RESUMO
Polysorbate 80, commonly abbreviated as PS80, is a widely used pharmaceutical excipient renowned for its role as a solubilizer and stabilizer in drug formulations. Although PS80 is essential for various pharmaceutical applications, particularly in the formulation of injectable drugs, it has been implicated in a range of adverse reactions. However, due to the complexity of the composition of PS80, the differences in the types and contents of the constituents of PS80 from different manufacturers increase the probability or likelihood of their uneven quality. Addressing the complete spectrum of PS80's components is challenging; thus, most studies to date have examined PS80 as a singular entity. This approach, however, carries a degree of uncertainty, as it overlooks the unique composition and concentration of components within the PS80 used in experiments, which may not reflect the actual diversity in commercially available PS80 products. Recognizing the critical need to understand how PS80's composition influences biological effects and toxicity, our study aims to bridge this knowledge gap. By doing so, we can clarify how different PS80 compositions from various manufacturers might affect the quality of pharmaceutical formulations, and also guide excipient manufacturers toward producing higher-quality PS80. Such insights could further facilitate a more targeted application of PS80 in drug development. Building on our previous work, we isolated and prepared two key components of PS80-polyoxyethylene sorbitan monooleate (PSM) and polyoxyethylene isosorbide monooleate (PIM)-and conducted a systematic comparison. We evaluated the acute, hemolytic, and target organ toxicity of two different PS80 samples, as well as PSM and PIM, using a zebrafish model. Our research also delved into the potential mechanisms behind the observed toxicological effects, providing an in-depth understanding of PS80's impact on biological systems.The results show that PS80, PSM, and PIM resulted in developmental anomalies in larval zebrafish. The primary organs of acute toxicity in zebrafish exposed to PS80 and its typical components PSM and PIM include the cardiovascular system, kidneys, intestines, skin, and liver. Notably, PIM further induced severe pericardial edema and erythrocyte hemolysis, thereby affecting blood flow. The samples also instigated oxidative damage by disrupting the redox equilibrium in the larvae. Compared to PS80, both PSM and PIM induced greater oxidative damage, with PIM notably causing significantly higher lipid oxidation, suggesting that oxidative stress may play a crucial role in polysorbate80-induced toxicity. Furthermore, our study found that PS80 could induce alterations in DNA conformation. The findings underscore the necessity for excipient regulators to establish comprehensive quality standards for Polysorbate 80 (PS80). By implementing such standards, it is possible to minimize the clinical risks associated with the variability in PS80 composition, ensuring safer pharmaceutical products for patients.
RESUMO
BACKGROUND: It is still unclear whether small left ventricle (LV) is an adverse structural prognostic feature in patients with atrial fibrillation (AF). OBJECTIVES: The purpose of this study was to evaluate the association between small LV and risk of cardiovascular events in AF population. METHODS: From the China-AF registry, 7,764 patients with AF were enrolled and divided into groups with normal, small, and large LV size based on left ventricular end-diastolic dimension (LVEDD) measurement per the American Society of Echocardiography references. Cox models were used to assess the association between LV size or LVEDD with composite cardiovascular events (cardiovascular death, ischemic stroke or systemic embolism, or major bleeding). RESULTS: There were 308 (4.0%) participants assessed with small LV who were older, with lower body mass and blood pressure, and fewer comorbidities, and 429 (5.5%) were identified with large LV. Compared with the normal LV group, small LV and large LV were significantly associated with higher incidence of composite cardiovascular events (adjusted HR [aHR]: 1.54 [95% CI: 1.07-2.20] for small LV; aHR: 1.36 [95% CI: 1.02-1.81] for large LV) and cardiovascular death (aHR: 1.94 [95% CI: 1.14-3.28] for small LV; aHR: 1.83 [95% CI: 1.24-2.69] for large LV). Small LV was also associated with increased risk of major bleeding [aHR: 2.21 [95% CI: 1.01-4.86]). A U-shaped relationship between LVEDD and composite cardiovascular events was identified (Pnonlinear < 0.001). CONCLUSIONS: In a prospective AF cohort, small LV was independently associated with an increased risk of cardiovascular events, which needed consideration in risk stratification and management for patients with AF. (ChiCTR-OCH-13003729).
Assuntos
Fibrilação Atrial , Ventrículos do Coração , Humanos , Fibrilação Atrial/epidemiologia , Fibrilação Atrial/complicações , Masculino , Feminino , Idoso , Pessoa de Meia-Idade , Ventrículos do Coração/diagnóstico por imagem , Ventrículos do Coração/fisiopatologia , Sistema de Registros , China/epidemiologia , Doenças Cardiovasculares/epidemiologia , Doenças Cardiovasculares/etiologia , Estudos Prospectivos , Medição de Risco/métodos , Ecocardiografia , Fatores de Risco , Tamanho do ÓrgãoRESUMO
Long-term tumor starvation may be a potential strategy to elevate the antitumor immune response by depriving nutrients. However, combining long-term starvation therapy with immunotherapy often yields limited efficacy due to the blockage of immune cell migration pathways. Herein, an intelligent blood flow regulator (BFR) is first established through photoactivated in situ formation of the extravascular dynamic hydrogel to compress blood vessels, which can induce long-term tumor starvation to elicit metabolic stress in tumor cells without affecting immune cell migration pathways. By leveraging methacrylate-modified nanophotosensitizers (HMMAN) and biodegradable gelatin methacrylate (GelMA), the developed extravascular hydrogel dynamically regulates blood flow via enzymatic degradation. Additionally, aPD-L1 loaded into HMMAN continuously blocks immune checkpoints. Systematic in vivo experiments demonstrate that the combination of immune checkpoint blockade (ICB) and BFR-induced metabolic stress (BIMS) significantly delays the progression of Lewis lung and breast cancers by reshaping the tumor immunogenic landscape and enhancing antitumor immune responses.
Assuntos
Hidrogéis , Hidrogéis/química , Animais , Camundongos , Humanos , Linhagem Celular Tumoral , Feminino , Fármacos Fotossensibilizantes/química , Fármacos Fotossensibilizantes/farmacologia , Imunoterapia , Gelatina/química , Metacrilatos/química , Metacrilatos/farmacologia , Neoplasias da Mama/imunologiaRESUMO
Cervical cancer is a significant global health issue, its prevalence and prognosis highlighting the importance of early screening for effective prevention. This research aimed to create and validate an artificial intelligence cervical cancer screening (AICCS) system for grading cervical cytology. The AICCS system was trained and validated using various datasets, including retrospective, prospective, and randomized observational trial data, involving a total of 16,056 participants. It utilized two artificial intelligence (AI) models: one for detecting cells at the patch-level and another for classifying whole-slide image (WSIs). The AICCS consistently showed high accuracy in predicting cytology grades across different datasets. In the prospective assessment, it achieved an area under curve (AUC) of 0.947, a sensitivity of 0.946, a specificity of 0.890, and an accuracy of 0.892. Remarkably, the randomized observational trial revealed that the AICCS-assisted cytopathologists had a significantly higher AUC, specificity, and accuracy than cytopathologists alone, with a notable 13.3% enhancement in sensitivity. Thus, AICCS holds promise as an additional tool for accurate and efficient cervical cancer screening.
Assuntos
Inteligência Artificial , Detecção Precoce de Câncer , Neoplasias do Colo do Útero , Humanos , Feminino , Neoplasias do Colo do Útero/diagnóstico , Neoplasias do Colo do Útero/patologia , Detecção Precoce de Câncer/métodos , Adulto , Pessoa de Meia-Idade , Estudos Prospectivos , Estudos Retrospectivos , Sensibilidade e Especificidade , Colo do Útero/patologia , Gradação de Tumores , Área Sob a Curva , CitologiaRESUMO
AURKA is a threonine or serine kinase that needs to be activated by TPX2, Bora and other factors. AURKA is located on chromosome 20 and is amplified or overexpressed in many human cancers, such as breast cancer. AURKA regulates some basic cellular processes, and this regulation is realized via the phosphorylation of downstream substrates. AURKA can function in either the cytoplasm or the nucleus. It can promote the transcription and expression of oncogenes together with other transcription factors in the nucleus, including FoxM1, C-Myc, and NF-κB. In addition, it also sustains carcinogenic signaling, such as N-Myc and Wnt signaling. This article will focus on the role of AURKA in the nucleus and its carcinogenic characteristics that are independent of its kinase activity to provide a theoretical explanation for mechanisms of resistance to kinase inhibitors and a reference for future research on targeted inhibitors.
AURKA plays an important role in the control of the proliferation, invasion, cell cycle regulation and self-renewal of cancer stem cells.Small molecule kinase inhibitors targeting AURKA have been developed, but the overall response rate of patients in clinical trials is not ideal, prompting us to pay attention to the non-kinase activity of AURKA.This review focuses on the nuclear function of AURKA and its oncogenic properties independent of kinase activity, demonstrating that the nuclear substrate of AURKA and the remote allosteric site of the kinase may be targets of anticancer therapy.
Assuntos
Aurora Quinase A , Carcinogênese , Núcleo Celular , Humanos , Aurora Quinase A/metabolismo , Carcinogênese/genética , Carcinogênese/metabolismo , Núcleo Celular/metabolismo , Neoplasias/genética , Neoplasias/metabolismo , Transdução de Sinais , Regulação Neoplásica da Expressão Gênica , Inibidores de Proteínas Quinases/farmacologia , AnimaisRESUMO
Manipulating the expression of cellular genes through efficient CRISPR/Cas9 delivery is rapidly evolving into a desirable tumor therapeutics. The exposure of CRISPR/Cas9 to a complex external environment poses challenges for conventional delivery carriers in achieving responsive and accurate release. Here, we report a Trojan horse-like nanocapsule for the on-demand delivery of CRISPR/Cas9 in a microRNA-responsive manner, enabling precise tumor therapy. The nanocapsule comprises a nanoassembled, engineered DNAzyme shell encasing a Cas9/sgRNA complex core. The DNAzyme, functioning as a catalytic unit, undergoes a conformational change in the presence of tumor-associated microRNA, followed by activating a positive feedback-driven autonomous catabolic cycle of the nanocapsule shell. This catabolic cycle is accomplished through chain reactions of DNAzyme "cleavage-hybridization-cleavage", which ensures sensitivity in microRNA recognition and effective release of Cas9/sgRNA. Utilizing this Trojan horse-like nanocapsule, as low as 1.7 pM microRNA-21 can trigger the on-demand release of Cas9/sgRNA, enabling the specific editing of the protumorigenic microRNA coding gene. The resulting upregulation of tumor suppressor genes induces apoptosis in tumor cells, leading to significant inhibition of tumor growth by up to 75.94%. The Trojan horse-like nanocapsule, with superior programmability and biocompatibility, is anticipated to serve as a promising carrier for tailoring responsive gene editing systems, achieving enhanced antitumor specificity and efficacy.
RESUMO
BACKGROUND: We explored the potential novel anticancer mechanisms of 25-hydroxyvitamin D (25(OH)D), a vitamin D metabolite with antitumour effects in breast cancer. It is stable in serum and is used to assess vitamin D levels in clinical practice. Transfer RNA-derived small RNAs are small noncoding RNAs that generate various distinct biological functions, but more research is needed on their role in breast cancer. METHODS: Small RNA microarrays were used to explore the novel regulatory mechanism of 25(OH)D. High-throughput RNA-sequencing technology was used to detect transcriptome changes after 25(OH)D treatment and tRF-1-Ser knockdown. RNA pull-down and high-performance liquid chromatography-mass spectrometry/mass spectrometry were used to explore the proteins bound to tRF-1-Ser. In vitro and in vivo functional experiments were conducted to assess the influence of 25(OH)D and tRF-1-Ser on breast cancer. Semi-quantitative PCR was performed to detect alternative splicing events. Western blot assay and qPCR were used to assess protein and mRNA expression. RESULTS: The expression of tRF-1-Ser is negatively regulated by 25(OH)D. In our breast cancer (BRCA) clinical samples, we found that the expression of tRF-1-Ser was higher in cancer tissues than in paired normal tissues, and was significantly associated with tumour invasion. Moreover, tRF-1-Ser inhibits the function of MBNL1 by hindering its nuclear translocation. Functional experiments and transcriptome data revealed that the downregulation of tRF-1-Ser plays a vital role in the anticancer effect of 25(OH)D. CONCLUSIONS: In brief, our research revealed a novel anticancer mechanism of 25(OH)D, unveiled the vital function of tRF-1-Ser in BRCA progression, and suggested that tRF-1-Ser could emerge as a new therapeutic target for BRCA.
Assuntos
Neoplasias da Mama , Proliferação de Células , Proteínas de Ligação a RNA , Vitamina D , Humanos , Neoplasias da Mama/genética , Neoplasias da Mama/metabolismo , Feminino , Vitamina D/metabolismo , Vitamina D/análogos & derivados , Vitamina D/farmacologia , Proteínas de Ligação a RNA/metabolismo , Proteínas de Ligação a RNA/genética , Proliferação de Células/genética , Camundongos , AnimaisRESUMO
Context: Cabozantinib combined with immune checkpoint inhibitors (ICIs) has brought a new therapeutic effect for the medical treatment of renal cell carcinoma (RCC). Objectives: We performed a meta-analysis of randomized controlled trials and single-arm trials to evaluate the efficacy and safety of cabozantinib plus ICIs in RCC. Methods: We extracted data from PubMed, Cochrane, Medline and Embase databases, and rated literature quality through Cochrane risk of bias tool and MINORS. RevMan5.3 software was used to analyze the results of randomized controlled trials and single-arm trials. Results: A total of 7 studies were included. Treatment with cabozantinib plus ICIs improved PFS [HR 0.75, (95%CI: 0.52, 1.08), p = 0.12] and the OS [HR 0.80, (95%CI: 0.60, 1.07), p = 0.13] in randomized controlled trials. Meanwhile, the result of the ORR in randomized controlled trials was [risk ratio (RR) 1.37, (95%CI: 1.21, 1.54), p < 0.00001] and in single-arm trials was [risk difference (RD) 0.49, (95%CI: 0.26, 0.71), p < 0.0001]. Conclusion: Cabozantinib plus ICIs prolonged the PFS and OS, and improved ORR in patients with RCC. Our recommendation is to use cabozantinib plus ICIs to treat advanced RCC, and to continuous monitor and manage the drug-related adverse events. Systematic Review Registration: identifier CRD42023455878.
RESUMO
BACKGROUND: Blood pressure variability (BPV) is a risk factor for poor kidney function independent of blood pressure (BP) in chronic kidney disease (CKD). Little is known about the association between kidney function decline and BPV in hypertensive patients without CKD. METHODS: A post-hoc analysis of the Systolic Blood Pressure Intervention Trial (SPRINT) was performed. BPV was measured as standard deviation (SD) and average real variability (ARV). Cox proportional hazard models were employed to explore the relationship between BPV and incident CKD and albuminuria. RESULTS: A total of 5700 patients were included, with a mean age of 66.4âyears old. During a median of 3.29âyears follow-up, 150 (2.6%) patients developed CKD and 222 (7.2%) patients developed albuminuria. Patients were divided into four groups according to the quartiles of BPV. Compared with SBPV Q1, the incidence of CKD was higher in SBPV Q2-Q4; hazard ratios and 95% confidence interval were 1.81 (1.07-3.04), 1.85 (1.10-3.12) and 1.90 (1.13-3.19), respectively. The association between incident CKD and albuminuria with DBPV was less significant than SBPV. Similar results were found when measuring BPV as ARV and SD. No interaction was detected in BP-lowering strategy and SBPV on incident CKD and albuminuria (Pâ>â0.05). CONCLUSION: This study found that BPV was a risk factor for incident CKD and albuminuria in patients without CKD, especially SBPV. Although intensive BP control increased the risk of CKD, the association between SBPV and kidney function decline did not differ between the two treatment groups. REGISTRATION: URL: https://clinicaltrials.gov/, Unique identifier: NCT01206062.
RESUMO
INTRODUCTION: Chimeric antigen receptor (CAR)-T cells obtained long-term durability in about 30% to 40% of relapsed/refractory (r/r) B-cell non-Hodgkin lymphoma (B-NHL). Maintenance therapy after CAR-T is necessary, and PD1 inhibitor is one of the important maintenance therapy options. METHODS: A total of 173 r/r B-NHL patients treated with PD1 inhibitor maintenance following CD19/22 CAR-T therapy alone or combined with autologous hematopoietic stem cell transplantation (ASCT) from March 2019 to July 2022 were assessed for eligibility for two trials. There were 81 patients on PD1 inhibitor maintenance therapy. RESULTS: In the CD19/22 CAR-T therapy trial, the PD1 inhibitor maintenance group indicated superior objective response rate (ORR) (82.9% vs 60%; P = 0.04) and 2-year progression-free survival (PFS) (59.8% vs 21.3%; P = 0.001) than the non-maintenance group. The estimated 2-year overall survival (OS) was comparable in the two groups (60.1% vs 45.1%; P = 0.112). No difference was observed in the peak expansion levels of CD19 CAR-T and CD22 CAR-T between the two groups. The persistence time of CD19 and CD22 CAR-T in the PD1 inhibitor maintenance group was longer than that in the non-maintenance group. In the CD19/22 CAR-T therapy combined with ASCT trial, no significant differences in ORR (81.4% vs 84.8%; P = 0.67), 2-year PFS (72.3% vs 74.9%; P = 0.73), and 2-year OS (84.1% vs 80.7%; P = 0.79) were observed between non-maintenance and PD1 inhibitor maintenance therapy groups. The peak expansion levels and duration of CD19 and CD22 CAR-T were not statistically different between the two groups. During maintenance treatment with PD1 inhibitor, all adverse events were manageable. In the multivariable analyses, type and R3m were independent predictive factors influencing the OS of r/r B-NHL with PD1 inhibitor maintenance after CAR-T therapy. CONCLUSION: PD1 inhibitor maintenance following CD19/22 CAR-T therapy obtained superior response and survival in r/r B-NHL, but not in the trial of CD19/22 CAR-T cell therapy combined with ASCT.
RESUMO
BACKGROUND: Breast cancer is the most common cancer in women, and in advanced stages, it often metastasizes to the brain. However, research on the biological mechanisms of breast cancer brain metastasis and potential therapeutic targets are limited. METHODS: Differential gene expression analysis (DEGs) for the datasets GSE43837 and GSE125989 from the GEO database was performed using online analysis tools such as GEO2R and Sangerbox. Further investigation related to SULF1 was conducted using online databases such as Kaplan-Meier Plotter and cBioPortal. Thus, expression levels, variations, associations with HER2, biological processes, and pathways involving SULF1 could be analyzed using UALCAN, cBioPortal, GEPIA2, and LinkedOmics databases. Moreover, the sensitivity of SULF1 to existing drugs was explored using drug databases such as RNAactDrug and CADSP. RESULTS: High expression of SULF1 was associated with poor prognosis in advanced breast cancer brain metastasis and was positively correlated with the expression of HER2. In the metastatic breast cancer population, SULF1 ranked top among the 16 DEGs with the highest mutation rate, reaching 11%, primarily due to amplification. KEGG and GSEA analyses revealed that the genes co-expressed with SULF1 were positively enriched in the 'ECM-receptor interaction' gene set and negatively enriched in the 'Ribosome' gene set. Currently, docetaxel and vinorelbine can act as treatment options if the expression of SULF1 is high. CONCLUSIONS: This study, through bioinformatics analysis, unveiled SULF1 as a potential target for treating breast cancer brain metastasis (BM).
RESUMO
The integration of low-dimensional nanomaterials with microscale architectures in flexible pressure sensors has garnered significant interest due to their outstanding performance in healthcare monitoring. However, achieving high sensitivity across different magnitudes of external pressure remains a critical challenge. Herein, we present a high-performance flexible pressure sensor crafted from biomimetic hibiscus flower microstructures coated with silver nanowires. When compared with a flat electrode, these microstructures as electrodes display significantly enhanced sensitivity and an extended stimulus-response range. Furthermore, we utilized an ionic gel film as the dielectric layer, resulting in an enhancement of the overall performance of the flexible pressure sensor through an increase in interfacial capacitance. Consequently, the capacitive pressure sensor exhibits an extraordinary ultrahigh sensitivity of 48.57 [Kpa]-1 within the pressure range of 0-1 Kpa, 15.24 [Kpa]-1 within the pressure range of 1-30 Kpa, and 3.74 [Kpa]-1 within the pressure range of 30-120 Kpa, accompanied by a rapid response time (<58 ms). The exceptional performance of our flexible pressure sensor serves as a foundation for its numerous applications in healthcare monitoring. Notably, the flexible pressure sensor excels not only in detecting subtle physiological signals such as finger and wrist pulse signals, vocal cord vibrations, and breathing intensity but also demonstrates excellent performance in monitoring higher pressures, such as plantar pressure. We foresee that this flexible pressure sensor possesses significant potential in the field of wearable electronics.
RESUMO
Tongue squamous cell carcinoma (TSCC) is a prevalent form of oral malignancy, with increasing incidence. Unfortunately, the 5-year survival rate for patients has not exceeded 50%. Studies have shown that sex-determining region Y box 9 (SOX9) correlates with malignancy and tumor stemness in a variety of tumors. To investigate the role of SOX9 in TSCC stemness, we analyzed its influence on various aspects of tumor biology, including cell proliferation, migration, invasion, sphere and clone formation, and drug resistance in TSCC. Our data suggest a close association between SOX9 expression and both the stemness phenotype and drug resistance in TSCC. Immunohistochemical experiments revealed a progressive increase of SOX9 expression in normal oral mucosa, paracancerous tissues, and tongue squamous carcinoma tissues. Furthermore, the expression of SOX9 was closely linked to the TNM stage, but not to lymph node metastasis or tumor diameter. SOX9 is a crucial gene in TSCC responsible for promoting the stemness function of cancer stem cells. Developing drugs that target SOX9 is extremely important in clinical settings.
Assuntos
Carcinoma de Células Escamosas , Neoplasias Bucais , Neoplasias da Língua , Humanos , Carcinoma de Células Escamosas/patologia , Neoplasias da Língua/metabolismo , Linhagem Celular Tumoral , Neoplasias Bucais/genética , Língua/metabolismo , Língua/patologia , Proliferação de Células , Regulação Neoplásica da Expressão Gênica , Movimento Celular/genética , Fatores de Transcrição SOX9/genética , Fatores de Transcrição SOX9/metabolismoRESUMO
The increasing depth of mine excavation presents greater challenges in mine ventilation and in managing cooling energy consumption. Therefore, there is an urgent need for comprehensive research on jet ventilation influenced by low-speed crossflows. This study investigated the impact of flow velocity ratios (R) and jet exit diameters (d) on flow-field distribution and flow characteristics through velocity measurements and smoke flow visualization experiments. The results of the study revealed two distinct types of air lakes formed by jet ventilation in crossflow (JVIC), with one being wall-attached and the other suspended. Notably, a significant secondary flow phenomenon was observed in the near-field near the upper wall. Additionally, the deflection angle (θj) of JVIC decreases as R and d/D increase, leading to the formation and movement of a semi-confined point (SP) and a confined point (CP) in the -x direction. Moreover, the wall confinement effect diminishes the jet's diffusion and deflection ability in the -z direction, leading to increased penetration in the x direction. Before the formation of the SP, the deflection section of the jet lengthens, followed by a rapid shortening upon its formation. Finally, the study further developed empirical equations for the jet axial trajectory and diffusion width.
RESUMO
Evidence suggests associations between COVID-19 patients or vaccines and glycometabolic dysfunction and an even higher risk of the occurrence of diabetes. Herein, we retrospectively analyzed pancreatic lesions in autopsy tissues from 67 SARS-CoV-2 infected non-human primates (NHPs) models and 121 vaccinated and infected NHPs from 2020 to 2023 and COVID-19 patients. Multi-label immunofluorescence revealed direct infection of both exocrine and endocrine pancreatic cells by the virus in NHPs and humans. Minor and limited phenotypic and histopathological changes were observed in adult models. Systemic proteomics and metabolomics results indicated metabolic disorders, mainly enriched in insulin resistance pathways, in infected adult NHPs, along with elevated fasting C-peptide and C-peptide/glucose ratio levels. Furthermore, in elder COVID-19 NHPs, SARS-CoV-2 infection causes loss of beta (ß) cells and lower expressed-insulin in situ characterized by islet amyloidosis and necrosis, activation of α-SMA and aggravated fibrosis consisting of lower collagen in serum, an increase of pancreatic inflammation and stress markers, ICAM-1 and G3BP1, along with more severe glycometabolic dysfunction. In contrast, vaccination maintained glucose homeostasis by activating insulin receptor α and insulin receptor ß. Overall, the cumulative risk of diabetes post-COVID-19 is closely tied to age, suggesting more attention should be paid to blood sugar management in elderly COVID-19 patients.
Assuntos
COVID-19 , Diabetes Mellitus , Adulto , Animais , Humanos , Idoso , SARS-CoV-2 , Receptor de Insulina , Peptídeo C , DNA Helicases , Estudos Retrospectivos , Proteínas de Ligação a Poli-ADP-Ribose , RNA Helicases , Proteínas com Motivo de Reconhecimento de RNA , GlucoseRESUMO
CD36 may defect on platelets and/or monocytes in healthy individuals, which was defined as CD36 deficiency. However, we did not know the correlation between the molecular and protein levels completely. Here, we aim to determine the polymorphisms of the CD36 gene, RNA level, and CD36 on platelets and in plasma. The individuals were sequenced by Sanger sequencing. Bioinformational analysis was used by the HotMuSiC, CUPSAT, SAAFEC-SEQ, and FoldX. RNA analysis and CD36 protein detection were performed by qPCR, flow cytometry, and ELISA. In this study, we found c.1228_1239delATTGTGCCTATT (allele frequency = 0.0072) with the highest frequency among our cohort, and one mutation (c.1329_1354dupGATAGAAATGATCTTACTCAGTGTTG) was not present in the dbSNP database. 5 mutations located in the extracellular domain sequencing region with confirmation in deficient individuals, of which c.284T>C, c.512A>G, c.572C>T, and c.869T>C were found to have a deleterious impact on CD36 protein stability. Furthermore, the MFI of CD36 expression on platelets in the mutation-carry, deleterious-effect, and deficiency group was significantly lower than the no-mutation group (P < 0.0500). In addition, sCD36 levels in type II individuals were significantly lower compared with positive controls (P = 0.0060). Nevertheless, we found the presence of sCD36 in a type I individual. RNA analysis showed CD36 RNA levels in platelets of type II individuals were significantly lower than the positive individuals (P = 0.0065). However, no significant difference was observed in monocytes (P = 0.7500). We identified the most prevalent mutation (c.1228_1239delATTGTGCCTATT) among Kunming donors. Besides, our results suggested RNA level alterations could potentially underlie type II deficiency. Furthermore, sCD36 may hold promise for assessing immune reaction risk in CD36-deficient individuals, but more studies should be conducted to validate this hypothesis.
Assuntos
Transtornos Plaquetários , Antígenos CD36 , Humanos , Antígenos CD36/genética , Plaquetas , Bases de Dados Factuais , RNARESUMO
Despite much progress, image processing remains a significant bottleneck for high-throughput analysis of microscopy data. One popular platform for single-cell time-lapse imaging is the mother machine, which enables long-term tracking of microbial cells under precisely controlled growth conditions. While several mother machine image analysis pipelines have been developed in the past several years, adoption by a non-expert audience remains a challenge. To fill this gap, we implemented our own software, MM3, as a plugin for the multidimensional image viewer napari. napari-MM3 is a complete and modular image analysis pipeline for mother machine data, which takes advantage of the high-level interactivity of napari. Here, we give an overview of napari-MM3 and test it against several well-designed and widely used image analysis pipelines, including BACMMAN and DeLTA. Researchers often analyze mother machine data with custom scripts using varied image analysis methods, but a quantitative comparison of the output of different pipelines has been lacking. To this end, we show that key single-cell physiological parameter correlations and distributions are robust to the choice of analysis method. However, we also find that small changes in thresholding parameters can systematically alter parameters extracted from single-cell imaging experiments. Moreover, we explicitly show that in deep learning-based segmentation, 'what you put is what you get' (WYPIWYG) - that is, pixel-level variation in training data for cell segmentation can propagate to the model output and bias spatial and temporal measurements. Finally, while the primary purpose of this work is to introduce the image analysis software that we have developed over the last decade in our lab, we also provide information for those who want to implement mother machine-based high-throughput imaging and analysis methods in their research.
Assuntos
Processamento de Imagem Assistida por Computador , Mães , Feminino , Humanos , Microscopia , Cultura , PesquisadoresRESUMO
Ultra-high-performance concrete (UHPC), a new cement-based material that offers high mechanical strength and good durability, has been widely applied in construction and rehabilitation projects in recent years. An optimum bending system is achieved by positioning the UHPC layer at the bottom tensile zone of the composite beam and placing the normal-strength concrete (NC) layer at the upper compression zone, which is described as the UHPC-NC composite beam. The fatigue behavior of reinforced UHPC-NC composite beams was described in this study, with an emphasis on the effects of UHPC layer thickness and fatigue load level on the fatigue life of the beam, deformation of the interface between UHPC and NC layers, as well as the bending stiffness of the beam. A total of 9 reinforced UHPC-NC composite beams were tested under cyclic loading. The test variables include UHPC layer thicknesses (zero, 200, and 360 mm), reinforcement ratios (1.184% and 1.786%), and the upper load levels (0.39~0.65). The results showed that good bonding had been achieved without delamination between UHPC and NC layers prior to the final fatigue failure of the beam, and the bending stiffness of the composite beam experienced a three-stage reduction under cyclic loading. Furthermore, an equation was proposed to predict the stiffness reduction coefficient of UHPC-NC composite beams under cyclic loading.
RESUMO
Cutaneous wound healing is a challenge in plastic and reconstructive surgery. In theory, cells undergoing mesenchymal transition will achieve re-epithelialization through mesenchymal-epithelial transition at the end of wound healing. But in fact, some pathological stimuli will inhibit this biological process and result in scar formation. If mesenchymal-epithelial transition can be activated at the corresponding stage, the ideal wound healing may be accomplished. Two in vivo skin defect mouse models and dermal-derived mesenchymal cells were used to evaluate the effect of lithium chloride in wound healing. The mesenchymal-epithelial transition was detected by immunohistochemistry staining. In vivo, differentially expressed genes were analysed by transcriptome analyses and the subsequent testing was carried out. We found that lithium chloride could promote murine cutaneous wound healing and facilitate mesenchymal-epithelial transition in vivo and in vitro. In lithium chloride group, scar area was smaller and the collagen fibres are also orderly arranged. The genes related to mesenchyme were downregulated and epithelial mark genes were activated after intervention. Moreover, transcriptome analyses suggested that this effect might be related to the inhibition of CXCL9 and IGF2, subsequent assays demonstrated it. Lithium chloride can promote mesenchymal-epithelial transition via downregulating CXCL9 and IGF2 in murine cutaneous wound healing, the expression of IGF2 is regulated by ß-catenin. It may be a potential promising therapeutic drug for alleviating postoperative scar and promoting re-epithelialization in future.
Assuntos
Cicatriz , Cloreto de Lítio , Animais , Camundongos , Cloreto de Lítio/farmacologia , Diferenciação Celular , Cicatrização , PeleRESUMO
Since the MerR family is known for its special regulatory mechanism, we aimed to explore which factors determine the expression activity of the mer promoter. The Tn501/Tn21 mer promoter contains an abnormally long spacer (19 bp) between the -35 and -10 elements, which is essential for the unique DNA distortion mechanism. To further understand the role of base sequences in the mer promoter spacer, this study systematically engineered a series of mutant derivatives and used luminescent and fluorescent reporter genes to investigate the expression activity of these derivatives. The results reveal that the expression activity of the mer promoter is synergistically modulated by the spacer length (17 bp is optimal) and the region upstream of -10 (especially -13G). The spacing is regulated by MerR transcription factors through symmetrical sequences, and -13G presumably functions through interaction with the RNA polymerase sigma-70 subunit.