Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 39
Filtrar
1.
Neurogenetics ; 2024 Jul 03.
Artigo em Inglês | MEDLINE | ID: mdl-38958838

RESUMO

Glioma, a type of brain tumor, poses significant challenges due to its heterogeneous nature and limited treatment options. Interferon-related genes (IRGs) have emerged as potential players in glioma pathogenesis, yet their expression patterns and clinical implications remain to be fully elucidated. We conducted a comprehensive analysis to investigate the expression patterns and functional enrichment of IRGs in glioma. This involved constructing protein-protein interaction networks, heatmap analysis, survival curve plotting, diagnostic and prognostic assessments, differential expression analysis across glioma subgroups, GSVA, immune infiltration analysis, and drug sensitivity analysis. Our analysis revealed distinct expression patterns and functional enrichment of IRGs in glioma. Notably, IFNW1 and IFNA21 were markedly downregulated in glioma tissues compared to normal tissues, and higher expression levels were associated with improved overall survival and disease-specific survival. Furthermore, these genes showed diagnostic capabilities in distinguishing glioma tissues from normal tissues and were significantly downregulated in higher-grade and more aggressive gliomas. Differential expression analysis across glioma subgroups highlighted the association of IFNW1 and IFNA21 expression with key pathways and biological processes, including metabolic reprogramming and immune regulation. Immune infiltration analysis revealed their influence on immune cell composition in the tumor microenvironment. Additionally, elevated expression levels were associated with increased resistance to chemotherapeutic agents. Our findings underscore the potential of IFNW1 and IFNA21 as diagnostic biomarkers and prognostic indicators in glioma. Their roles in modulating glioma progression, immune response, and drug sensitivity highlight their significance as potential therapeutic targets. These results contribute to a deeper understanding of glioma biology and may inform the development of personalized treatment strategies for glioma patients.

2.
Ecol Evol ; 14(6): e11577, 2024 Jun.
Artigo em Inglês | MEDLINE | ID: mdl-38873020

RESUMO

Understanding the processes and mechanisms that shape the distribution patterns and variations of biodiversity along spatial gradients continues to be a priority for ecological research. We focused on the biodiversity of benthic diatom communities within a large near-natural watershed. The objectives are: (1) to explore the overall spatial patterns of benthic diatom biodiversity; (2) to investigate the effects associated with watercourse position and environmental variables, as well as both common and rare species on two facets (i.e., taxonomic and functional) of alpha and beta diversity; and (3) to unveil the mechanisms underlying their spatial variations. Alpha diversity indices along the stream watercourse showed a clear increasing trend from upstream to downstream sites. Results of random forest regression identified conductivity as the primary factor influencing functional alpha diversity, while elevation emerged as the predominant factor for taxonomic alpha diversity. Beta diversity partitioning revealed that taxonomic beta diversity generally exceeded functional beta diversity. These diversity measures exhibited different patterns along the watercourse position: taxonomic beta diversity remained relatively consistent along the watercourse, whereas functional total beta diversity and its two components of middle stream sites were lower than those of upstream and downstream sites. Functional beta diversity was sustained by dominant and common species, while rare species made significant contributions to taxonomic beta diversity. Both taxonomic and functional beta diversity and its components displayed a stronger influence from spatial factors than from local environmental, geo-climatic, and nutrient variables. Collectively, taxonomic and functional alpha and beta diversity demonstrated distinct responses to the main environmental gradients and spatial factors within our catchment, highlighting their different insights into diatom diversity. Furthermore, research is required to assess the generalizability of our findings to similar ecosystems. In addition, this study presents opportunities for expansion to include other taxa (e.g., macroinvertebrates and fish) to gain a comprehensive understanding of the driving mechanisms behind stream biodiversity.

3.
Environ Res ; 255: 119174, 2024 Aug 15.
Artigo em Inglês | MEDLINE | ID: mdl-38763284

RESUMO

In near-natural basins, zooplankton are key hubs for maintaining aquatic food webs and organic matter cycles. However, the spatial patterns and drivers of zooplankton in streams are poorly understood. This study registered 165 species of zooplankton from 147 sampling sites (Protozoa, Rotifers, Cladocera and Copepods), integrating multiple dimensions (i.e., taxonomic, functional, and phylogenetic) and components (i.e., total, turnover, and nestedness) of α and ß diversity. This study aims to reveal spatial patterns, mechanisms, correlations, and relative contribution of abiotic factors (i.e., local environment, geo-climatic, land use, and spatial factors) through spatial interpolation (ordinary kriging), mantel test, and variance partitioning analysis (VPA). The study found that α diversity is concentrated in the north, while ß diversity is more in the west, which may be affected by typical habitat, hydrological dynamics and underlying mechanisms. Taxonomic and phylogenetic ß diversity is dominated by turnover, and metacommunity heterogeneity is the result of substitution of species and phylogeny along environmental spatial gradients. Taxonomic and phylogenetic ß diversity were strongly correlated (r from 0.91 to 0.95), mainly explained by historical/spatial isolation processes, community composition, generation time, and reproductive characteristics, and this correlation provides surrogate information for freshwater conservation priorities. In addition, spatial factors affect functional and phylogenetic α diversity (26%, 28%), and environmental filtering and spatial processes combine to drive taxonomic α diversity (10%) and phylogenetic ß diversity (11%). Studies suggest that spatial factors are key to controlling the community structure of zooplankton assemblages in near-natural streams, and that the relative role of local environments may depend on the dispersal capacity of species. In terms of diversity conservation, sites with high variation in uniqueness should be protected (i) with a focus on the western part of the thousand islands lake catchment and (ii) increasing effective dispersal between communities to facilitate genetic and food chain transmission.


Assuntos
Biodiversidade , Rios , Zooplâncton , Animais , Zooplâncton/classificação , Filogenia , Ecossistema
4.
Front Plant Sci ; 15: 1356861, 2024.
Artigo em Inglês | MEDLINE | ID: mdl-38504886

RESUMO

Introduction: In contemporary agriculture, the substitution of manure for chemical fertilizer based on phosphorus (P) input in vegetable production has led to a significant reduction in P fertilizer application rates, while, the effect of manure substitution rates on soil P transformation and uptake by root remain unclear. Methods: This research conducts a pot experiment with varying manure substitution rates (0%, 10%, 20%, 30%, 40%, 50%, 75% and 100%) based on P nutrient content to elucidate the mechanisms through which manure substitution affects P uptake in pepper. Results and discussion: The result showed that shoot and root biomass of pepper gradually increased as manure substitution rate from 10% to 40%, and then gradually decreased with further increases in the substitution rate. Soil alkaline phosphatase activity and arbuscular mycorrhizal (AM) colonization gradually increased with manure substitution rates improvement. Specifically, when the substitution rate reached 30%-40%, the alkaline phosphatase activity increased by 24.5%-33.8% compared to the fertilizer treatment. In contrast, phytase activity and the relative expression of phosphate transporter protein genes in the root system was declined after peaking at 30% manure substitution. Additionally, soil available P remained moderate under 30%-40% substitution rate, which was reduced by 8.6%-10.2% compared to that in chemical fertilizer treatment, while microbial biomass P was comparable. In the current study, soil labile P similar to or even higher than that in chemical fertilizer treatment when the substitution rate was ≤40%. Correlation heatmaps demonstrated a significant and positive relationship between soil available P and factors related to labile P and moderately labile P. Conclusion: This finding suggested that substituting 30%-40% of chemical P with manure can effectively enhance root length, AM colonization, soil enzyme activity, soil labile P, and consequently improve P uptake in pepper. These findings provide valuable insights for future organic agricultural practices that prioritize P supply, aiming to standardize organic P management in farmland and achieve high crop yields and maintain soil health.

5.
Hum Genomics ; 17(1): 111, 2023 Dec 08.
Artigo em Inglês | MEDLINE | ID: mdl-38062488

RESUMO

BACKGROUND: ß-Thalassemia is mainly caused by point mutations in the ß-globin gene cluster. With the rapid development of sequencing technic, more and more variants are being discovered. RESULTS: In this study, we found two novel deletion mutations in two unrelated families, HBB: c.180delG (termed ßCD59) and HBB: c.382_402delCAGGCTGCCTATCAGAAAGTG (termed ßCD128-134) in family A and B, respectively. Both the two novel mutations lead to ß-thalassemia trait. However, when compounded with other ß0-thalassemia, it may behave with ß-thalassemia intermedia or ß-thalassemia major. CONCLUSION: Our study broadens the variants spectral of ß-thalassemia in Chinese population and provides theoretical guidance for the prenatal diagnosis.


Assuntos
Talassemia beta , Gravidez , Feminino , Humanos , Talassemia beta/genética , Globinas beta/genética , Diagnóstico Pré-Natal , Deleção de Sequência/genética , China , Mutação
7.
J Assist Reprod Genet ; 40(9): 2219-2231, 2023 Sep.
Artigo em Inglês | MEDLINE | ID: mdl-37480419

RESUMO

OBJECTIVE: The purpose of this study was to evaluate the performance of noninvasive prenatal testing (NIPT) for the detection of chromosomal aneuploidies and copy number variations (CNVs) in twin pregnancies. METHOD: A cohort of 2010 women with twin pregnancies was recruited. 1331 patients opted for NIPT, and 679 patients opted for expanded NIPT (NIPT-plus). All high-risk patients were advised to undergo invasive prenatal diagnosis. All participants were followed up until 6 months after birth. RESULTS: Twenty-two cases were predicted to have a high risk of chromosome abnormalities by NIPT, of which 14 pregnant women underwent invasive prenatal diagnosis. The 14 cases included 3 cases of trisomy 21, 1 case of trisomy 18, 1 case of trisomy 7, 2 cases of sex chromosome aneuploidies (SCAs), and 7 cases of CNVs, of which the confirmed cases numbered 2, 1, 0, 1, and 0, respectively. Twenty cases were predicted to have a high risk of chromosome abnormalities by NIPT-plus, of which 16 pregnant women underwent invasive prenatal diagnosis. The 16 cases included 1 case of trisomy 21, 1 case of trisomy 7, 7 cases of SCAs, and 7 cases of CNVs, of which were confirmed in 1, 0, 3, and 2, respectively. No false-negative result was reported during the follow-up period. CONCLUSION: The NIPT/NIPT-plus has excellent performance in the detection of chromosome aneuploidies in twin pregnancies. But for CNVs, the effectiveness of NIPT is poor, and the NIPT-plus have a certain detection efficiency. It is worth noting that pre- and post-genetic counseling is especially important, and the chorionicity, mode of conception, clinical indications, and fetal fraction should be considered as influencing factors.


Assuntos
Síndrome de Down , Teste Pré-Natal não Invasivo , Gravidez , Feminino , Humanos , Síndrome de Down/diagnóstico , Síndrome de Down/epidemiologia , Síndrome de Down/genética , Trissomia/diagnóstico , Trissomia/genética , Variações do Número de Cópias de DNA/genética , Gravidez de Gêmeos/genética , Aberrações Cromossômicas , Aneuploidia , China/epidemiologia
8.
Toxics ; 11(6)2023 Jun 17.
Artigo em Inglês | MEDLINE | ID: mdl-37368639

RESUMO

The study of microplastics and their impact on aquatic ecosystems has received increasing attention in recent years. Drawing from an analysis of 814 papers related to microplastics published between 2013 and 2022 in the Web of Science Core Repository, this paper explores trends, focal points, and national collaborations in freshwater microplastics research, providing valuable insights for future studies. The findings reveal three distinct stages of microplastics: nascent development (2013-2015), slow rise (2016-2018), and rapid development (2019-2022). Over time, the focus of research has shifted from "surface", "effect", "microplastic pollution", and "tributary" to "toxicity", "species", "organism", "threat", "risk", and "ingestion". While international cooperation has become more prevalent, the extent of collaboration remains limited, mostly concentrated among English-speaking countries or English and Spanish/Portuguese-speaking countries. Future research directions should encompass the bi-directional relationship between microplastics and watershed ecosystems, incorporating chemical and toxicological approaches. Long-term monitoring efforts are crucial to assessing the sustained impacts of microplastics.

9.
RSC Adv ; 13(11): 7385-7391, 2023 Mar 01.
Artigo em Inglês | MEDLINE | ID: mdl-36895776

RESUMO

In this study, we report on a novel and effective approach for the encapsulation of the shear thickening fluid in polyurethane polyurea double layer microcapsules. Under the action of dibutyltin disilicate as a catalyst, CD-MDI reacted with polyethylene glycol to form polyurethane inner shell and reacted with diethylenetriamine to form a polyurea outer shell. The results show that the shear thickening liquid was emulsified using liquid paraffin as a solvent and Span80 as a surfactant to form a lotion similar to water-in-oil. The shear thickened droplets can be stably and uniformly dispersed to a diameter of 100 µm at a rotation speed of 800 rpm min-1. The bilayer shell material achieves a good coating effect on STF, which provides support for strength and stress conduction and improves the compatibility between STF and polyurea matrix. The toughness and impact resistance of the composites were analyzed by a universal testing machine and drop hammer impact tester. Finally, compared with the pure polyurea material, the elongation at break of 2% added amount is increased by 22.70%, and the impact resistance of 1% added amount is the best, which is 76.81 N more than that of the pure specimen.

10.
J Assist Reprod Genet ; 40(4): 803-810, 2023 Apr.
Artigo em Inglês | MEDLINE | ID: mdl-36763299

RESUMO

OBJECTIVE: This study aims to evaluate the correlation combined fetal fraction and Z-score for fetal trisomies 13, 18, and 21 of NIPT by the semiconductor sequencing platform and further analyze the differences of different sequencing depths. METHODS: A cohort of 61,581 pregnancies were recruited for NIPT. Invasive prenatal diagnostic confirmation is recommended in all high-risk NIPT cases. Logistic regression and rank correlation analysis were applied to analyze the relationship between different parameters. ROC curve analysis was adopted to analyze the cutoff values of Z-score and fetal fraction. RESULTS: A total of 278 common trisomy pregnancies were verified in 377 NIPT-positive results. The fitted logistic regression models revealed that Z-scores of NIPT-positive results were significantly associated with PPVs (p < 0.05). The ROC curve analysis showed that the optimal cutoff value of Z-scores for T21, T18, and T13 was 7.597, 4.944, and 9.135 for NIPT and 9.489, 8.004, and 12.4 for NIPT-plus. If combing fetal fraction as another evaluation factor, the PPV of trisomy 21 gradually improved. We analyzed the correlation between the fetal fraction and the PPV, which revealed that the fetal fraction was significantly correlated with PPV. By analyzing the PPV of different groups divided by the associated criteria obtained from ROC curve, the PPV of high Z-score and high fetal fraction is higher in groups of Z-score > the optimal cutoff value. CONCLUSION: The results of this study show that the fetal fraction is significantly correlated with the PPV. Combining fetal fraction with Z-score is significantly better than in groups of Z-score-associated criteria; clinicians can give more accurate and efficient prenatal genetic counseling.


Assuntos
Síndrome de Down , Teste Pré-Natal não Invasivo , Gravidez , Feminino , Humanos , Trissomia/diagnóstico , Trissomia/genética , Diagnóstico Pré-Natal/métodos , Síndrome de Down/diagnóstico , Síndrome de Down/genética , Síndrome da Trissomia do Cromossomo 13/diagnóstico , Síndrome da Trissomia do Cromossomo 13/genética
11.
Animals (Basel) ; 12(19)2022 Oct 02.
Artigo em Inglês | MEDLINE | ID: mdl-36230389

RESUMO

One of the key targets of community ecology and biogeography concerns revealing the variability and underlying drivers of biodiversity. Most current studies understand biodiversity based on taxonomic information alone, but few studies have shown the relative contributions of multiple abiotic factors in shaping biodiversity based on taxonomic, functional, and phylogenetic information. We collected 179 samples of macroinvertebrates in the Hun-Tai River Basin. We validated the complementarity between the three facets and components of ß-diversity using the Mantel test. Distance-based redundancy analysis and variance partitioning were applied to explore the comparative importance of local environmental, geo-climatic, and spatial factors on each facet and component of ß-diversity. Our study found that taxonomic and phylogenetic total ß-diversity was mainly forced by turnover, while functional total ß-diversity was largely contributed by nestedness. There is a strong correlation between taxonomic and phylogenetic ß-diversity. However, the correlations of functional with both taxonomic and phylogenetic ß-diversity were relatively weak. The findings of variation partitioning suggested that distinct facets and components of macroinvertebrates' ß-diversity were impacted by abiotic factors to varying degrees. The contribution of spatial factors was greater than that of the local environment and geo-climatic factors for taxonomic, functional, and phylogenetic ß-diversity. Thus, studying different facets and components of ß-diversity allows a clearer comprehension of the influence of abiotic factors on diversity patterns. Therefore, future research should investigate patterns and mechanisms of ß-diversity from taxonomic, functional, and phylogenetic perspectives.

12.
Molecules ; 27(19)2022 Oct 01.
Artigo em Inglês | MEDLINE | ID: mdl-36235017

RESUMO

Nuclear accidents and decommissioning in the nuclear industry would release a large number of radioactive aerosols which endangers the natural environment and the health of workers. Therefore, there is an urgent need for environment-friendly aerosol suppressants to control and handle environmental pollution problems caused by radioactive aerosols. In this paper, sodium alginate (SA), a type of polyphenol material (TP), and alkyl glycosides (APGs) were selected as the components of the compound aerosol suppressant and the optimal proportion was generated via the method of D-optimal mixture design. Furthermore, the cesium aerosol sedimentation effect of the optimized compound aerosol suppressants was evaluated via sedimentation efficiency, the change in particle concentration cumulative concentration fraction of the cesium aerosol sedimentation process. The results showed that the aerosol sedimentation efficiency was 99.82% which was much higher than nature settlement, 18.6% and water spraying sedimentation, 43.3%. Moreover, after spraying the compound suppressant, it displayed a good effect on settling the cesium aerosol particles with a diameter of less than 1 µm, as the concentration of particles was reduced from 55.49% to 44.53%. Finally, the sedimentation mechanism of the compound aerosol suppressant and cesium aerosol particles, such as the coagulation effect, was analyzed using the particle size distribution.


Assuntos
Césio , Polifenóis , Aerossóis , Alginatos , Biomassa , Glicosídeos , Humanos , Tamanho da Partícula , Água
13.
Zhonghua Yi Xue Yi Chuan Xue Za Zhi ; 38(11): 1045-1050, 2021 Nov 10.
Artigo em Chinês | MEDLINE | ID: mdl-34729740

RESUMO

OBJECTIVE: To assess the clinical value of non-invasive prenatal testing (NIPT) for the screening of trisomy and copy number variations (CNVs) of chromosomes 21, 18 and 13. METHODS: From January 2015 to December 2019, 40 628 pregnant women underwent NIPT testing using high-throughput sequencing and bioinformatics analysis to test the cell-free fetal DNA in maternal plasma. High-risk pregnant women underwent invasive prenatal diagnosis, while low-risk ones were followed up by telephone. RESULTS: The three most common indications included intermediate risk of serological screening, high risk of serological screening and advanced maternal age. Among all pregnant women, 257 cases were detected as trisomy 21, 18 and 13 (170, 49 and 38 cases, respectively). 227 cases chose invasive prenatal diagnosis, with respectively 122, 28 and 10 cases confirmed. The positive predictive value (PPV) was 81.33% (122/150), 65.12% (28/43), 29.41% (10/34), respectively. Two false negative cases of trisomy 18 were found during follow-up. Meanwhile, NIPT has detected 46 cases (15, 16 and 15 cases, respectively) CNVs on chromosomes 21, 18 and 13, among which 37 cases underwent invasive prenatal diagnosis. There were 5, 3 and 5 positive cases, which yielded a PPV of 41.67% (5/12), 25%(3/12) and 33.33%(5/15), respectively. Two other chromosome CNVs were accidentally discovered among the false positive samples. CONCLUSION: The incidence of chromosomal abnormalities in the serological screening high-risk group was 52.02%, which was significantly higher than other groups. NIPT has a high sensitivity and specificity for the screening of trisomies 21, 18 and 13, while its accuracy for detecting CNVs of chromosomes 21, 18 and 13 needs to be improved. As a screening method, NIPT has a great clinical value, though there are still limitations of false positive and false negative results.Comprehensive pre- and post-test genetic counseling should be provided to the patients.


Assuntos
Transtornos Cromossômicos , Síndrome de Down , Aneuploidia , Transtornos Cromossômicos/diagnóstico , Transtornos Cromossômicos/genética , Cromossomos , Variações do Número de Cópias de DNA , Síndrome de Down/diagnóstico , Síndrome de Down/genética , Feminino , Humanos , Gravidez , Diagnóstico Pré-Natal , Trissomia/diagnóstico , Trissomia/genética , Síndrome da Trissomía do Cromossomo 18/genética
14.
Am J Transl Res ; 13(8): 9260-9268, 2021.
Artigo em Inglês | MEDLINE | ID: mdl-34540042

RESUMO

OBJECTIVE: This study explored the effect of respiratory function training under the mode of mutual-help of patients to the postoperative pulmonary infection and immune function on lung cancer. METHODS: 116 lung cancer patients who received surgical treatment from June 2018 to June 2019 were enrolled as the object. Patients were categorized into a control or observation group, according to the admission time of patients. Each group contained 58 subjects. The control-group was given regular nursing intervention, and the observation-group received respiratory function training under the mode of mutual assist between patients. Subsequently, the postoperative pulmonary infection, pulmonary function, and the changes of immune function before and after surgery were compared between the two groups. RESULT: The pulmonary infection rate of the group for observation was much lower than that of the control-group. The difference was statistically significant (5.17%, 17.24%, = 0.0394). The postoperative pulmonary function indexes in the observation-group were conspicuously better than those in control-group, the difference was statistically conspicuous (P<0.05). After nursing intervention, the cellular immune factors TNF-α, IL-8, and IL-6 of the two groups were conspicuously lower than those before the nursing intervention, and the decrease in the observation-group was remarkably greater than that in control-group, with the difference of statistical significance (P<0.05). In addition, the T cell subsets CD4+ and CD4+/CD8+ in the observation-group were conspicuously higher than those in the control-group. CD8+ in the observation-group was conspicuously lower than that in the group of control, with statistical significance (P<0.05). CONCLUSION: The respiratory function training under the mode of mutual-assist of patients can effectively reduce the incidence of postoperative pulmonary infection, improve the postoperative pulmonary function index, and improve the immune function, which is worthy of clinical promotion.

15.
Hum Genomics ; 15(1): 41, 2021 07 02.
Artigo em Inglês | MEDLINE | ID: mdl-34215332

RESUMO

OBJECTIVE: To evaluate the performance of noninvasive prenatal testing (NIPT) and NIPT-PLUS for the detection of genome-wide microdeletion and microduplication syndromes (MMSs) at different sequencing depths. The NIPT sequencing depth was 0.15X, and the data volume was 3 million reads; the NIPT-PLUS sequencing depth was 0.4X, and the data volume was 8 million reads. METHODS: A cohort of 50,679 pregnancies was recruited. A total of 42,969 patients opted for NIPT, and 7710 patients opted for NIPT-PLUS. All high-risk cases were advised to undergo invasive prenatal diagnosis and were followed up. RESULTS: A total of 373 cases had a high risk of a copy number variation (CNV) as predicted by NIPT and NIPT-PLUS: NIPT predicted 250 high-risk CNVs and NIPT-PLUS predicted 123. NIPT-PLUS increased the detection rate by 1.02% (0.58% vs 1.60%, p < 0.001). A total of 291 cases accepted noninvasive prenatal diagnosis, with 197 cases of NIPT and 94 cases of NIPT-PLUS. The PPV of CNV > 10 Mb for NIPT-PLUS was significantly higher than that for NIPT (p = 0.02). The total PPV of NIPT-PLUS was 12.56% higher than that of NIPT (43.61% vs 30.96%, p = 0.03). CONCLUSION: NIPT-PLUS had a better performance in detecting CNVs in terms of the total detection rate and total PPV. However, great care must be taken in presenting results and providing appropriate counseling to patients when deeper sequencing is performed in clinical practice.


Assuntos
Variações do Número de Cópias de DNA/genética , Deleção de Genes , Duplicação Gênica/genética , Teste Pré-Natal não Invasivo/métodos , Adulto , Feminino , Genoma Humano/genética , Sequenciamento de Nucleotídeos em Larga Escala , Humanos , Recém-Nascido , Gravidez , Diagnóstico Pré-Natal , Semicondutores
16.
J Assist Reprod Genet ; 38(3): 727-734, 2021 Mar.
Artigo em Inglês | MEDLINE | ID: mdl-33564935

RESUMO

BACKGROUND: Noninvasive prenatal testing (NIPT) has been widely used to screen for fetal aneuploidies, including fetal sex chromosome aneuploidies (SCAs). However, there is less information on the performance of NIPT in detecting SCAs. METHODS: A cohort of 47,800 pregnancies was recruited to review the high-risk NIPT results for SCAs. Cell-free fetal DNA (cffDNA) was extracted and sequenced. All NIPT high-risk cases were recommended to undergo invasive prenatal diagnosis for karyotyping analysis and chromosome microarray analysis (CMA). RESULTS: A total of 238 high-risk cases were detected by NIPT, including 137 cases of 45,X, 27 cases of 47,XXX, and 74 cases of 47,XYY/47,XXY. Prenatal diagnosis, including karyotyping analysis and CMA, was available in 170 cases. The positive predictive value (PPV) was 30.00% for 45,X, 70.58% for 47,XXX, and 81.13% for 47,XYY/47,XXY. In addition, 13 cases of sex chromosome mosaicism and 9 cases of sex chromosome CNVs were incidentally found in this study. CONCLUSION: Our study showed that NIPT was reliable for screening SCAs based on a large sample, and it performed better in predicting sex chromosome trisomies than monosomy X. Our study will provide an important reference for clinical genetic counseling and further processing of the results.


Assuntos
Variações do Número de Cópias de DNA , Fertilização in vitro/métodos , Testes Genéticos/métodos , Diagnóstico Pré-Implantação/métodos , Transtornos dos Cromossomos Sexuais/diagnóstico , Cromossomos Sexuais/genética , Adolescente , Adulto , Transferência Embrionária , Feminino , Humanos , Pessoa de Meia-Idade , Gravidez , Resultado da Gravidez , Taxa de Gravidez , Estudos Retrospectivos , Transtornos dos Cromossomos Sexuais/genética , Adulto Jovem
17.
Zhongguo Shi Yan Xue Ye Xue Za Zhi ; 28(4): 1381-1385, 2020 Aug.
Artigo em Chinês | MEDLINE | ID: mdl-32798430

RESUMO

OBJECTIVE: To investigate the clinical characteristics and prognostic risk factors of HLH children with central nervous system (CNS) involvement so as to provide more reference for further improving the prognosis of HLH children. METHODS: The clinical data of 45 HLH children with CNS involvement treated in our hospital from January 2006 to October 2016 were collected and analyzed retrospectively. The clinical characteristics of HLH children with CNS involvement were recorded, moreover the possible factors influencing the prognosis of HLH children with CNS involvement were analyzed using univariate and multivariate analysis through the establishment of Cox risk ratio model. RESULTS: Among 45 HLH children with CNS involvement, male was 19 cases and female was 26 cases. The median age of 4.0 years old (1.0-15.1). The detection showed that EBV found in 38 cases (84.44%), CMV infection in 1 case (2.22%), bacterial infection in 3 cases (6.67%), connection tissue disease in 1 case (2.22%) and indefinite etiology infection in 2 cases (4.44%). After lumbar puncture of 27 HLH children with CNS involvement, 10 cases (37.04%) showed cerebrospinal fluid abnormality. In addition, 22 cases showed the craniography abnormality. The follow-up results showed that the OS rate of 1 year was 46.67% (21/45), the OS rate of 3 years was 44.44% (20/45); the median survival time was 5.0 months. The OS analysis indicated that 1 years OS rate of diseased children with cerebrospinal fluid abnormality was significantly lower than that of diseased children with cerebrospinal fluid normality (10/45 vs 17/45) (P<0.05), and 1 years OS rate of diseased children who not received intrathecal injection was significantly lower that of diseased children who received intrathecal (10/45 vs 17/45) (P<0.05). The univariate analysis showed that the symptoms of nervous system, abnormal cerebrospinal fluid, absence of intrathecal injection and treatment schedule all were the risk factors affecting the prognosis of HLH children with CNS involvement (P<0.05). The multivariate analysis by Cox risk model showed that abnormal cerebrospinal fluid and absence of intrathecal injection were independent risk factors for of HLH children with CNS involvement (P<0.05). CONCLUSION: The clinical prognosis of HLH children with CNS involvement is relatively poor, moreover some of HLH children with CNS involvement have neural sequelae. The cerebrospinal fluid abnormality and absence of intrathecal injection are independent risk factors leading to poor prognosis for HLH clildren with CNS involvement.


Assuntos
Infecções por Citomegalovirus , Sistema Nervoso , Criança , Pré-Escolar , Feminino , Humanos , Masculino , Prognóstico , Estudos Retrospectivos , Fatores de Risco
18.
Photodiagnosis Photodyn Ther ; 30: 101761, 2020 Jun.
Artigo em Inglês | MEDLINE | ID: mdl-32283311

RESUMO

Xeroderma pigmentosum (XP) is a rare autosomal recessive dermatosis that is often complicated by multiple skin tumours at exposed locations, which are difficult to treat. We report a case of a 12-year-old girl with XP treated with oral retinoic acid and photodynamic therapy (PDT) with good clinical results. She had an 8-year history of multiple skin lesions that first appeared on her nasal dorsum, but gradually increased in size and spread to her entire face, neck, and upper limbs. Notably, the lesions became evidently aggravated after sun exposure. When she was 6 years old, sesame-seed-sized papules and plaques appeared, which were fragile and irregular in shape and would self-rupture, accompanied with slight itchiness and bloody exudate. Examination revealed multiple basal cell carcinomas. The tumours were treated with local carbon dioxide laser therapy combined with PDT. On the follow-up visit 2 months after the surgery, most of the skin lesions on her face had subsided. In cases of multiple tumours, PDT can be the treatment method of choice because it is less invasive, has less side effects, and does not damage the surrounding normal tissues.


Assuntos
Carcinoma Basocelular/tratamento farmacológico , Lasers de Gás/uso terapêutico , Fotoquimioterapia/métodos , Neoplasias Cutâneas/tratamento farmacológico , Tretinoína/uso terapêutico , Xeroderma Pigmentoso/tratamento farmacológico , Carcinoma Basocelular/complicações , Criança , Quimioterapia Combinada , Face , Feminino , Hematoporfirinas/uso terapêutico , Humanos , Fármacos Fotossensibilizantes/uso terapêutico , Neoplasias Cutâneas/complicações , Xeroderma Pigmentoso/complicações , Xeroderma Pigmentoso/patologia
19.
Oncol Lett ; 19(3): 2097-2106, 2020 Mar.
Artigo em Inglês | MEDLINE | ID: mdl-32194707

RESUMO

The present study aimed to investigate the curative effect of high-dose methotrexate (HD-MTX) combined with teniposide (Vm26) vs. HD-MTX alone in the treatment of primary central nervous system lymphoma (PCNSL), in order to provide data for assisting decisions associated with clinical treatment. Data from 56 patients with PCNSL admitted in Shanghai Huashan Hospital (Shanghai, China) from January 2009 to December 2014 were included into the present study. Clinical data, curative effects and prognosis of patients in these two groups were retrospectively analyzed using SPSS 20 statistical software. In the HD-MTX+Vm26 group, 12 patients (42.85%) achieved complete remission (CR) and 10 patients (35.71%) achieved partial remission (PR), while in the HD-MTX group 7 patients (25%) achieved CR and 11 patients (39.29%) achieved PR (P=0.158). The median progression-free survival (PFS) time was 22 months in the HD-MTX+Vm26 group and 12 months in the HD-MTX group (P=0.019). The median overall survival time was 57 months in the HD-MTX+Vm26 group, and 28 months in the HD-MTX group (P=0.013). Compared with HD-MTX alone, the combined treatment of HD-MTX+Vm26 had an improved curative effect in the treatment of PCNSL, effectively controlled tumor progression in patients, prolonged survival time and improved prognosis. Age was an independent prognostic factor in patients with PCNSL. Patients with an age of ≤60 years exhibited longer PFS compared with patients with an age of >60 years.

20.
Hum Genomics ; 13(1): 62, 2019 12 04.
Artigo em Inglês | MEDLINE | ID: mdl-31801621

RESUMO

BACKGROUND: The identification of cell-free fetal DNA (cffDNA) facilitated non-invasive prenatal screening (NIPS) through analysis of cffDNA in maternal plasma. However, challenges regarding its clinical implementation become apparent. Factors affecting fetal fraction should be clarified to guide its clinical application. RESULTS: A total of 13,661 pregnant subjects with singleton pregnancies who undertook NIPS were included in the study. Relationship of gestational age, maternal BMI, and maternal age with the cffDNA fetal fraction in maternal plasmas for NIPS was investigated. Compared with 13 weeks (12.74%) and 14-18 weeks group (12.73%), the fetal fraction in gestational ages of 19-23 weeks, 24-28 weeks, and more than 29 weeks groups significantly increased to 13.11%, 16.14%, and 21.17%, respectively (P < 0.01). Compared with fetal fraction of 14.54% in the maternal BMI group of < 18.5 kg/m2, the percentage of fetal fraction in the group of 18.5-24.9 kg/m2 (13.37%), 25-29.9 kg/m2 (12.20%), 30-34.9 kg/m2 (11.32%), and 35-39.9 kg/m2 (11.57%) decreased significantly (P < 0.01). Compared with the fetal fraction of 14.38% in the group of 18-24 years old, the fetal fraction in the maternal age group of 25-29 years old group (13.98%) (P < 0.05), 30-34 years old group (13.18%) (P < 0.01), 35-39 years old group (12.34%) (P < 0.01), and ≥ 40 years old (11.90%) group (P < 0.01) decreased significantly. CONCLUSIONS: The percentage of fetal fraction significantly increased with increase of gestational age. Decreased fetal fraction with increasing maternal BMI was found. Maternal age was also negatively related to the fetal fraction.


Assuntos
Ácidos Nucleicos Livres/sangue , Feto/metabolismo , Teste Pré-Natal não Invasivo , Adulto , Índice de Massa Corporal , Feminino , Idade Gestacional , Humanos , Gravidez
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA