RESUMO
The increasing prevalence of drought events poses a major challenge for upcoming crop production. Melatonin is a tiny indolic tonic substance with fascinating regulatory functions in plants. While plants can respond in several ways to alleviate drought stress, the processes underpinning stress sensing and signaling are poorly understood. Hereafter, the objectives of this investigation were to explore the putative functions of melatonin in the regulation of sugar metabolism and abscisic acid biosynthesis in drought-stressed tomato seedlings. Melatonin (100 µM) and/or water were foliar sprayed, followed by the plants being imposed to drought stress for 14 days. Drought stress significantly decreased biomass accumulation, inhibited photosynthetic activity, and stimulated senescence-associated gene 12 (SAG12) expression. Melatonin treatment effectively reversed drought-induced growth retardation as evidenced by increased leaf pigment and water balance and restricted abscisic acid (ABA) accumulation. Sugar accumulation, particularly sucrose content, was higher in drought-imposed seedlings, possibly owing to higher transcription levels of sucrose non-fermenting 1-related protein kinase 2 (SnKR2.2) and ABA-responsive element binding factors 2 (AREB2). Melatonin addition further uplifted the sucrose content, which coincided with increased activity of sucrose synthase (SS, 130%), sucrose phosphate synthase (SPS, 137%), starch degradation encoding enzyme ß-amylase (BAM, 40%) and α-amylase (AMY, 59%) activity and upregulated their encoding BAM1(10.3 folds) and AMY3 (8.1 folds) genes expression at day 14 relative to the control. Under water deficit conditions, melatonin supplementation decreased the ABA content (24%) and its biosynthesis gene expressions. Additionally, sugar transporter subfamily genes SUT1 and SUT4 expression were upregulated by the addition of melatonin. Collectively, our findings illustrate that melatonin enhances drought tolerance in tomato seedlings by stimulating sugar metabolism and negatively regulating ABA synthesis.
Assuntos
Ácido Abscísico , Secas , Regulação da Expressão Gênica de Plantas , Melatonina , Plântula , Solanum lycopersicum , Sacarose , Ácido Abscísico/metabolismo , Melatonina/farmacologia , Melatonina/metabolismo , Solanum lycopersicum/efeitos dos fármacos , Solanum lycopersicum/genética , Solanum lycopersicum/fisiologia , Solanum lycopersicum/metabolismo , Plântula/efeitos dos fármacos , Plântula/genética , Plântula/fisiologia , Plântula/metabolismo , Sacarose/metabolismo , Regulação da Expressão Gênica de Plantas/efeitos dos fármacos , Proteínas de Plantas/genética , Proteínas de Plantas/metabolismo , Estresse Fisiológico , Folhas de Planta/metabolismo , Folhas de Planta/efeitos dos fármacos , Folhas de Planta/fisiologia , Folhas de Planta/genética , Glucosiltransferases/metabolismo , Glucosiltransferases/genéticaRESUMO
Strigolactones (SLs) constitute essential phytohormones that control pathogen defense, resilience to phosphate deficiency and abiotic stresses. Furthermore, SLs are released into the soil by roots, especially in conditions in which there is inadequate phosphate or nitrogen available. SLs have the aptitude to stimulate the root parasite plants and symbiotic cooperation with arbuscular mycorrhizal (AM) fungi in rhizosphere. The use of mineral resources, especially phosphorus (P), by host plants is accelerated by AMF, which also improves plant growth and resilience to a series of biotic and abiotic stresses. Thus, these SL treatments that promote rhizobial symbiosis are substitutes for artificial fertilizers and other chemicals, supporting ecologically friendly farming practices. Moreover, SLs have become a fascinating target for abiotic stress adaptation in plants, with an array of uses in sustainable agriculture. In this review, the biological activity has been summarized that SLs as a signaling hormone for AMF symbiosis, nutrient acquisition, and abiotic stress tolerance through interaction with other hormones. Furthermore, the processes behind the alterations in the microbial population caused by SL are clarified, emphasizing the interplay with other signaling mechanisms. This review covers the latest developments in SL studies as well as the properties of SLs on microbial populations, plant hormone transductions, interactions and abiotic stress tolerance.
RESUMO
BACKGROUND: In recent years, with benefits from the continuous improvement of clinical technology and the advantage of fertility preservation, the application of embryo cryopreservation has been growing rapidly worldwide. However, amidst this growth, concerns about its safety persist. Numerous studies have highlighted the elevated risk of perinatal complications linked to frozen embryo transfer (FET), such as large for gestational age (LGA) and hypertensive disorders during pregnancy. Thus, it is imperative to explore the potential risk of embryo cryopreservation and its related mechanisms. METHODS: Given the strict ethical constraints on clinical samples, we employed mouse models in this study. Three experimental groups were established: the naturally conceived (NC) group, the fresh embryo transfer (Fresh-ET) group, and the FET group. Blastocyst formation rates and implantation rates were calculated post-embryo cryopreservation. The impact of FET on fetal growth was evaluated upon fetal and placental weight. Placental RNA-seq was conducted, encompassing comprehensive analyses of various comparisons (Fresh-ET vs. NC, FET vs. NC, and FET vs. Fresh-ET). RESULTS: Reduced rates of blastocyst formation and implantation were observed post-embryo cryopreservation. Fresh-ET resulted in a significant decrease in fetal weight compared to NC group, whereas FET reversed this decline. RNA-seq analysis indicated that the majority of the expression changes in FET were inherited from Fresh-ET, and alterations solely attributed to embryo cryopreservation were moderate. Unexpectedly, certain genes that showed alterations in Fresh-ET tended to be restored in FET. Further analysis suggested that this regression may underlie the improvement of fetal growth restriction in FET. The expression of imprinted genes was disrupted in both FET and Fresh-ET groups. CONCLUSION: Based on our experimental data on mouse models, the impact of embryo cryopreservation is less pronounced than other in vitro manipulations in Fresh-ET. However, the impairment of the embryonic developmental potential and the gene alterations in placenta still suggested it to be a risky operation.
Assuntos
Criopreservação , Transferência Embrionária , Placenta , Criopreservação/métodos , Feminino , Gravidez , Animais , Camundongos , Transferência Embrionária/métodos , Placenta/metabolismo , Embrião de Mamíferos , Implantação do Embrião/genética , Desenvolvimento Fetal/genética , Blastocisto/metabolismoRESUMO
BACKGROUND: Maternal diabetes mellitus can influence the development of offspring. Gestational diabetes mellitus (GDM) creates a short-term intrauterine hyperglycaemic environment in offspring, leading to glucose intolerance in later life, but the long-term effects and specific mechanism involved in skeletal muscle dysfunction in offspring remain to be clarified. METHODS: Pregnant mice were divided into two groups: The GDM group was intraperitoneally injected with 100 mg/kg streptozotocin on gestational days (GDs) 6.5 and 12.5, while the control (CTR) group was treated with vehicle buffer. Only pregnant mice whose random blood glucose level was higher than 16.8 mmol/L beginning on GD13.5 were regarded as the GDM group. The growth of the offspring was monitored, and the glucose tolerance test was performed at different time points. Body composition analysis and immunohistochemical methods were used to evaluate the development of lean mass at 8 weeks. The exercise capacity and grip strength of the male mouse offspring were assessed at the same period. Transmission electron microscopy was used to observe the morphology inside skeletal muscle at 8 weeks and as a foetus. The genes and proteins associated with mitochondrial biogenesis and oxidative metabolism were investigated. We also coanalyzed RNA sequencing and proteomics data to explore the underlying mechanism. Chromatin immunoprecipitation and bisulfite-converted DNA methylation detection were performed to evaluate this phenomenon. RESULTS: Short-term intrauterine hyperglycaemia inhibited the growth and reduced the lean mass of male offspring, leading to decreased endurance exercise capacity. The myofiber composition of the tibialis anterior muscle of GDM male offspring became more glycolytic and less oxidative. The morphology and function of mitochondria in the skeletal muscle of GDM male offspring were destroyed, and coanalysis of RNA sequencing and proteomics of foetal skeletal muscle showed that mitochondrial elements and lipid oxidation were consistently impaired. In vivo and in vitro myoblast experiments also demonstrated that high glucose concentrations impeded mitochondrial organisation and function. Importantly, the transcription of genes associated with mitochondrial biogenesis and oxidative metabolism decreased at 8 weeks and during the foetal period. We predicted Ppargc1α as a key upstream regulator with the help of IPA software. The proteins and mRNA levels of Ppargc1α in the skeletal muscle of GDM male offspring were decreased as a foetus (CTR vs. GDM, 1.004 vs. 0.665, p = 0.002), at 6 weeks (1.018 vs. 0.511, p = 0.023) and 8 weeks (1.006 vs. 0.596, p = 0.018). In addition, CREB phosphorylation was inhibited in GDM group, with fewer activated pCREB proteins binding to the CRE element of Ppargc1α (1.042 vs. 0.681, p = 0.037), Pck1 (1.091 vs. 0.432, p = 0.014) and G6pc (1.118 vs. 0.472, p = 0.027), resulting in their decreased transcription. Interestingly, we found that sarcopenia and mitochondrial dysfunction could even be inherited by the next generation. CONCLUSIONS: Short-term intrauterine hyperglycaemia significantly reduced lean mass in male offspring at 8 weeks, resulting in decreased exercise endurance and metabolic disorders. Disrupted organisation and function of the mitochondria in skeletal muscle were also observed among them. Foetal exposure to hyperglycaemia decreased the ratio of phosphorylated CREB and reduced the transcription of Ppargc1α, which inhibited the transcription of downstream genes involving in mitochondrial biogenesis and oxidative metabolism. Abnormal mitochondria, which might be transmitted through aberrant gametes, were also observed in the F2 generation.
Assuntos
Proteína de Ligação ao Elemento de Resposta ao AMP Cíclico , Diabetes Gestacional , Hiperglicemia , Músculo Esquelético , Coativador 1-alfa do Receptor gama Ativado por Proliferador de Peroxissomo , Efeitos Tardios da Exposição Pré-Natal , Transdução de Sinais , Animais , Feminino , Coativador 1-alfa do Receptor gama Ativado por Proliferador de Peroxissomo/metabolismo , Gravidez , Camundongos , Masculino , Músculo Esquelético/metabolismo , Diabetes Gestacional/metabolismo , Hiperglicemia/metabolismo , Efeitos Tardios da Exposição Pré-Natal/metabolismo , Proteína de Ligação ao Elemento de Resposta ao AMP Cíclico/metabolismo , Diabetes Mellitus Experimental/metabolismo , Mitocôndrias/metabolismo , Glicemia/metabolismoRESUMO
OBJECTIVE: To assess electrocardiogram (ECG) for risk stratification in inferior ST-elevation myocardial infarction (STEMI) patients within 24 h. METHODS: Three hundred thirty-four patients were divided into four ECG-based groups: Group A: R V1 <0.3 mV with ST-segment elevation (ST↑) V7-V9, Group B: R V1 <0.3 mV without ST↑ V7-V9, Group C: R V1 ≥0.3 mV with ST↑ V7-V9, and Group D: R V1 ≥0.3 mV without ST↑ V7-V9. RESULTS: Group A demonstrated the longest QRS duration, followed by Groups B, C, and D. ECG signs for right ventricle (RV) infarction were more common in Groups A and B (p < .01). ST elevation in V6, indicative of left ventricle (LV) lateral injury, was more higher in Group C than in Group A, while the ∑ST↑ V3R + V4R + V5R, representing RV infarction, showed the opposite trend (p < .05). The estimated LV infarct size from ECG was similar between Groups A and C, yet Group A had higher creatine kinase MB isoform (CK-MB; p < .05). Cardiac troponin I (cTNI) was higher in Groups A and C than in B and D (p < .05 and p = .16, respectively). NT-proBNP decreased across groups (p = .20), with the highest left ventricular ejection fraction (LVEF) observed in Group D (p < .05). Group A notably demonstrated more cardiac dysfunction within 4 h post-onset. CONCLUSIONS: For inferior STEMI patients, concurrent R V1 <0.3 mV with ST↑ V7-V9 suggests prolonged ventricular activation and notable myocardial damage. RV infarction's dominance over LV lateral injury might explain these observations.
Assuntos
Infarto Miocárdico de Parede Inferior , Infarto do Miocárdio , Infarto do Miocárdio com Supradesnível do Segmento ST , Humanos , Infarto Miocárdico de Parede Inferior/complicações , Infarto Miocárdico de Parede Inferior/diagnóstico , Eletrocardiografia , Infarto do Miocárdio com Supradesnível do Segmento ST/complicações , Infarto do Miocárdio com Supradesnível do Segmento ST/diagnóstico , Relevância Clínica , Volume Sistólico , Função Ventricular Esquerda , Arritmias CardíacasRESUMO
OBJECTIVE: To explore characteristics of clinical and imaging findings in patients with fat embolism syndrome. METHODS: From January 2021 to October 2022,clinical manifestations of 13 patients with fat embolism due to fracture or orthopaedic surgery were retrospectively analyzed,including 11 males and 2 females,aged from 17 to 60 years old. Mental and respiratory abnormalities and changes in vital signs occurred after admission or after surgery,and patient's chest and brain imaging results were abnormal. The patient's mental and respiratory abnormalities,vital signs,chest and brain imaging results were continuously monitored. RESULTS: The main clinical manifestations of fat embolism syndrome were abnormal pulmonary respiration in 13 patients,abnormal central nervous function in 7 patients,and spotted rash in 2 patients. Chest CT showed diffuse distribution of ground glass shadows in 13 patients,and severe symptoms were "snowstorm". Nine patients with ground glass fusion consolidation,5 patients with multiple nodules and 4 patients accompanied by bilateral pleural effusion. Head CT findings of 5 patients were negative,and head MRI findings of 1 patient showed multiple T1WI low signal,T2WI high signal shadow,DWI high signal shadow,and "starry sky sign" in basal ganglia,radiative crown,hemioval center,thalamus,frontal parietal cortex and subcortex. CONCLUSION: Fat embolism syndrome has a high mortality rate. Clinical manifestations of respiratory system and nervous system are not specific,and the skin spot rash has a characteristic manifestation. The "blizzard" sign is the specific manifestation of chest X-ray and CT examination of fat embolism,and the "starry sky" sign is the typical manifestation of diffusion-weighted sequence of brain MRI examination of fat embolism.
Assuntos
Embolia Gordurosa , Exantema , Masculino , Feminino , Humanos , Adolescente , Adulto Jovem , Adulto , Pessoa de Meia-Idade , Estudos Retrospectivos , Imageamento por Ressonância Magnética , Encéfalo , Embolia Gordurosa/diagnóstico por imagem , Embolia Gordurosa/etiologiaRESUMO
The dynamic of plant-parasitic nematode populations in soil is closely related to soil microorganisms. Fungi from Heterodera zeae cysts were isolated to explore the phenomenon of decline in the H. zeae population in the soil. Phylogenetic study of partial ITS, BenA, CaM, and RPB2 gene sequences, in addition to morphological investigations, was utilized to identify a nematode-destroying fungus. The nematicidal activity of a novel strain GX1 against H. zeae was assessed in vitro and in the greenhouse. Our findings revealed that strain GX1 is a new species of Talaromyces, named Talaromyces cystophila. It has a strong parasitic and lethal effect on H. zeae cysts, with 91.11% parasitism on cysts at 3 days after treatment. The contents of second-stage juveniles (J2s) and eggs inside the cysts were degraded and formed dense vacuoles, and the damaged eggs could not hatch normally. The spore suspension exhibited high nematophagous activity against nematodes, and fermentation filtrate exhibited marked inhibition of egg hatching and nematicidal activities on J2s. The hatching inhibition rates of eggs exposed to 1 × 108 CFU/ml spore suspensions or 20% 1-week fermentation filtrate (1-WF) for 15 days were 98.56 and 100%, respectively. The mortality of J2s exposed to 1 × 108 CFU/ml spore suspension reached 100% at 24 h; exposure to 50% 2-WF was 98.65 and 100% at 24 and 48 h, respectively. Greenhouse experiments revealed that the spore suspension and fermentation broth considerably decreased H. zeae reproduction by 56.17 to 78.76%. T. cystophila is a potential biocontrol strain with nematophagous and nematicidal activity that deserves attention and application.
Assuntos
Cistos , Talaromyces , Tylenchida , Tylenchoidea , Animais , Zea mays , Talaromyces/metabolismo , Filogenia , Doenças das Plantas/prevenção & controle , Doenças das Plantas/parasitologia , Antinematódeos/farmacologia , SoloRESUMO
Follicle-stimulating hormone (FSH) is involved in mammalian reproduction via binding to FSH receptor (FSHR). However, several studies have found that FSH and FSHR play important roles in extragonadal tissue. Here, we identified the expression of FSHR in human and mouse pancreatic islet ß-cells. Blocking FSH signaling by Fshr knock-out led to impaired glucose tolerance owing to decreased insulin secretion, while high FSH levels caused insufficient insulin secretion as well. In vitro, we found that FSH orchestrated glucose-stimulated insulin secretion (GSIS) in a bell curve manner. Mechanistically, FSH primarily activates Gαs via FSHR, promoting the cAMP/protein kinase A (PKA) and calcium pathways to stimulate GSIS, whereas high FSH levels could activate Gαi to inhibit the cAMP/PKA pathway and the amplified effect on GSIS. Our results reveal the role of FSH in regulating pancreatic islet insulin secretion and provide avenues for future clinical investigation and therapeutic strategies for postmenopausal diabetes.
Assuntos
Hormônio Foliculoestimulante , Ilhotas Pancreáticas , Camundongos , Animais , Humanos , Hormônio Foliculoestimulante/farmacologia , Hormônio Foliculoestimulante/metabolismo , Secreção de Insulina , Glucose/farmacologia , Glucose/metabolismo , Receptores do FSH/genética , Receptores do FSH/metabolismo , Ilhotas Pancreáticas/metabolismo , Transdução de Sinais , Insulina/metabolismo , Proteínas Quinases Dependentes de AMP Cíclico/metabolismo , Mamíferos/metabolismoRESUMO
Two new C-glucofuranosyl flavones apigenin 6-C-ß-glucofuranoside (1) and apigenin 6-C-α-glucofuranoside (2) together with four known compounds (3-6) were isolated from the flowers of Gypsophila oldhamiana. Their structures were elucidated on the basis of extensive spectroscopic analyses. These compounds were evaluated for the cytotoxic activities against four human cancer cell lines and did not exhibit any significant bioactivities (IC50 values > 10 µM).
RESUMO
Pitaya (Selenicereus costaricensis), a tropical and subtropical fruit of Cactaceae family, become very popular in the fruit consumer market in recent years. In June 2022, plant stunting, reduced yields and galled root symptoms were observed on S. costaricensis plants sampled from a commercial production base in Wuming County (23°10'36.67â³ N; 108°40'43.24â³ E), Guangxi autonomous region, China. The area of S. costaricensis field we investigated was about 19.9 ha. The incidence of root-knot nematode disease was almost 60%. Roots of twenty S. costaricensis plants were dug up, and many root knots and egg masses were observed. The roots with galls were collected, nematodes at different stages were collected and morphologically identified. Females were annulated, pearly white and globular to pear-shaped. The perineal pattern was oval shaped with the dorsal arch being moderately high to high. Average length of adult females (n = 20): body = 614.4 ± 57.3 µm, stylet lengths = 15.1 ± 0.9 µm, dorsal esophageal gland orifice (DGO) = 4.7 ± 0.6 µm. The tail of the second stage juvenile (J2) was very thin with a bluntly pointed tip. The hyaline tail terminus was clearly defined. Average length of J2 (n = 20): body = 469.5 ± 36.7 µm, stylet lengths = 14.7 ± 0.5 µm, DGO = 3.5 ± 0.4 µm, tail lengths averaged = 43.6 ± 9.7 µm. The males were vermiform, annulated, slightly tapering anteriorly, bluntly rounded posteriorly. Typical characteristics of Meloidogyne enterolobii observed were consistent with those previously described by Yang & Eisenback (1983) and Bulletin (2016). J2s hatched from an individual egg mass were collected for DNA extraction and used for molecular biological identification. The specific primers of M. enterolobii, Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/TCAGTTCAGGCAGGATCAACC), was used to validate the pathogen (Long et al. 2006). Approximately 236 bp of the target product was amplified, whereas no product was obtained from M. incognita. Further, the rDNA gene sequences (ITS; ITS1_5.8S_ITS2) and large subunit rDNA gene were amplified by the primers V5367/26S (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (Vrain et al. 1992) and D2A/D3B (ACAAGTACCGTGAGGGAAAGT/TCGGAAGGAACCAGCTACTA), respectively (Subbotin et al. 2006). The target sequences of 765 bp (GenBank accession no. OQ512155) and 759 bp (OQ512743) were recorded in the NCBI with GeneBank. The sequences showed 100% identity with M. enterolobii in ITSs (KJ146863, JQ082448) and D2/D3 (MF467276, OL681885). To verify reproduction on S. costaricensis (Jindu 1), twelve ten-week-old seedlings (12 pots) cultured on a sterile substrate soil were inoculated with 5,000 J2s from the original population in a greenhouse at 26 ËC. Noninoculated control were set up at the same time. After 8 weeks, the noninoculated plants (n = 12) did not present galls in the roots. All inoculated plants had galled roots and showed dwarf plant. The average reproductive factor obtained was 11.6 and the mean root gall rating of the samples was 5.3 (rating scale of 0 to 10), confirming the pathogenicity of M. enterolobii to S. costaricensis. The red dragon fruits (Hylocereus polyrhizus) in Hainan Island (China) were reported infected by M. enterolobii in previous report (Long et al. 2022). To our knowledge, this is the first report of M. enterolobii parasitizing S. costaricensis in Guangxi, China. This finding has important implications for the control of M. enterolobii at the place of discovery, which is the major fruit production area.
RESUMO
Circular RNAs (circRNAs) are generally formed by the back-splicing of precursor mRNA. Increasing evidence implicates the important role of circRNAs in cardiovascular diseases. However, the role of circ-insulin-like growth factor 1 receptor (circIGF1R) in cardiomyocyte (CM) proliferation remains unclear. Here, we investigated the potential role of the circIGF1R in the proliferation of CMs. We found that circIGF1R expression in heart tissues and primary CMs from adult mice was significantly lower than that in neonatal mice at postnatal 1 day (p1). Increased circIGF1R expression was detected in the injured neonatal heart at 0.5 and 1 days post-resection. circIGF1R knockdown significantly decreased the proliferation of primary CMs. Combined prediction software, luciferase reporter gene analysis, and quantitative real time-PCR (qPCR) revealed that circIGF1R interacted with miR-362-5p. A significant increase in miR-362-5p expression was detected in the adult heart compared with that in the neonatal heart. Further, heart injury significantly decreased the expression of miR-362-5p in neonatal mice. Treatment with miR-362-5p mimics significantly suppressed the proliferation of primary CMs, whereas knockdown of miR-362-5p promoted the CMs proliferation. Meanwhile, miR-362-5p silencing can rescue the proliferation inhibition of CMs induced by circIGF1R knockdown. Target prediction and qPCR validation revealed that miR-362-5p significantly inhibited the expression of Phf3 in primary CMs. In addition, decreased Phf3 expression was detected in adult hearts compared with neonatal hearts. Consistently, increased Phf3 expression was detected in injured neonatal hearts compared with that in sham hearts. Knockdown of Phf3 markedly repressed CMs proliferation. Taken together, these findings suggest that circIGF1R might contribute to cardiomyocyte proliferation by promoting Pfh3 expression by sponging miR-362-5p and provide an important experimental basis for the regulation of heart regeneration.
Assuntos
Doenças Cardiovasculares , MicroRNAs , Animais , Camundongos , Miócitos Cardíacos , RNA Circular/genética , Proliferação de Células/genética , MicroRNAs/genética , Linhagem Celular TumoralRESUMO
The assessment of factors that can promote the transmission of antibiotic resistance genes (ARGs) across bacteria in the gastrointestinal tract is in great demand to understand the occurrence of infections related to antibiotic-resistant bacteria (ARB) in humans. However, whether acid-resistant enteric bacteria can promote ARG transmission in gastric fluid under high-pH conditions remains unknown. This study assessed the effects of simulated gastric fluid (SGF) at different pH levels on the RP4 plasmid-mediated conjugative transfer of ARGs. Moreover, transcriptomic analysis, measurement of reactive oxygen species (ROS) levels, assessment of cell membrane permeability, and real-time quantitative assessment of the expression of key genes were performed to identify the underlying mechanisms. The frequency of conjugative transfer was the highest in SGF at pH 4.5. Antidepressant consumption and certain dietary factors further negatively impacted this situation, with 5.66-fold and 4.26-fold increases in the conjugative transfer frequency being noted upon the addition of sertraline and 10% glucose, respectively, compared with that in the control group without any additives. The induction of ROS generation, the activation of cellular antioxidant systems, increases in cell membrane permeability, and the promotion of adhesive pilus formation were factors potentially contributing to the increased transfer frequency. These findings indicate that conjugative transfer could be enhanced under certain circumstances in SGF at elevated pH levels, thereby facilitating ARG transmission in the gastrointestinal tract. IMPORTANCE The low pH of gastric acid kills unwanted microorganisms, in turn affecting their inhabitation in the intestine. Hence, studies on the factors that influence antibiotic resistance gene (ARG) propagation in the gastrointestinal tract and on the underlying mechanisms are limited. In this study, we constructed a conjugative transfer model in the presence of simulated gastric fluid (SGF) and found that SGF could promote the dissemination of ARGs under high-pH conditions. Furthermore, antidepressant consumption and certain dietary factors could negatively impact this situation. Transcriptomic analysis and a reactive oxygen species assay revealed the overproduction of reactive oxygen species as a potential mechanism by which SGF could promote conjugative transfer. This finding can help provide a comprehensive understanding of the bloom of antibiotic-resistant bacteria in the body and create awareness regarding the risk of ARG transmission due to certain diseases or an improper diet and the subsequent decrease in gastric acid levels.
Assuntos
Antagonistas de Receptores de Angiotensina , Genes MDR , Humanos , Espécies Reativas de Oxigênio , Antagonistas de Receptores de Angiotensina/farmacologia , Ácido Gástrico , Inibidores da Enzima Conversora de Angiotensina/farmacologia , Bactérias/genética , Antibacterianos/farmacologia , Intestinos , Concentração de Íons de Hidrogênio , Transferência Genética Horizontal , Genes Bacterianos , PlasmídeosRESUMO
Harmful red tides in China have caused paralytic shellfish toxins (PSTs) pollution and led to severe socioeconomic effects in shellfish aquaculture. Although shellfish can survive harmful algal blooms, the effects on their Condition Index (CI) have been underestimated. This study sought to evaluate the effects of the profiles and levels of paralytic shellfish toxins on variations in the CI in bivalves under natural blooming conditions. We observed clear soft tissue lesions to varying degrees except in Mytilus galloprovincialis after toxin exposure. Among the five species of shellfish exposed in situ, only M. galloprovincialis accumulated PSTs content above the maximum permitted level (800 µg STX di-HCl eq./kg). The highest toxin content in all sample tissues was observed in Patinopecten yessoensis. Significant interspecies differences in PSTs accumulation among the five bivalve species were observed in the hepatopancreas. A total of nine PSTs components and four new C-11 hydroxyl metabolites (so-called M-toxins) toxins were detected, and detoxification diversity was observed among bivalves. We observed a higher proportion of M-toxin in early stages, and the proportions changed only slightly over time in M. galloprovincialis and Magallana gigas, thus accounting for the significantly higher metabolism rate. Notably, the CI in M. gigas and Argopecten irradians was positively correlated with lowest toxin accumulation of PSTs content, but significantly inhibited. In conclusion, our results revealed a significant inhibitory effect on the CI in shellfish, in a species specific manner, with distinct levels of inhibition correlated with different toxin metabolites. Our study revealed the toxin content of different bivalves exposed to a natural red tide environment and the consequent effects on growth, thus building a foundation for research on the mechanisms underlying the effects of PSTs on growth. These data establish the ecological and economic significance of the effects of harmful algal blooms on bivalves.
Assuntos
Dinoflagellida , Mytilus , Animais , Proliferação Nociva de Algas , Toxinas Marinhas/toxicidade , Mytilus/metabolismo , PectinidaeRESUMO
The Colorado potato beetle (CPB), Leptinotarsa decemlineata (Say), is the most notorious insect pest of potato globally. Injudicious use of insecticides for management of this pest has resulted in resistance to all major groups of insecticides along with many human, animal health, and environmental concerns. Additionally, the input cost of insecticide development/discovery is markedly increasing because each year thousands of chemicals are produced and tested for their insecticidal properties, requiring billions of dollars. For the management of resistance in insect pests, synergists can play a pivotal role by reducing the application dose of most insecticides. These eco-friendly synergists can be classified into two types: plant-based synergists and RNAi-based synergists. The use of plant-based and RNAi-based synergists in resistance management of insect pests can give promising results with lesser environmental side effects. This review summarizes the resistance status of CPB and discusses the potential advantage of plant-based and RNAi-based synergists for CPB resistance management. It will motivate researchers to further investigate the techniques of using plant- and RNAi-based synergists in combination with insecticides.
RESUMO
In the last 5 years, paralytic shellfish toxins (PSTs) have been recurrently detected in mollusks farmed in the mussel culture area of Qinhuangdao city, along with the occurrence of toxic outbreaks linked to dinoflagellate species of the Alexandrium genus. To understand the formation mechanism and variation of these events, continuous and comprehensive PSTs monitoring was carried out between 2017 and 2020. Through the analysis of both phytoplankton and cysts via light microscopy and quantitative polymerase chain reaction, it was shown that Alexandrium catenella was responsible for the production of PSTs, which consisted mainly of gonyautoxins 1,4 (GTX1/4, 87%) and GTX2/3 (13%). During bloom events in 2019, mussels accumulated the highest PSTs value (929 µg STX di-HCl eq·kg-1) in conjunction with the peak of cell abundances, and toxin profiles were consistent with high distributions of GTX1/4, GTX2/3, and Neosaxitoxin. Toxin metabolites vary in different substances and mainly transferred to a stable proportion of α-epimer: ß-epimers 3:1. The environmental drivers of Alexandrium blooms included the continuous rise of water temperature (>4 °C) and calm weather with low wind speed and no significant precipitation. By comparing toxin profiles and method sensitivity, it was found that dissolved toxins in seawater are more useful for early warning. These results have important implications for the effective monitoring and management of paralytic shellfish poisoning outbreaks.
Assuntos
Bivalves , Dinoflagellida , Intoxicação por Frutos do Mar , Animais , Dinoflagellida/metabolismo , Água do Mar , Água/metabolismoRESUMO
Tup1, a conserved transcriptional repressor, plays a critical role in the growth and development of fungi. Here, we identified a BsTup1 gene from the plant pathogenic fungus Bipolaris sorokiniana. The expression of BsTup1 showed a more than three-fold increase during the conidial stage compared with mycelium stage. Deletion of BsTup1 led to decrease hyphal growth and defect in conidia formation. A significant difference was detected in osmotic, oxidative, or cell wall stress responses between the WT and ΔBsTup1 strains. Pathogenicity assays showed that virulence of the ΔBsTup1 mutant was dramatically decreased on wheat and barely leaves. Moreover, it was observed that hyphal tips of the mutants could not form appressorium-like structures on the inner epidermis of onion and barley coleoptile. Yeast two-hybrid assays indicated that BsTup1 could interact with the BsSsn6. RNAseq revealed significant transcriptional changes in the ΔBsTup1 mutant with 2369 genes down-regulated and 2962 genes up-regulated. In these genes, we found that a subset of genes involved in fungal growth, sporulation, cell wall integrity, osmotic stress, oxidation stress, and pathogenicity, which were misregulated in the ΔBsTup1 mutant. These data revealed that BsTup1 has multiple functions in fungal growth, development, stress response and pathogenesis in B. sorokiniana.
Assuntos
Bipolaris , Hordeum , Proteínas Fúngicas/genética , Proteínas Fúngicas/metabolismo , Hordeum/genética , Hordeum/metabolismo , Doenças das Plantas/microbiologia , Esporos Fúngicos/genética , Virulência/genéticaRESUMO
The types and intensity of anthropogenic pressure in the same sea area may differ spatially and may change as time passes, but response of benthic biotic indices to different pressure is different, which makes it unreasonable to use the same benthic biotic indices in a large sea area. We provided a new way of thinking as to selecting benthic biotic indices according to pressure type. The study took six bays under eutrophication and sediment heavy metal pollution to different levels in Fujian coastal water, East China sea, as examples, analysed the response of five benthic biotic indices, namely AZTI marine biotic index (AMBI), multivariate AMBI (M-AMBI), Shannon-Wiener diversity index (H'), benthic opportunistic polychaetes amphipods (BOPA) and benthic polychaetes amphipods (BPA), to eutrophication factors and sediment heavy metal pollution factors firstly. The result indicated that AMBI well responded to dissolved inorganic nitrogen (DIN) and dissolved inorganic phosphorus (DIP); M-AMBI responded soundly in the range of DIN >0.131 mg L-1 and DIP >0.022 mg L-1 and responded universally to heavy metals; H' responded to only Hg and Cd; BOPA has response to eutrophication condition of DIN >0.242 mg L-1; BPA had response to DIN, Cu and As. Then, suitable indices were selected based on the four pressure scenarios in the study area. AMBI was selected in no pressure scenario; M-AMBI was chosen under only eutrophication pressure and under dual pressure; H' was preferred in only heavy metal pressure scenario (mainly Hg pollution). At last, the density plot of the distribution of the selected indices in the evaluation grades under different pressure scenarios proved the proposal of selecting benthic biotic indices according to pressure types feasible. This study can offer some new insights into rapidly choosing indices to evaluate the coastal benthic ecological quality status.
Assuntos
Anfípodes , Mercúrio , Animais , Cádmio , China , Ecossistema , Monitoramento Ambiental , Eutrofização , Invertebrados , Nitrogênio , Fósforo , ÁguaRESUMO
The prevalence of gestational diabetes mellitus (GDM) is increasing rapidly. In addition to the metabolic disease risks, GDM might increase the risks of cryptorchidism in children. However, its mechanism involved in abnormalities of the male reproductive system is still unclear. The purpose of this study was to study the effects of GDM on the development of mouse fetal Leydig cells (FLCs) and Sertoli cells (SCs). Pregnant mice were treated on gestational days 6.5 and 12.5 with streptozotocin (100 mg/kg) or vehicle (sodium citrate buffer). Leydig cell and SC development and functions were evaluated by investigating serum testosterone levels, cell number and distribution, genes, and protein expression. GDM decreased serum testosterone levels, the anogenital distance, and the level of desert hedgehog in SCs of testes of male offspring. FLC number was also decreased in testes of GDM offspring by delaying the commitment of stem Leydig cells into the Leydig cell lineage. RNA-seq showed that FOXL2, RSPO1/ß-catenin signaling was activated and Gsk3ß signaling was inhibited in GDM offspring testis. In conclusion, GDM disrupted reproductive tract and testis development in mouse male offspring via altering genes related to development.
Assuntos
Diabetes Gestacional , Testículo , Animais , Diabetes Gestacional/metabolismo , Feminino , Desenvolvimento Fetal , Humanos , Células Intersticiais do Testículo/metabolismo , Masculino , Camundongos , Gravidez , Células de Sertoli/metabolismo , Testículo/metabolismo , TestosteronaRESUMO
Upon injury, the liver is capable of substantial regeneration from the original tissue until an appropriate functional size. The underlying mechanisms controlling the liver regeneration processes are not well elucidated. Previous studies have proposed that the transcription factor FoxO3 is involved in various liver diseases, but its exact role in the regulation of liver regeneration remains largely unclear. To directly test the detailed role of FoxO3 in liver regeneration, both a constitutive Albumin-Cre driver line and adeno-associated virus serotype 8 (AAV8)-Tbg-Cre (AAV-Cre)-injected adult FoxO3fl/fl mice were subjected to 70% partial hepatectomy (PH). Our data demonstrate that FoxO3 deletion accelerates liver regeneration primarily by limiting polyploidization and promoting the proliferation of hepatocytes during liver regeneration. RNA-seq analysis indicates that FoxO3 deficiency greatly alters the expression of gene sets associated with cell proliferation and apoptosis during liver regeneration. Chromatin immunoprecipitation-PCR (ChIP-PCR) and luciferase reporter assays reveal that FoxO3 promotes the expression of Nox4 but suppresses the expression of Nr4a1 in hepatocytes. AAV8 virus-mediated overexpression of Nox4 and knockdown of Nr4a1 significantly suppressed hepatocyte proliferation and liver regeneration in FoxO3-deficient mice. We demonstrate that FoxO3 negatively controls hepatocyte proliferation through Nox4 upregulation and Nr4a1 downregulation, thereby ensuring appropriate functional regeneration of the liver. Our findings provide novel mechanistic insight into the therapeutic mechanisms of FoxO3 in liver damage and repair.
RESUMO
A new chromone glycoside, 8-O-ß-D-Glucopyranosyl-2-methylchromone (1), together with eight known compounds (2-9) were isolated from the Tibetan medicine plant of Swertia punicea. All compounds of this plant were reported for the first time. The structures of these metabolites were elucidated by analysis of their HR-ESI-MS, 1D and 2D NMR spectroscopic data and comparison with data reported in the literature. In vitro test, all compounds were evaluated for their anti-inflammatory activity through the determination of nitric oxide production. Compounds 1-2 were evaluated for cytotoxic activities against three human cancer cell lines (HeLa, MDA-MB-231 and A375) by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) method. Furthermore, the chemotaxonomic significance of these compounds has also been described.