone, auxin-activated signaling pathway and multidimensional cell growth, and phenylpropanoid biosynthesis pathway were enriched by infection with both nematode races. More DEGs associated with stress response elements, plant-hormone signaling transduction pathway, and plant-pathogen interaction pathway with more upregulation were found in the incompatible reaction with SCN4 infection, and more DEGs with more upregulation involved in cell wall modification and carbohydrate bioprocess were detected in the compatible reaction with SCN5 infection when compared with each other. Among them, overlapping DEGs with a quantitative difference was triggered. The combination of protein-protein interaction with DEGs for the first time indicated that nematode infection activated the interactions between transcription factor WRKY and VQ (valine-glutamine motif) to contribute to soybean defense. The knowledge of the SCN-soybean interaction mechanism as a model will present more understanding of other plant-nematode interactions.

16.
Plant Dis ; 2022 Jun 19.
Artigo em Inglês | MEDLINE | ID: mdl-35722916

RESUMO

'Baiwei' (swallowwort root, Cynanchum versicolor Bunge), is a perennial cranberry type of Chinese medicinal herb, and grows in mountains with wide distribution in many provinces including Shandong, Henan, Hebei, Liaoning, Anhui and others. The functions of 'Baiwei' are strengthening myocardial contraction, detoxifying, and as a diuretic; thus it is one of very important herbs in China (Yunsi Su et al. 2021). With the increasing need for this herbal medicine in China, farmers are trying to cultivate the wild type of 'Baiwei'. In 2019, we found severe crop damage in a second-year planting of 'Baiwei' with many dead plants in a field (Fig. S1A, B) in Mengyin County of Shandong Province, China. Root galls were clearly seen in the roots and the typical root-knot nematode (Meloidogyne spp.) symptoms were observed (Fig. S1C). The previous crop was peanut. Peanut is widely planted in Shandong Province and peanut root-knot nematode (M. arenaria) is one of its major root-knot nematode pests. We suspected that the damage was caused by peanut root-knot nematode. The roots were taken to the lab and kept at 10℃ for morphological and molecular identification of root-knot nematodes, and pathogenicity testing. Twenty females were picked up from the infected roots for perineal pattern observation. The perineal pattern had distinct characteristics such as a low dorsal arch and lateral field marked by forked and broken striae and without punctate markings between the anus and tail terminus (Fig. S2A), which is similar to the description of M. arenaria (Eisenback et al., 1981). Eggs were extracted from roots and hatched to second-stage juveniles (J2s). The morphometric characters of J2s (n = 30) demonstrated body length = 437.35 ± SE 3.51 µm, body width = 16.74 ± 0.16 µm, stylet length = 11.31 ± 0.20 µm, DGO = 3.87 ± 0.07 µm, tail length = 53.32 ± 0.99 µm, and hyaline tail terminus = 11.14 ± 0.12 µm. The universal primer 194/195 (5.8S-18S rDNA TTAACTTGCCAGATCGGACG/TCTAATGAGCCGTACGC) for confirmation of Meloidogyne spp. was chosen and the sequence characterized amplified region (SCAR) PCR specific markers for M. incognita (Finc/Rinc GGGATGTGTAAATGCTCCTG/CCCGCTACACCCTCAACTTC), M. javanica (Fjav/Rjav ACGCTAGAATTCGACCCTGG/GGTACCAGAAGCAGCCATGC), M. enterolobii (Fent/Rent GAAATTGCTTTATTGTTACTAAG/TAGCCACAGCAAAATAGTTTTC), M. arenaria (Fare/Rare TCGGCGATAGAGGTAAATGAC/TCGGCGATAGACACTACAACT), M. hapla (Fhap/Rhap TGACGGCGGTGAGTGCGA/TGACGGCGGTACCTCATAG) and M. chitwoodi (Fchi/Rchi TGGAGAGCAGCAGGAGAAAGA/GGTCTGAGTGAGGACAAGAGTA) were utilized for species identification (Mao et al., 2019). PCR products of J2 amplification were run in the agar gel (Fig. S2B). A PCR product of 750 bp was obtained for 194/195 primer pair and a 420 bp band was identified for M. arenaria for all tested J2 samples. There were no bands for other specific primers. The amplicons from 194/195 and M. arenaria primer pairs were sequenced. A 100% identity of the Fare/Rare sequence (MZ522722.1) with M. arenaria KP234264.1 and a 99.8% identity with M. arenaria MW315990.1 were found through NCBI blast. A 100% identity of the 194/195 sequence (MZ555753.1) with both M. arenaria GQ395518.1 and U42342.1 and M. thailandica HF568829.1. To confirm the pathogenicity, 2000 J2s obtained from the same population as described above were used to inoculate each plant of one-month old 'Baiwei' seedlings (n = 5) and of one-month-old tomato cv. 'Zhongshu4' seedlings (n = 5) growing in 15-cm-diameter and 10-cm-height plastic pot containing sand and soil (2:1 ratio) in the glasshouse at 22-28℃ and 16/8 h day/night. Plants without J2s were used as control. Sixty days later, roots were stained with erioglaucine (Omwega et al. 1988) and an average of 107 ± SE 59 and 276 ± SE 31 egg masses per gram root were produced in each infected 'Baiwei' (Fig. S3A) and tomato (Fig. S3B) root, respectively. PCR amplification of the hatched J2s reconfirmed the reproduced nematode in 'Baiwei' and tomato was M. arenaria. This is the first report on M. arenaria parasitizing the medicinal herb C. versicolor in China.

17.
Dalton Trans ; 51(26): 10061-10068, 2022 Jul 05.
Artigo em Inglês | MEDLINE | ID: mdl-35726895

RESUMO

It is of utmost importance to explore bifunctional electrocatalysts for water splitting. Herein, unique ZnCo2O4-CoOOH heterostructured ultrathin nanosheets on Ni foam are reported that combines a two-step hydrothermal method. This catalyst exhibits excellent catalytic performances to achieve a current density of 10 mA cm-2 with an ultralow overpotential of 115 mV for HER, attaining an overpotential of 238 mV at 20 mA cm-2 for OER. Remarkably, ZnCo2O4-CoOOH/Ni shows a voltage of 1.494 V to drive a current density of 10 mA cm-2. Such performances are due to the inter-penetrative pores present in the ultrathin nanosheets that provide large surface areas and expose massive active sites to enhance activities. In addition, the unique nanosheet structure and the 3D Ni foam substrate possess large specific surface areas, which can facilitate mass diffusion. This excellent performance is ascribed to the ZnCo2O4-CoOOH heterostructure that manipulates strong synergy to improve the electrochemical activity. This study offers new insight on an innovative approach for the exploitation of effective bifunctional electrocatalysts with a heterostructure.

18.
Front Plant Sci ; 13: 858313, 2022.
Artigo em Inglês | MEDLINE | ID: mdl-35498643

RESUMO

Cotton (Gossypium spp.) is the most important renewable source of natural textile fiber and one of the most cultivated crops around the world. Plant-parasitic nematode infestations, such as the southern Root-Knot Nematode (RKN) Meloidogyne incognita, represent a threat to cotton production worldwide. Host-plant resistance is a highly effective strategy to manage RKN; however, the underlying molecular mechanisms of RKN-resistance remain largely unknown. In this study, we harness the differences in RKN-resistance between a susceptible (Acala SJ-2, SJ2), a moderately resistant (Upland Wild Mexico Jack Jones, WMJJ), and a resistant (Acala NemX) cotton entries, to perform genome-wide comparative analysis of the root transcriptional response to M. incognita infection. RNA-seq data suggest that RKN-resistance is determined by a constitutive state of defense transcriptional behavior that prevails in the roots of the NemX cultivar. Gene ontology and protein homology analyses indicate that the root transcriptional landscape in response to RKN-infection is enriched for responses related to jasmonic and salicylic acid, two key phytohormones in plant defense responses. These responses are constitutively activated in NemX and correlate with elevated levels of these two hormones while avoiding a fitness penalty. We show that the expression of cotton genes coding for disease resistance and receptor proteins linked to RKN-resistance and perception in plants, is enhanced in the roots of RKN-resistant NemX. Members of the later gene families, located in the confidence interval of a previously identified QTL associated with RKN resistance, represent promising candidates that might facilitate introduction of RKN-resistance into valuable commercial varieties of cotton. Our study provides novel insights into the molecular mechanisms that underlie RKN resistance in cotton.

19.
Dalton Trans ; 51(8): 3349-3356, 2022 Feb 22.
Artigo em Inglês | MEDLINE | ID: mdl-35137739

RESUMO

It is of pivotal significance to probe highly efficient, cost-effective and low-cost catalysts for the hydrogen evolution reaction. Herein, a closely packed carbon-encapsulated CuO/Cu2O heterohedron with a heterojunction structure is reported that combines chemical etching and thermal oxidation processes. CuO/Cu2O@C-10 has remarkable catalytic activity for HER with an overpotential of 121 mV at a current density of 10 mA cm-2 and a Tafel slope of 81.58 mV dec-1, along with excellent stability in alkaline media under optimal conditions. Benefiting from CuO/Cu2O nanoparticles embedded in a carbon matrix, it forms a porous heterohedron structure by a close packing mode, owing to the unique CuO/Cu2O heterostructure with an ultrathin coated carbon layer and an interconnected conductive carbon network structure. These characteristics make a great contribution to the massive number of active interfacial sites, alleviating the aggregation of active substances, enhancing ion diffusion and the conductivity of the materials. This facile strategy sheds new light on a rational synthesis for a highly efficient hydrogen evolution catalyst with a heterostructure.

20.
Opt Express ; 29(19): 30284-30295, 2021 Sep 13.
Artigo em Inglês | MEDLINE | ID: mdl-34614754

RESUMO

Deflectometry, as a non-contact, fully optical metrology method, is difficult to apply to refractive elements due to multi-surface entanglement and precise pose alignment. Here, we present a computational self-calibration approach to measure parametric lenses using dual-camera refractive deflectometry, achieved by an accurate, differentiable, and efficient ray tracing framework for modeling the metrology setup, based on which damped least squares is utilized to estimate unknown lens shape and pose parameters. We successfully demonstrate both synthetic and experimental results on singlet lens surface curvature and asphere-freeform metrology in a transmissive setting.

SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA