Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 265
Filtrar
1.
World J Psychiatry ; 14(8): 1165-1173, 2024 Aug 19.
Artigo em Inglês | MEDLINE | ID: mdl-39165558

RESUMO

Patients with hematological tumors experience physical and psychological stress, and negative psychological states. Baduanjin, an emerging psychological rehabilitation method combined with resistance exercise, has received widespread attention. This study reviews the current status of the application of Baduanjin combined with resistance exercise in improving the negative psychological state of patients with hematological tumors and discusses its problems and prospects. Through a literature review and comprehensive analysis, the application of Baduanjin and resistance exercise in the psychological rehabilitation of patients with hematological tumors was identified and evaluated. The results showed that Baduanjin with resistance exercise had a positive effect on improving negative psychological states of patients with hematological tumors, which can alleviate anxiety, depression, and other adverse emotions, and improve quality of life. However, there is a lack of unified and standardized exercise intervention programs for practical application, and patient participation and compliance must be improved. Baduanjin combined with resistance exercise can potentially improve the negative psychological status of patients with hematological tumors; however, it is still necessary to further standardize and improve the exercise program improving patient participation and compliance. Future studies should strengthen theoretical exploration and empirical research, providing more effective psychological rehabilitation strategies for patients with hematological tumors.

2.
Chin J Integr Med ; 2024 Aug 21.
Artigo em Inglês | MEDLINE | ID: mdl-39167283

RESUMO

OBJECTIVE: To investigate potential mechanisms of anti-atherosclerosis by berberine (BBR) using ApoE-/- mice. METHODS: Eight 8-week-old C57BL/6J mice were used as a blank control group (normal), and 56 8-week-old AopE-/- mice were fed a high-fat diet for 12 weeks, according to a completely random method, and were divided into the model group, BBR low-dose group (50 mg/kg, BBRL), BBR medium-dose group (100 mg/kg, BBRM), BBR high-dose group (150 mg/kg, BBRH), BBR+nuclear factor erythroid 2-related factor 2 (NRF2) inhibitor group (100 mg/kg BBR+30 mg/kg ML385, BBRM+ML385), NRF2 inhibitor group (30 mg/kg, ML385), and positive control group (2.5 mg/kg, atorvastatin), 8 in each group. After 4 weeks of intragastric administration, samples were collected and serum, aorta, heart and liver tissues were isolated. Biochemical kits were used to detect serum lipid content and the expression levels of malondialdehyde (MDA) and superoxide dismutase (SOD) in all experimental groups. The pathological changes of atherosclerosis (AS) were observed by aorta gross Oil Red O, aortic sinus hematoxylin-eosin (HE) and Masson staining. Liver lipopathy was observed in mice by HE staining. The morphology of mitochondria in aorta cells was observed under transmission electron microscope. Flow cytometry was used to detect reactive oxygen species (ROS) expression in aorta of mice in each group. The content of ferrous ion Fe2+ in serum of mice was detected by biochemical kit. The mRNA and protein relative expression levels of NRF2, glutathione peroxidase 4 (GPX4) and recombinant solute carrier family 7 member 11 (SLC7A11) were detected by quantitative real time polymerase chain reaction (RT-qPCR) and Western blot, respectively. RESULTS: BBRM and BBRH groups delayed the progression of AS and reduced the plaque area (P<0.01). The characteristic morphological changes of ferroptosis were rarely observed in BBR-treated AS mice, and the content of Fe2+ in BBR group was significantly lower than that in the model group (P<0.01). BBR decreased ROS and MDA levels in mouse aorta, increased SOD activity (P<0.01), significantly up-regulated NRF2/SLC7A11/GPX4 protein and mRNA expression levels (P<0.01), and inhibited lipid peroxidation. Compared with the model group, the body weight, blood lipid level and aortic plaque area of ML385 group increased (P<0.01); the morphology of mitochondria showed significant ferroptosis characteristics; the serum Fe2+, MDA and ROS levels increased (P<0.05 or P<0.01), and the activity of SOD decreased (P<0.01). Compared with BBRM group, the iron inhibition effect of BBRM+ML385 group was significantly weakened, and the plaque area significantly increased (P<0.01). CONCLUSION: Through NRF2/SLC7A11/GPX4 pathway, BBR can resist oxidative stress, inhibit ferroptosis, reduce plaque area, stabilize plaque, and exert anti-AS effects.

3.
J Agric Food Chem ; 2024 Aug 29.
Artigo em Inglês | MEDLINE | ID: mdl-39205635

RESUMO

Phellinus igniarius is a commonly used Chinese medicine fungus, and its polysaccharide is a valuable bioactive with antioxidant, antiaging, antitumor activities, etc. However, their bioactivities are influenced by their structural and physicochemical properties. Hence, this research isolated and purified homogeneous water-soluble intracellular polysaccharide (IPSW-1) from P. igniarius mycelia. A coherent study of its structural characteristics, conformation, and antitumor mechanisms was evaluated. The results showed IPSW-1 has no triple helical conformation according to the Congo red test. Based on FT-IR, periodate oxidation, Smith degradation, methylation analysis, 1H and 13C NMR spectroscopy data, and IPSW-1 consisted of α-d-glucopyranose (Glcp). The backbone of IPSW-1 consisted primarily of repeating three (1 → 6)-linked α-d-Glcp and one (1 → 3,4)-linked α-d-Glcp, with one terminal α-d-Glcp as side chains of 3-O-connected to the main chain for every four residues. The IPSW-1 had an inhibitory influence on HepG2 cell proliferation and inhibited the migration and invasion ability by down-regulating the expression levels of MMP-7 and RhoA. Moreover, IPSW-1 could inhibit the lysis of autophagosomes to inhibit autophagy and regulate mitochondrial membrane potential and pro-apoptotic protein Bax, which causes the caspase cascade to promote apoptosis, thereby inhibiting the role of tumor cells. These findings show IPSW-1 holds potential as an innovative functional food.

4.
Food Res Int ; 190: 113905, 2024 Aug.
Artigo em Inglês | MEDLINE | ID: mdl-38945555

RESUMO

Bee bread is a product of honeybees, which collect and ferment pollen, that contains highly nutritious and easily digestible active substances. However, its nutritional composition varies significantly with fermentation strains and seasonal changes. To unveil the patterns of microbial community and nutritional component changes in bee bread across seasons, we employed high-throughput techniques to assess the diversity of bacteria and fungi in bee bread. The results indicated that the compositions of bacteria and fungi in bee bread undergo significant seasonal variation, with noticeable changes in the microbial diversity of bee bread from different bee species. Subsequently, metabolomic analysis revealed high activity of glycerophospholipid metabolism in bee bread. Furthermore, our analysis identifaied noteworthy differences in nutritional components, including pH values, sugar content, and free amino acid levels, in bee bread across different seasons.


Assuntos
Bactérias , Microbiota , Valor Nutritivo , Estações do Ano , Abelhas/microbiologia , Animais , Bactérias/classificação , Fermentação , Aminoácidos/análise , Fungos/classificação , Pólen/química , Pão/análise , Pão/microbiologia , Concentração de Íons de Hidrogênio , Metabolômica
5.
Insect Sci ; 2024 Jun 16.
Artigo em Inglês | MEDLINE | ID: mdl-38880966

RESUMO

The tetraspanin gene family encodes cell-surface proteins that span the membrane 4 times and play critical roles in a wide range of biological processes across numerous organisms. Recent findings highlight the involvement of a tetraspanin of the lepidopteran pest Helicoverpa armigera in resistance to Bacillus thuringiensis Cry insecticidal proteins, which are extensively used in transgenic crops. Thus, a better understanding of lepidopteran tetraspanins is urgently needed. In the current study, genome scanning in 10 lepidopteran species identified a total of 283 sequences encoding potential tetraspanins. Based on conserved cysteine patterns in the large extracellular loop and their phylogenetic relationships, these tetraspanins were classified into 8 subfamilies (TspA to TspH). Six ancestral introns were identified within lepidopteran tetraspanin genes. Tetraspanins in TspA, TspB, TspC, and TspD subfamilies exhibit highly similar gene organization, while tetraspanins in the remaining 4 subfamilies exhibited variation in intron loss and/or gain during evolution. Analysis of chromosomal distribution revealed a lepidopteran-specific cluster of 10 to 11 tetraspanins, likely formed by tandem duplication events. Selective pressure analysis indicated negative selection across all orthologous groups, with ω values ranging between 0.004 and 0.362. However, positive selection was identified at 18 sites within TspB5, TspC5, TspE3, and TspF10. Furthermore, spatiotemporal expression analysis of H. armigera tetraspanins demonstrated variable expression levels across different developmental stages and tissues, suggesting diverse functions of tetraspanin members in this globally important insect pest. Our findings establish a solid foundation for subsequent functional investigations of tetraspanins in lepidopteran species.

6.
iScience ; 27(5): 109733, 2024 May 17.
Artigo em Inglês | MEDLINE | ID: mdl-38689641

RESUMO

Intervertebral disc is a highly rhythmical tissue. As a key factor linking biorhythm and inflammatory response, the shielding effect of NR1D1 in the process of intervertebral disc degeneration remains unclear. Here, we first confirmed that NR1D1 in the nucleus pulposus tissue presents periodic rhythmic changes and decreases in expression with intervertebral disc degeneration. Second, when NR1D1 was activated by SR9009 in vitro, NLRP3 inflammasome assembly and IL-1ß production were inhibited, while ECM synthesis was increased. Finally, the vivo experiments further confirmed that the activation of NR1D1 can delay the process of disc degeneration to a certain extent. Mechanistically, we demonstrate that NR1D1 can bind to IL-1ß and NLRP3 promoters, and that the NR1D1/NLRP3/IL-1ß pathway is involved in this process. Our results demonstrate that the activation of NR1D1 can effectively reduce IL-1ß secretion, alleviate LPS-induced NPMSC pyroptosis, and protect ECM degeneration.

7.
Exp Ther Med ; 27(6): 270, 2024 Jun.
Artigo em Inglês | MEDLINE | ID: mdl-38756899

RESUMO

Inherited neuromuscular disorder (IND) is a broad-spectrum, clinically diverse group of diseases that are caused due to defects in the neurosystem, muscles and related tissue. Since IND may originate from mutations in hundreds of different genes, the resulting heterogeneity of IND is a great challenge for accurate diagnosis and subsequent management. Three pediatric cases with IND were enrolled in the present study and subjected to a thorough clinical examination. Next, a genetic investigation was conducted using whole-exome sequencing (WES). The suspected variants were validated through Sanger sequencing or quantitative fluorescence PCR assay. A new missense variant of the Spastin (SPAST) gene was found and analyzed at the structural level using molecular dynamics (MD) simulations. All three cases presented with respective specific clinical manifestations, which reflected the diversity of IND. WES detected the diagnostic variants in all 3 cases: A compound variation comprising collagen type VI α3 chain (COL6A3) (NM_004369; exon19):c.6322G>T(p.E1208*) and a one-copy loss of COL6A3:exon19 in Case 1, which are being reported for the first time; a de novo SPAST (NM_014946; exon8):c.1166C>A(p.T389K) variant in Case 2; and a de novo Duchenne muscular dystrophy (NM_004006; exon11):c.1150-17_1160delACTTCCTTCTTTGTCAGGGGTACATGATinsC variant in Case 3. The structural and MD analyses revealed that the detected novel SPAST: c.1166C>A(p.T389K) variant mainly altered the intramolecular hydrogen bonding status and the protein segment's secondary structure. In conclusion, the present study expanded the IND mutation spectrum. The study not only detailed the precise diagnoses of these cases but also furnished substantial grounds for informed consultations. The approach involving the genetic evaluation strategy using WES for variation screening followed by validation using appropriate methods is beneficial due to the considerable heterogeneity of IND.

8.
Carbohydr Res ; 540: 109121, 2024 Jun.
Artigo em Inglês | MEDLINE | ID: mdl-38692248

RESUMO

Precise and selective modification of carbohydrates is a critical strategy in producing diverse carbohydrate derivatives for exploiting their functions. We disclosed a simple, efficient, and highly regioselective and stereoselective protocol to controllable amination of 2-nitroglycals under mild conditions in 5 min. A range of 3-amino-carbohydrates including 3-arylamino-2-nitro-glycals and 1,3-di-amino-carbohydrate derivatives were obtained in good to excellent yield with excellent stereoselectivity. The produced 3-amino-2-nitro-glycals can be used as a precursor for further transformation.


Assuntos
Nitrocompostos , Aminação , Estereoisomerismo , Estrutura Molecular , Nitrocompostos/química , Nitrocompostos/síntese química , Carboidratos/química , Carboidratos/síntese química
9.
JACS Au ; 4(3): 974-984, 2024 Mar 25.
Artigo em Inglês | MEDLINE | ID: mdl-38559736

RESUMO

The selective modification of carbohydrates is significant for producing their unnatural analogues for drug discovery. C1-functionalization (glycosylation) and C1,C2-difunctionalization of carbohydrates have been well developed. In contrast, C3-functionalization or C1,C3-difunctionalization of carbohydrates remains rare. Herein, we report such processes that efficiently and stereoselectively modify carbohydrates. Specifically, we found that trifluoroethanol (TFE) could promote 1,3-bis-indolylation/pyrrolylation of 2-nitroglycals generated carbohydrate derivatives in up to 93% yield at room temperature; slightly reducing the temperature could install two different indoles at the C1- and C3-positions. Switching TFE to a bifunctional amino thiourea catalyst leads to the generation of C3 monosubstituted carbohydrates, which could also be used to construct 1,3-di-C-functionalized carbohydrates. This approach produced a range of challenging sugar derivatives (over 80 examples) with controllable and high stereoselectivity (single isomer for over 90% of the examples). The potential applications of the reaction were demonstrated by a set of transformations including the synthesis of bridged large-ring molecules and gram scale reactions. Biological activities evaluation demonstrated that three compounds exhibit a potent inhibitory effect on human cancer cells T24, HCT116, AGS, and MKN-45 with IC50 ranged from 0.695 to 3.548 µM.

10.
Molecules ; 29(6)2024 Mar 11.
Artigo em Inglês | MEDLINE | ID: mdl-38542881

RESUMO

RNAs play crucial roles in various essential biological functions, including catalysis and gene regulation. Despite the widespread use of coarse-grained (CG) models/simulations to study RNA 3D structures and dynamics, their direct application is challenging due to the lack of atomic detail. Therefore, the reconstruction of full atomic structures is desirable. In this study, we introduced a straightforward method called ABC2A for reconstructing all-atom structures from RNA CG models. ABC2A utilizes diverse nucleotide fragments from known structures to assemble full atomic structures based on the CG atoms. The diversification of assembly fragments beyond standard A-form ones, commonly used in other programs, combined with a highly simplified structure refinement process, ensures that ABC2A achieves both high accuracy and rapid speed. Tests on a recent large dataset of 361 RNA experimental structures (30-692 nt) indicate that ABC2A can reconstruct full atomic structures from three-bead CG models with a mean RMSD of ~0.34 Å from experimental structures and an average runtime of ~0.5 s (maximum runtime < 2.5 s). Compared to the state-of-the-art Arena, ABC2A achieves a ~25% improvement in accuracy and is five times faster in speed.


Assuntos
Simulação de Dinâmica Molecular , RNA , RNA/química , Nucleotídeos
11.
Sci Rep ; 14(1): 6390, 2024 03 16.
Artigo em Inglês | MEDLINE | ID: mdl-38493212

RESUMO

The immune infiltration profiles of the tumor microenvironment have effects on the prognosis of head and neck squamous cell carcinoma (HNSCC). Whereas, HNSCC is a heterogeneous group of tumors, but past work has not taken this into consideration. Herein, we investigate the associations between survival and the function of immune cells in different tumorigenic sites of HNSCC. 1149 samples of HNSCC were collected from publicly accessible databases. Based on gene expression data, CIBERSORTx was applied to determine the proportion of 22 immune cell subpopulations. In the Cox regression model, the associations between overall survival, disease-free survival, and immune cells were examined, modeling gene expression and immune cell proportion as quartiles. Consensus cluster analysis was utilized to uncover immune infiltration profiles. Regardless of tumor sites, CD8+ T cells and activated CD4 memory T cells were associated with favorable survival, while eosinophils were the opposite. The survival of the hypopharynx, oral cavity, and larynx subsites was somewhat affected by immune cells, while the survival of the oropharynx subsite potentially was the most impacted. High expression of TIGIT, CIITA, and CXCR6 was linked to better survival, mainly in the oropharynx subsite. Immune cell clusters with four distinct survival profiles were discovered, of which the cluster with a high CD8+ T cell content had a better prognosis. The immune-infiltration pattern is related to the survival of HNSCC to varying degrees depending on the tumor sites; forthcoming studies into immune-mediated infiltration profiles will lay the groundwork for treating HNSCC with precision therapy.


Assuntos
Neoplasias de Cabeça e Pescoço , Humanos , Carcinoma de Células Escamosas de Cabeça e Pescoço , Estudos Retrospectivos , Prognóstico , Linfócitos T CD8-Positivos , Microambiente Tumoral
12.
Pediatr Neonatol ; 2024 Mar 15.
Artigo em Inglês | MEDLINE | ID: mdl-38523015

RESUMO

OBJECTIVE: To study the relationship between umbilical cord blood vitamin A (VA) and neonatal lung diseases and explore the impact of umbilical cord blood VA on neonatal lung diseases. METHOD: Umbilical vein blood was collected at birth, and its VA content was measured. According to the VA levels in umbilical cord blood, a VA deficiency (VAD) group, a marginal deficiency group and a normal group were created and followed up until 28 days after birth. RESULTS: The umbilical cord blood VA level in the neonatal group with lung disease was 0.13 ± 0.05 mg/L, while the result for the VA level in the non-lung disease group was 0.15 ± 0.05 mg/L. The umbilical cord blood VA levels in the neonatal lung disease group were significantly lower than those in the non-lung disease group. The incidence of neonatal pulmonary diseases was highest in the VAD group, and the incidence decreased as the level of VA in umbilical cord blood increased. Umbilical cord blood VAD and premature birth were found to be independent risk factors for neonatal respiratory disease. CONCLUSION: Umbilical cord blood VAD and premature birth are independent risk factors for neonatal pulmonary diseases. The lower the level of VA in umbilical cord blood, the more susceptible infants will be to neonatal respiratory infections in the neonatal period.

13.
Mol Genet Genomic Med ; 12(3): e2401, 2024 Mar.
Artigo em Inglês | MEDLINE | ID: mdl-38444278

RESUMO

BACKGROUND: The MYH3-associated myosinopathies comprise a spectrum of rare neuromuscular disorders mainly characterized by distal arthrogryposis with or without other features like pterygia and vertebrae fusion. CPSKF1B (contractures, pterygia, and spondylocarpotarsal fusion syndrome1B) is the only known autosomal recessiveMYH3-associated myosinopathy so far, with no more than two dozen cases being reported. MATERIALS AND METHODS: A boy with CPSKF1B was recruited and subjected to a comprehensive clinical and imaging evaluation. Genetic detection with whole-exome sequencing (WES) was performed on the patient and extended family members to identify the causative variation. A series of in silico and in vitro investigations were carried out to verify the pathogenicity of the two variants of the identified compound heterozygous variation. RESULTS: The patient exhibited moderate CPSKF1B symptoms including multiarticular contractures, webbed neck, and spondylocarpotarsal fusion. WES detected a compound heterozygous MYH3 variation consisting of two variants, namely NM_002470.4: c.3377A>G; p. (E1126G) and NM_002470.4: c.5161-2A>C. It was indicated that the NM_002470.4: c.3377A>G; p. (E1126G) variant mainly impaired the local hydrogen bond formation and impacted the TGF-B pathway, while the NM_002470.4: c.5161-2A>C variant could affect the normal splicing of pre-mRNA, resulting in the appearance of multiple abnormal transcripts. CONCLUSIONS: The findings of this study expanded the mutation spectrum of CPSKF1B, provided an important basis for the counseling of the affected family, and also laid a foundation for the functional study of MYH3 mutations.


Assuntos
Artrogripose , Túnica Conjuntiva , Contratura , Pterígio , Humanos , Masculino , Artrogripose/genética , Túnica Conjuntiva/anormalidades , Contratura/genética , Família
14.
World J Clin Cases ; 12(3): 538-550, 2024 Jan 26.
Artigo em Inglês | MEDLINE | ID: mdl-38322463

RESUMO

BACKGROUND: The incidence of chronic kidney disease among patients with diabetes mellitus (DM) remains a global concern. Long-term obesity is known to possibly influence the development of type 2 diabetes mellitus. However, no previous meta-analysis has assessed the effects of body mass index (BMI) on adverse kidney events in patients with DM. AIM: To determine the impact of BMI on adverse kidney events in patients with DM. METHODS: A systematic literature search was performed on the PubMed, ISI Web of Science, Scopus, Ovid, Google Scholar, EMBASE, and BMJ databases. We included trials with the following characteristics: (1) Type of study: Prospective, retrospective, randomized, and non-randomized in design; (2) participants: Restricted to patients with DM aged ≥ 18 years; (3) intervention: No intervention; and (4) kidney adverse events: Onset of diabetic kidney disease [estimated glomerular filtration rate (eGFR) of < 60 mL/min/1.73 m2 and/or microalbuminuria value of ≥ 30 mg/g Cr], serum creatinine increase of more than double the baseline or end-stage renal disease (eGFR < 15 mL/min/1.73 m2 or dialysis), or death. RESULTS: Overall, 11 studies involving 801 patients with DM were included. High BMI (≥ 25 kg/m2) was significantly associated with higher blood pressure (BP) [systolic BP by 0.20, 95% confidence interval (CI): 0.15-0.25, P < 0.00001; diastolic BP by 0.21 mmHg, 95%CI: 0.04-0.37, P = 0.010], serum albumin, triglycerides [standard mean difference (SMD) = 0.35, 95%CI: 0.29-0.41, P < 0.00001], low-density lipoprotein (SMD = 0.12, 95%CI: 0.04-0.20, P = 0.030), and lower high-density lipoprotein (SMD = -0.36, 95%CI: -0.51 to -0.21, P < 0.00001) in patients with DM compared with those with low BMIs (< 25 kg/m2). Our analysis showed that high BMI was associated with a higher risk ratio of adverse kidney events than low BMI (RR: 1.22, 95%CI: 1.01-1.43, P = 0.036). CONCLUSION: The present analysis suggested that high BMI was a risk factor for adverse kidney events in patients with DM.

15.
Medicine (Baltimore) ; 103(8): e34654, 2024 Feb 23.
Artigo em Inglês | MEDLINE | ID: mdl-38394545

RESUMO

BACKGROUND: The research on the relationship between the Braf Proto-oncogene (BRAF) mutation and lung cancer has generated conflicting findings. Nevertheless, there is an argument suggesting that assessing the BRAF status could offer benefits in terms of managing and prognosing individuals with non-small cell lung cancer (NSCLC). To present a comprehensive overview of this subject, we undertook an up-to-date meta-analysis of pertinent publications. METHODS: We conducted an extensive literature search utilizing Medical Subject Headings keywords, namely "BRAF", "mutation", "lung", "tumor", "NSCLC", and "neoplasm", across multiple databases, including PubMed, EMBASE, ISI Science Citation Index, and CNKI. For each study, we calculated and evaluated the odds ratio and confidence interval, focusing on the consistency of the eligible research. RESULTS: The meta-analysis unveiled a noteworthy correlation between BRAF mutation and lung cancer. No significant evidence was found regarding the connection between smoking and staging among individuals with BRAF mutations. Furthermore, a substantial disparity in the rate of BRAF mutations was observed between males and females. CONCLUSION: Our meta-analysis revealed a significant correlation between BRAF mutations and NSCLC. Moreover, we observed a higher incidence of BRAF lung mutations in females compared to males. Additionally, the BRAFV600E mutation was found to be more prevalent among female patients and nonsmokers.


Assuntos
Carcinoma Pulmonar de Células não Pequenas , Neoplasias Pulmonares , Masculino , Humanos , Feminino , Carcinoma Pulmonar de Células não Pequenas/genética , Neoplasias Pulmonares/genética , Proteínas Proto-Oncogênicas B-raf/genética , Mutação , Fumar/epidemiologia , Fumar/genética
16.
Aging (Albany NY) ; 16(2): 1555-1580, 2024 01 17.
Artigo em Inglês | MEDLINE | ID: mdl-38240717

RESUMO

Genome-wide association studies (GWAS) have identified multiple risk variants for Parkinson's disease (PD). Nevertheless, how the risk variants confer the risk of PD remains largely unknown. We conducted a proteome-wide association study (PWAS) and summary-data-based mendelian randomization (SMR) analysis by integrating PD GWAS with proteome and protein quantitative trait loci (pQTL) data from human brain, plasma and CSF. We also performed a large transcriptome-wide association study (TWAS) and Fine-mapping of causal gene sets (FOCUS), leveraging joint-tissue imputation (JTI) prediction models of 22 tissues to identify and prioritize putatively causal genes. We further conducted PWAS, SMR, TWAS, and FOCUS using a multi-trait analysis of GWAS (MTAG) to identify additional PD risk genes to boost statistical power. In this large-scale study, we identified 16 genes whose genetically regulated protein abundance levels were associated with Parkinson's disease risk. We undertook a large-scale analysis of PD and correlated traits, through TWAS and FOCUS studies, and discovered 26 casual genes related to PD that had not been reported in previous TWAS. 5 genes (CD38, GPNMB, RAB29, TMEM175, TTC19) showed significant associations with PD at both the proteome-wide and transcriptome-wide levels. Our study provides new insights into the etiology and underlying genetic architecture of PD.


Assuntos
Doença de Parkinson , Transcriptoma , Humanos , Estudo de Associação Genômica Ampla , Proteoma/genética , Predisposição Genética para Doença , Doença de Parkinson/genética , Polimorfismo de Nucleotídeo Único , Glicoproteínas de Membrana/genética
17.
Anticancer Drugs ; 35(1): 109-115, 2024 01 01.
Artigo em Inglês | MEDLINE | ID: mdl-37578745

RESUMO

Despite the initial promise of epidermal growth factor receptor-tyrosine kinase inhibitors (EGFR-TKIs) in effectively combating tumor growth, the majority of patients with advanced non-small cell lung cancers (NSCLCs) inevitably develop resistance to these treatments. An infrequent genetic mutation known as BRAFV600E has been identified as a contributing factor to the emergence of acquired resistance to EGFR-TKIs. Genetic alterations in BRAF, particularly V600E, contribute to resistance to osimertinib. However, a combination therapy involving osimertinib, dabrafenib (a BRAF inhibitor), and trametinib has shown effectiveness in overcoming BRAF V600E-mediated resistance in advanced lung adenocarcinoma. This treatment regimen holds promise for similar cases. In our case report, the combination of osimertinib, dabrafenib, and trametinib effectively overcame osimertinib resistance and resulted in sustained partial remission.


Assuntos
Neoplasias Pulmonares , Humanos , Neoplasias Pulmonares/tratamento farmacológico , Neoplasias Pulmonares/genética , Neoplasias Pulmonares/patologia , Proteínas Proto-Oncogênicas B-raf/genética , Compostos de Anilina , Inibidores de Proteínas Quinases/farmacologia , Inibidores de Proteínas Quinases/uso terapêutico , Mutação , Receptores ErbB/genética , Resistencia a Medicamentos Antineoplásicos
18.
Cell Death Dis ; 14(12): 811, 2023 12 09.
Artigo em Inglês | MEDLINE | ID: mdl-38071340

RESUMO

Pancreatic cancer is highly lethal, of which 90% is pancreatic ductal adenocarcinoma (PDAC), with a 5-year survival rate of less than 12%, lacking effective treatment options and late diagnosis. Furthermore, the tumors show an intense resistance to cytotoxic chemotherapies. As autophagy is elevated in PDAC, targeting the autophagic pathway is regarded as a promising strategy for cancer treatment. Immunofluorescence and transmission electron microscopy were utilized to assess the autophagic flux. Label-free quantitative phosphoproteomics was used to figure out critically altered tyrosine phosphorylation of the proteins. Tumor-bearing mice were used to validate that SH2 TrM-(Arg)9 restrained the growth of tumor cells. SH2 TrM-(Arg)9 inhibited collagen-induced autophagy via blocking the DDR1/PYK2/ERK signaling cascades. SH2 TrM-(Arg)9 improved the sensitivity of PANC-1/GEM cells to gemcitabine (GEM). Inhibition of autophagy by SH2 TrM-(Arg)9 may synergized with chemotherapy and robusted tumor suppression in pancreatic cancer xenografts. SH2 TrM-(Arg)9 could enter into PDAC cells and blockade autophagy through inhibiting DDR1/PYK2/ERK signaling and may be a new treatment strategy for targeted therapy of PDAC.


Assuntos
Carcinoma Ductal Pancreático , Neoplasias Pancreáticas , Humanos , Animais , Camundongos , Quinase 2 de Adesão Focal/metabolismo , Neoplasias Pancreáticas/patologia , Carcinoma Ductal Pancreático/patologia , Transdução de Sinais , Autofagia , Linhagem Celular Tumoral , Receptor com Domínio Discoidina 1/metabolismo
19.
J Orthop Translat ; 43: 66-84, 2023 Nov.
Artigo em Inglês | MEDLINE | ID: mdl-38089645

RESUMO

Background: The changes in the microenvironment of degenerative intervertebral discs cause oxidative stress injury and excessive apoptosis of intervertebral disc endogenous stem cells. The purpose of this study was to explore the possible mechanism of the protective effect of melatonin on oxidative stress injury in NPMSCs induced by H2O2. Methods: The Cell Counting Kit-8 assay was used to evaluate the cytotoxicity of hydrogen peroxide and the protective effects of melatonin. ROS content was detected by 2'7'-dichlorofluorescin diacetate (DCFH-DA). Mitochondrial membrane potential (MMP) was detected by the JC-1assay. Transferase mediated d-UTP Nick end labeling (TUNEL) and Annexin V/PI double staining were used to determine the apoptosis rate. Additionally, apoptosis-associated proteins and PI3K/Akt signaling pathway-related proteins were evaluated by immunofluorescence, immunoblotting and PCR. ECMs were evaluated by RT‒PCR and immunofluorescence. In vivo, X-ray, Magnetic resonance imaging (MRI) and Histological analyses were used to evaluate the protective effect of melatonin. Results: Melatonin had an obvious protective effect on NPMSCs treated with 0-10 µM melatonin for 24 h. In addition, melatonin also had obvious protective effects on mitochondrial dysfunction, decreased membrane potential and cell senescence induced by H2O2. More importantly, melatonin could significantly reduce the apoptosis of nucleus pulposus mesenchymal stem cells induced by H2O2 by regulating the expression of apoptosis-related proteins and decreasing the rate of apoptosis. After treatment with melatonin, the PI3K/Akt pathway was significantly activated in nucleus pulposus mesenchymal stem cells, while the protective effect was significantly weakened after PI3K-IN-1 treatment. In vivo, the results of X-ray, MRI and histological analyses showed that therapy with melatonin could partially reduce the degree of intervertebral disc degeneration. Conclusion: Our research demonstrated that melatonin can effectively alleviate the excessive apoptosis and mitochondrial dysfunction of nucleus pulposus mesenchymal stem cells induced by oxidative stress via the PI3K/Akt pathway, which provides a novel idea for the therapy of intervertebral disc degeneration. The translational potential of this article: This study indicates that melatonin can effectively alleviate the excessive apoptosis and mitochondrial dysfunction of NPMSCs through activating the PI3K/Akt pathway. Melatonin might serve as a promising candidate for the prevention and treatment of Intervertebral disc degeneration disease (IVDD) in the future.

20.
Front Microbiol ; 14: 1253239, 2023.
Artigo em Inglês | MEDLINE | ID: mdl-38116531

RESUMO

During the survey on freshwater hyphomycetes in Guangxi, Guizhou and Hainan Provinces, China, five fresh collections were encountered. Based on their morphology, these five isolates were identified as belonging to Hermatomyces, Kirschsteiniothelia, Paramonodictys, Pleopunctum and Sparticola. Multi-gene phylogenetic analyses were performed for each genus, which resulted in the identification of five new species, namely Hermatomyces hainanensis, Kirschsteiniothelia ramus, Paramonodictys globosa, Pleopunctum guizhouense, and Sparticola irregularis. Detailed descriptions and illustrations of the morphological characteristics of these new taxa were provided. This research enriches the biodiversity of freshwater dematiaceous hyphomycetes.

SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA