Ectopic CD4+ T cells in choroid plexus mediate neuropsychiatric lupus symptoms in mice via interferon-γ induced microglia activation.

Neuropsychiatric systemic lupus erythematosus (NPSLE) is a disabling and potentially life-threatening complication of SLE. This study aims to investigate whether ectopic CD4+ T cells in the choroid plexus mediate NPSLE in mice. Intracerebroventricular (ICV) injection of anti-CD4 antibody effectively depleted CP-resident CD4+ T cells and alleviated NPSLE-like symptoms in MRL/lpr mice. Following ICV injection, the majority of isolated lupus CD4+ T cells from donor MRL/lpr mice predominantly stayed in the CP for at least 28 days in recipient C57BL/6 mice, while nearly all isolated CD4+ T cells from MRL/MpJ mice disappeared within 7 days. ICV injection of lupus CD4+ T cells resulted in NPSLE-like symptoms, including impaired behavioral performances, increased microglial activation, and abnormal microstructure changes. Flow cytometry analysis revealed that the majority of isolated lupus CD4+ T cells were positive for IFN-γ. Neutralizing intracerebral IFN-γ alleviated NPSLE-like symptoms in MRL/lpr mice. Moreover, ICV injection of anti-IFN-γ antibody or microglial depletion by PLX3397 benefited most NPSLE-like symptoms in lupus CD4+ T-treated mice, while ICV injection of IFN-γ mimicked most NPSLE-like symptoms. In conclusion, CP-resident lupus CD4+ T cells contribute to NPSLE-like symptoms in mice via Interferon-γ induced microglia activation. Depleting CP-resident lupus CD4+ T cells, interferon-γ, or activated microglia may be potential therapeutic targets for NPSLE.

Thermally Activated Delayed Fluorescence (TADF)-active Coinage-metal Sulfide Clusters for High-resolution X-ray Imaging.

The study of facile-synthesis and low-cost X-ray scintillators with high light yield, low detection limit and high X-ray imaging resolution plays a vital role in medical and industrial imaging fields. However, the optimal balance between X-ray absorption, decay lifetime and excitonic utilization efficiency of scintillators to achieve high-resolution imaging is extremely difficult due to the inherent contradiction. Here two thermally activated delayed fluorescence (TADF)-actived coinage-metal clusters M6 S6 L6 (M=Ag or Cu) were synthesized by simple solvothermal reaction, where the cooperation of heavy atom-rich character and TADF mechanism supports strong X-ray absorption and rapid luminescent collection of excitons. Excitingly, Ag6 S6 L6 (SC-Ag) displays a high photoluminescence quantum yield of 91.6 % and scintillating light yield of 17420 photons MeV-1 , as well as a low detection limit of 208.65 nGy s-1 that is 26 times lower than the medical standard (5.5 µGy s-1 ). More importantly, a high X-ray imaging resolution of 16 lp/mm based on SC-Ag screen is demonstrated. Besides, rigid core skeleton reinforced by metallophilicity endows clusters M6 S6 L6 strong resistance to humidity and radiation. This work provides a new view for the design of efficient scintillators and opens the research door for silver clusters in scintillation application.

Highly Sensitive Direct X-Ray Detector Based on Copper(II) Coordination Polymer Single Crystal with Anisotropic Charge Transport.

Anisotropic charge transport plays a pivotal role in clarifying the conductivity mechanism in direct X-ray detection to improve the detection sensitivity. However, the anisotropic photoelectric effect of semiconductive single crystal responsive to X-ray is still lacking of theoretical and experimental proof. The semiconductive coordination polymers (CPs) with designable structures, adjustable functions, and high crystallinity provide a suitable platform for exploring the anisotropic conductive mechanism. Here,the study first reveals a 1D conductive transmission path for direct X-ray detection from the perspective of structural chemistry. The semiconductive copper(II)-based CP 1 single crystal detector exhibits unique anisotropic X-ray detection performance. Along the 1D π-π stacking direction, the single crystal device (1-SC-a) shows a superior sensitivity of 2697.15 µCGyair -1  cm-2 and a low detection limit of 1.02 µGyair  s-1 among CPs-based X-ray detectors. This study provides beneficial guidance and deep insight for designing high-performance CP-based X-ray detectors.

Identification of a Novel 7-bp Deletion in the α-Globin Gene Cluster in One Chinese Family.

Deletional α-thalassemia is characterized by reduced hemoglobin A2 and involves the deletion of a few nucleotides, which is a rare hereditary disease. However, the detection of rare mutations using commonly used genetic tests is highly challenging. In the present study, next-generation sequencing (NGS) was used to identify a novel 7-bp deletion α-thalassemia in one individual from a Chinese family. Hematological parameters of the family members were determined using an automated cell counter, and hemoglobin electrophoresis was performed using a capillary electrophoresis system. Subsequently, NGS was performed on the genomic DNA of the patient and her family members. The 7-bp deletion (named Hb Honghe [HBA1: c.401_407delGCACCGT]) of α-thalassemia in the α-globin gene was confirmed using Sanger sequencing. The patient's father was also a heterozygous carrier of HBA1: c.401_407delGCACCGT deletion, but not her mother or sister. The application of the combined molecular approach is essential for the accurate diagnosis of rare thalassemia. This study reports a novel case of α- thalassemia. The characterization of the mutation might provide new insights into genetic counseling and accurate diagnosis of thalassemia.

Improving X-ray Scintillating Merits of Zero-Dimensional Organic-Manganese(II) Halide Hybrids via Enhancing the Ligand Polarizability for High-Resolution Imaging.

Luminescent metal halides have been exploited as a new class of X-ray scintillators for security checks, nondestructive inspection, and medical imaging. However, the charge traps and hydrolysis vulnerability are always detrimental to the three-dimensional ionic structural scintillators. Here, the two zero-dimensional organic-manganese(II) halide coordination complexes 1-Cl and 2-Br were synthesized for improvements in X-ray scintillation. The introduction of a polarized phosphine oxide can help to increase the stabilities, especially the self-absorption-free merits of these Mn-based hybrids. The X-ray dosage rate detection limits reached up to 3.90 and 0.81 µGyair/s for 1-Cl and 2-Br, respectively, superior to the medical diagnostic standard of 5.50 µGyair/s. The fabricated scintillation films were applied to radioactive imaging with high spatial resolutions of 8.0 and 10.0 lp/mm, respectively, holding promise for use in diagnostic X-ray medical imaging.

Two d10 2D Cathode-Ray Scintillation Coordination Polymers with High Efficiency and High-Voltage Stability.

Two examples of efficient cathode-ray scintillation coordination polymers with good stability at high voltage were prepared by conjugating luminescent groups with d10 metal ions. The synergistic effect of inorganic metal and organic ligand suppresses the self-quenching of the conjugated luminescent groups and enhances the scintillation performance. This work provides new ideas for the design of new field-emission displays and cathode-ray scintillation materials.

Five novel globin gene mutations identified in five Chinese families by next-generation sequencing.

BACKGROUND: Thalassemia is one of the most common inherited diseases worldwide. This report presents three novel cases of α-thalassemia and two novel cases of ß-thalassemia caused by five different mutations in the globin gene. METHODS: Next-generation sequencing (NGS) was used to identify novel α- and ß-thalassemia in five individuals, which was confirmed by Sanger sequencing of the globin gene. Hematological parameters were determined by an automated cell counter, and hemoglobin electrophoresis was carried out by a capillary electrophoresis system, respectively. The isoelectric point (pI), molecular weight, and conservation for the mutations were described by the Internet software programs. The pathogenicity for globin mutations was analyzed by bioinformatics analysis and relative quantitative analysis. RESULTS: NGS revealed five novel cases of α- and ß-thalassemia: HBA2:c.245C>T, HBA2:c.95+11_95+34delCTCCCCTGCTCCGACCCGGGCTCC, HBA2:c.54delC, HBB:c.373C>A, and HBB:c.40G>A. The clinical implications of these mutations were described. Computational predictions were made for pI, amino acid conservation, and pathogenicity of the missense mutation. Relative quantitative data of the α-globin mRNA were analyzed. CONCLUSION: Five novel globin mutations were identified in the populations of China, and those mutations were analyzed to provide a mechanistic view for their pathogenicity. These analyzed results improve genetic diagnostics for thalassemia, which can improve screening programs for thalassemia and prenatal diagnosis for Chinese population.

Single-cell-type transcriptomic analysis reveals distinct gene expression profiles in wheat guard cells in response to abscisic acid.

Stomatal closure, driven by shrinking guard cells in response to the accumulation of abscisic acid (ABA) under drought stress, has a great impact on plant growth and environmental acclimation. However, the molecular regulatory mechanism underlying the turgor alteration of guard cells remains elusive, especially in cereal grasses. Here, we develop a modified enzyme digestion-based approach for the isolation of wheat (Triticum aestivum L.) guard cells. With this approach, we can remove mesophyll, pavement cells and subsidiary cells successively from the epidermis of the trichomeless coleoptile in wheat and preserve guard cells on the cuticle layers in an intact and physiologically active conditions. Using a robust single-cell-type RNA sequencing analysis, we discovered 9829 differentially expressed genes (DEGs) as significantly up- or down-regulated in guard cells in response to ABA treatment. Transcriptome analysis revealed a large percent of DEGs encoding multiple phytohormone signalling pathways, transporters, calcium signalling components, protein kinases and other ABA signalling-related proteins, which are primarily involved in key signalling pathways in ABA-regulated stomatal control and stress response. Our findings provide valuable resource for investigating the transcriptional regulatory mechanism underlying wheat guard cells in response to ABA.

Detection of chromosomal abnormalities in spontaneous miscarriage by low­coverage next­generation sequencing.

Chromosomal abnormalities (CAs) can cause spontaneous miscarriage and increase the incidence of subsequent pregnancy loss and other complications. Presently, CAs are detected mainly by array comparative genomic hybridization (CGH) and single nucleotide polymorphism microarrays. The present study developed a low­coverage next­generation sequencing method to detect CAs in spontaneous miscarriage and assess its clinical performance. In total, 1,401 patients who had experienced an abortion were enrolled in the present study and divided into two groups. In group I, 437 samples that had been previously validated by array CGH were used to establish a method to detect CAs using a semiconductor sequencing platform. In group II, 964 samples, which were not verified, were assessed using established methods with respect to clinical significance. Copy number variant (CNV)­positive and euploidy samples were verified by array CGH and short tandem repeat profiling, respectively, based on quantitative fluorescent PCR. The low­coverage sequencing method detected CNVs >1 Mb in length and a total of 3.5 million unique reads. Similar results to array CGH were obtained in group I, except for six CNVs <1 Mb long. In group II, there were 341 aneuploidies, 195 CNVs, 25 mosaicisms and 403 euploidies. Overall, among the 1,401 abortion samples, there were 536 aneuploidies, 263 CNVs, 34 mosaicisms, and 568 euploidies. Trisomies were present in all autosomal chromosomes. The most common aneuploidies were T16, monosomy X, T22, T15, T21 and T13. Furthermore, one tetrasomy 21, one CNV associated with Wolf­Hirschhorn syndrome, one associated with DiGeorge syndrome and one associated with both Prader­Willi and Angelman syndromes were identified. These four cases were confirmed by short tandem repeat profiling and array CGH. Quantitative fluorescent PCR revealed nine polyploidy samples. The present method demonstrated equivalent efficacy to that of array CGH in detecting CNVs >1 Mb, with advantages of requiring less input DNA and lower cost.

Risk of epilepsy in rheumatoid arthritis: a meta-analysis of population based studies and bioinformatics analysis.

BACKGROUND: An increasing number of studies support an association between rheumatoid arthritis (RA) and brain disorders. This study aims to determine the association between RA and epilepsy. METHODS: A comprehensive search of databases in both English and Chinese was performed. Data from the selected studies were extracted and analyzed independently by two authors. Genes associated with epilepsy and RA were also collected and analyzed. RESULTS: We included six nationwide population based studies (n = 7,094,113 cases in total) for the meta-analysis. The risk of epilepsy was increased in RA patients [risk ratio (RR) = 1.601; 95% confidence interval (CI): 1.089-2.354; p = 0.017; n = 3,803,535 cases] and children born to mothers with RA (RR = 1.475; 95% CI: 1.333-1.633; p < 0.001, n = 3,290,578 cases). Subgroup analysis and meta-regression showed the RR of epilepsy in RA was negatively correlated with age. Furthermore, we found that 433 identified genes in a coexpression network from the hippocampi of 129 epileptic patients were enriched in the RA and related Kyoto Encyclopedia of Genes and Genomes pathways, while 13 genes (mainly related to inflammatory cytokines and chemokines) were identified as potential key genes bridging the RA and epilepsy. CONCLUSIONS: Our study, utilizing meta-analysis and bioinformatical data, highlights a close association between epilepsy and RA. Further studies are still warranted to expand these findings, especially for a population that is exposed to RA during fetal and childhood periods.

Analysis of brain metabolites by gas chromatography-mass spectrometry reveals the risk-benefit concerns of prednisone in MRL/lpr lupus mice.

OBJECTIVE: Neuropsychiatric systemic lupus erythematosus (NPSLE) is a common cause of disability in systemic lupus erythematosus (SLE). This study aims to investigate the metabolic changes in the hypothalamus and frontal cortex in lupus-prone MRL/lpr mice. METHODS: Metabolic changes were analyzed using gas chromatography-mass spectrometry (GC-MS). RESULTS: According to the principal component analysis (PCA), the metabolic profiles were different between the frontal cortex and hypothalamus, but they were comparable between MRL/lpr and MRL/MpJ mice (16 weeks of age). By OPLS-DA, eight cortical and six hypothalamic differential metabolites were identified in MRL/lpr as compared to MRL/MpJ mice. Among these differential metabolites, we found a decrease of N-acetyl-L-aspartate (NAA, a potential marker of neuronal integrity), an increase of pyruvate and a decrease of glutamate in the frontal cortex but not in the hypothalamus. Prednisone treatment (3 mg/kg from 8 weeks of age) relieved the decrease of NAA but further increased the accumulation of pyruvate in the frontal cortex, additionally affected eight enriched pathways in the hypothalamus, and led to significant imbalances between the excitation and inhibition in both the frontal cortex and hypothalamus. CONCLUSION: These results suggest that the frontal cortex may be more preferentially affected than the hypothalamus in SLE. Prednisone disrupted rather than relieved metabolic abnormalities in the brain, especially in the hypothalamus, indicating that the risk-benefit balance of prednisone for SLE or NPSLE remains to be further evaluated.

Limited preventive effect of prednisone on neuropsychiatric symptoms in murine systemic lupus erythematosus.

OBJECTIVE: To investigate whether glucocorticoids, the hallmark medication for systemic lupus erythematosus (SLE), could prevent the development of neuropsychiatric SLE (NPSLE). METHODS: The protective effects of prednisone on NPSLE were tested using the open field, object recognition/placement, forced swim, tail suspension, and sucrose preference tests in MRL/lpr mice. Auto-antibody titres and the weight of lymph nodes were also measured. RESULTS: MRL/lpr mice exhibited mild depression at the age of 8 weeks before progressing with spatial cognitive impairment and severe depression-like behaviour at the age of 16 weeks. Treating MRL/lpr mice with prednisone (5 mg/kg) from the age of 8 weeks decreased anti-cardiolipin and anti-N-methyl-D-aspartate (NMDA) receptor antibody titres in the brain, reduced the weight of lymph nodes, and prolonged the floating latency in the forced swim test. However, prednisone (3 or 5 mg/kg) had no preventive effect on the development of spatial cognitive impairment and other depression-like behaviours in MRL/lpr mice. The dose of prednisone had a positive correlation with the floating latency in the forced swim test, while it offered no effects on all other behavioural tests. CONCLUSION: Our results provide evidence that early treatment with prednisone had a limited effect on the development of neuropsychiatric symptoms in MRL/lpr mice. Further work is needed in other models beyond NPSLE in MRL/lpr mice before any definitive conclusions are made on the efficacy of prednisone in human NPSLE.

Noninvasive Prenatal Testing of Rare Autosomal Aneuploidies by Semiconductor Sequencing.

Rare autosomal aneuploidies (RAAs) can cause miscarriage or other pregnancy complications and lead to inconsistent results of noninvasive prenatal testing (NIPT), but many NIPT providers have not yet started to provide related services. Our aim was to develop a semiconductor sequencing platform (SSP)-based method for detecting RAAs when pregnant women performed NIPT. Fifty-three aneuploidy samples with verified karyotyping or array comparative genomic hybridization (aCGH) results were collected and subjected to RAAs detection using an SSP to develop a method by genomic sequencing. Various trisomies on all chromosomes other than chromosomes 17 and 19, four multiple aneusomies, one monosomy and five sex chromosome abnormalities were got by our method which can directly identify RAAs via a z-score. Then, artificial mixtures of 10% and 5% DNA were created by adding fragmented fifty-three tissue samples and used in an NIPT simulation to develop a bioinformatics analysis method which can use in NIPT. And the results were in accordance with those of karyotyping and aCGH. Therefore, our method has potential for use in NIPT. Finally, 23,823 clinical plasma samples were tested to verify the performance of our approach. Karyotyping or aCGH was performed on the positive clinical samples. In total, 188 of 23,823 clinical samples were positive (T2, n = 1; T7, n = 1; T13, n = 15; T18, n = 45; T21, n = 125; and multiple aneusomies, n = 1) and verified by karyotyping or aCGH; no sample was a false negative. Several false positives were detected, one of which showed maternal copy number variation (CNV). One case of multiple aneusomies was caused by a maternal tumor. The method developed enables detection of RAAs without increasing costs.

Evaluation of the analytical and clinical performances of time-resolved fluoroimmunoassay for detecting carcinoma antigen 50.

We developed a TR-FIA kit for quantitative detection of CA50. This study aims to evaluate the analytical and clinical performances of this kit. Precision, accuracy, specificity, sensitivity, stability, and endogenous interference of this kit are evaluated. Reference range is established. Coincidence rate and correlation between TR-FIA and RIA are evaluated. ROC is adopted to evaluate the diagnostic performance. This kit shows excellent precision with a coefficients of variation (CVs) ranged from 2.2-9.3%, accuracy (average recovery, 98.5%), sensitivity (minimum detectable concentration is 0.2 U/mL), specificity (all cross-reactivity is less than 0.1% except CA199, which is 0.175%), and storage stability (recoveries, 90.8-100.4%). Bilirubin, hemoglobin, and triglyceride dose not interfere with CA50 detection (recovery, 97.13-109.1%). The range from 0-25 U/mL is chosen as the reference range. There are good correlation (r = 0.804) and coincidence (p = 0.608, kappa = 0.924) between TR-FIA and RIA. Diagnostic performance of this kits, which based on RIA results, is perfect (AUC = 0.996), and the diagnostic accuracy for malignancy diagnosis is in moderate degree (AUC, 0.802-0.861). The TR-FIA (CA50) kit performs well in analytical and clinical performances, and can be employed in the clinical diagnosis of malignancy.

[Chromomycin A(2) induces apoptosis of HepG2 cells in vitro].

OBJECTIVE: To study the effect of chromomycin A(2) in inducing apoptosis of HepG2 cells and explore the molecular mechanism. METHODS: HepG2, MCF-7, A549, and 7901 cells were exposed to chromomycin A(2) and the changes in the cell viability were detected using MTT assay. The changes in the chromatins were observed with laser scanning confocal microscope after incubation of the cells with chromomycin A(2) (60 nmol/L) for 24 h. The changes in cell morphology were examined with a phase-contrast microscope, and the apoptotic cell populations, fluorescent intensity of reactive oxygen species (ROS) and mitochondrial membrane potential were determined using flow cytometry. RESULTS: Chromomycin A(2) significantly inhibited the proliferation of the cells in a time- and dose-dependent manner, and caused changes in the cell morphology and cell apoptosis. Exposure of the cells to chromomycin A(2) resulted in chromatin condensation, ROS generation, and reduction of the mitochondrial membrane potential. CONCLUSION: Increased ROS and mitochondria damage may importantly contribute to chromomycin A(2)-induced apoptosis in HepG2 cells.

Emodin-provoked oxidative stress induces apoptosis in human colon cancer HCT116 cells through a p53-mitochondrial apoptotic pathway.

Emodin, a natural anthraquinone isolated from the traditional Chinese medicine Radix rhizoma Rhei, can induce apoptosis in many kinds of cancer cells. This study demonstrated that emodin induces apoptosis in human colon cancer HCT116 cells by provoking oxidative stress, which subsequently triggers a p53-mitochondrial apoptotic pathway. Emodin induced mitochondrial transmembrane potential loss, increase in Bax and decrease in Bcl-2 expression and mitochondrial translocation and release of cytochrome c to cytosol in HCT116 cells. In response to emodin-treatment, ROS increased rapidly, and subsequently p53 was overexpressed. Pretreatment with the antioxidant NAC diminished apoptosis and p53 overexpression induced by emodin. Transfecting p53 siRNA also attenuated apoptosis induced by emodin, Bax expression and mitochondrial translocation being reduced compared to treatment with emodin alone. Taken together, these results indicate that ROS is a trigger of emodin-induced apoptosis in HCT116 cells, and p53 expression increases under oxidative stress, leading to Bax-mediated mitochondrial apoptosis.

miR-375 inhibits Helicobacter pylori-induced gastric carcinogenesis by blocking JAK2-STAT3 signaling.

Gastric cancer remains the second leading cause of cancer-related deaths worldwide. Although Helicobacter pylori (H. pylori) is considered to be a critical risk factor, the molecular mechanisms underlying H. pylori-induced gastric carcinogenesis are still poorly defined. Recently, accumulating studies have revealed that microRNAs play key roles in development, differentiation, immune regulation, and even carcinogenesis. This study was performed to explore the mechanism of microRNA-375 (miR-375) in H. pylori promotion of gastric carcinogenesis. It was shown that miR-375 was down-regulated in response to H. pylori infection in gastric epithelial cell lines; this finding was quite opposite to the expression patterns of pro-inflammatory cytokines observed in a co-culture cell model. Moreover, the ectopic expression of miR-375 aggravated cell proliferation and migration. It was further observed that Janus kinase 2 (JAK2) was a bona fide target of miR-375 and further activated signal transducer and activator of transcription 3 (STAT3) and other downstream target molecules. Both gain-of-function and loss-of-function experiments showed that decreased miR-375 expression could mimic the oncogenic effects of the JAK2-STAT3 pathway. In addition, pretreatment with siRNAs targeting JAK2 prevented gastric epithelial cells from increasing proliferation and migration even in response to H. pylori infection. For the first time, our results demonstrate that the JAK2-STAT3 pathway regulated by miR-375 is involved in H. pylori-induced inflammation; this pathway promotes neoplastic transformation by affecting the expression of BCL-2 and TWIST1, hence offering a potential therapeutic target for inflammation-related cancers, especially those related to H. pylori.

Bacterial community structure in cooling water and biofilm in an industrial recirculating cooling water system.

Microbial fouling is a serious problem in open recirculating cooling water systems. The bacterial communities that cause it have not been fully understood. In this study, we analyzed the community structure of free-living bacteria and particle-attached bacteria in cooling water, and bacteria in biofilm collected from the wall of the water reservoir in an industrial recirculating cooling water system by construction of a 16S rRNA gene clone library. Based on amplified ribosomal DNA restriction analysis, clones of all three libraries were clustered into 45 operational taxonomic units (OTUs). Thirteen OTUs displaying 91-96% sequence similarity to a type strain might be novel bacterial species. Noted differences in community structure were observed among the three libraries. The relative species richness of the free-living bacteria in cooling water was much lower than that of particle-attached bacteria and bacteria in biofilm. The majority of the free-living bacterial community (99.0%) was Betaproteobacteria. The predominant bacteria in the particle-attached bacterial community were Alphaproteobacteria (20.5%), Betaproteobacteria (27.8%) and Planctomycetes (42.0%), while those in the biofilm bacterial community were Alphaproteobacteria (47.9%), Betaproteobacteria (11.7%), Acidobacteria (13.1%) and Gemmatimonadetes (11.3%). To control microbial fouling in industrial recirculating cooling water systems, additional physiological and ecological studies of these species will be essential.

Differences in microcystin production and genotype composition among Microcystis colonies of different sizes in Lake Taihu.

The cyanobacterium Microcystis, which occurs as colonies of different sizes under natural conditions, can produce toxic microcystins (MCs). To monitor the toxicity and assess the risk of Microcystis blooms in Lake Taihu, it is important to investigate the relationship between MC production and Microcystis colony size. In this study, we classified Microcystis collected from Zhushan Bay of Lake Taihu during blooms into four classes with size of <50 µm, 50-100 µm, 100-270 µm and >270 µm and studied their differences in MC production and genetic structure. The results showed that colonies with size of <50, 50-100, 100-270 and >270 µm produced 12.2 ± 11.2%, 19.5 ± 7.9%, 61.3 ± 12.6%, and 7.0 ± 9.6% of total MC, respectively. The proportion of cell density of colonies with size of 50-100, 100-270 and >270 µm was positively correlated with MC concentration during blooms, while that of colonies with size of <50 µm was negatively correlated. The MC cell quota tended to be higher during blooms in colonies with larger size except that of colonies with size of 100-270 µm was higher than that of colonies with size of >270 µm from June 11 to September 16. Colonies with size of <50 µm showed the highest proportion of the less toxic MC congener MC-RR, and colonies with size of >100 µm showed higher proportion of the most toxic MC congener MC-LR than colonies with size of <100 µm. Real-time PCR indicated that larger colonies had higher proportion of potential toxic genotype. Principal component analysis of PCR-denaturing gradient gel electrophoresis profile showed that cpcBA and mcyJ genotype compositions were different between colonies with size of <50 µm and colonies with size of >50 µm, and cpcBA genotype composition was also different among colonies with size of 50-100 µm, 100-270 µm and >270 µm. These results indicated that MC cell quota and congener composition were different in Microcystis colonies with different sizes in Lake Taihu during blooms, and the differences in MC production in colonies with different size resulted chiefly from the difference in their genotype composition. Therefore, the authorities of water quality monitoring and drinking water supply service in Lake Taihu should be alert that the toxicity of Microcystis colony with different size was different during blooms, and the high abundance of colonies larger than 50 µm could be an indicator of relatively high bloom toxicity.

Effect of berberine on expression of hepatocyte nuclear factor-4alpha in rats with fructose-induced insulin resistance.

The effects of berberine on the expression of hepatocyte nuclear factor-4alpha (HNF-4alpha) in liver of rats with fructose-induced insulin resistance and the molecular mechanism of berberine preventing insulin resistance were investigated. The experimental animals were divided into two groups of 16 animals each. The control group received a control routine diet containing 60% carbohydrate, and the study group a high-fructose diet containing 60% fructose as the sole source of carbohydrate. At the end of 6 weeks these were each subdivided into two groups. One was administered with berberine [187.5 mg/(kg x d) in 5 g/L carboxymethyl cellulose] by intragastric intubation and the other group was treated with a vehicle (5 g/L carboxymethyl cellulose). The rats were fed on the same dietary regimen for the next 4 weeks. After the experimental period of 10 weeks, plasma glucose, insulin and triglyceride levels were measured. HOMA insulin resistance index (HOMA-IR) was assayed. Immunohistochemistry, semiquantitative RT-PCR and western blot were used to detect the expression of HNF-4alpha in liver. Compared with control diet, fructose feeding induced hyperinsulinemia, HOMA-IR and increased triglyceride (all P<0.01). Berberine prevented the rise in plasma insulin (P<0.01), HOMA-IR (P<0.01) and triglyceride (P<0.05) in the fructose-fed rats. No change in plasma glucose was seen among these groups. The mRNA and protein expression of HNF-4alpha was decreased in the fructose-fed rats, but berberine could promote its expression. It was concluded that berberine could prevent fructose-induced insulin resistance in rats possibly by promoting the expression HNF-4alpha in liver.